ID: 1086399533 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:86449073-86449095 |
| Sequence | AGCTTCCTATTGTTCCATAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 124 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 111} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1086399533_1086399535 | -9 | Left | 1086399533 | 11:86449073-86449095 | CCCATATGGAACAATAGGAAGCT | 0: 1 1: 0 2: 1 3: 11 4: 111 |
||
| Right | 1086399535 | 11:86449087-86449109 | TAGGAAGCTCAGTTCTGCTGAGG | 0: 1 1: 0 2: 3 3: 24 4: 193 |
||||
| 1086399533_1086399536 | 8 | Left | 1086399533 | 11:86449073-86449095 | CCCATATGGAACAATAGGAAGCT | 0: 1 1: 0 2: 1 3: 11 4: 111 |
||
| Right | 1086399536 | 11:86449104-86449126 | CTGAGGATCTCTGCCATTCTTGG | 0: 1 1: 0 2: 1 3: 16 4: 192 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1086399533 | Original CRISPR | AGCTTCCTATTGTTCCATAT GGG (reversed) | Intronic | ||