ID: 1086399533

View in Genome Browser
Species Human (GRCh38)
Location 11:86449073-86449095
Sequence AGCTTCCTATTGTTCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399533_1086399535 -9 Left 1086399533 11:86449073-86449095 CCCATATGGAACAATAGGAAGCT 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399533_1086399536 8 Left 1086399533 11:86449073-86449095 CCCATATGGAACAATAGGAAGCT 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1086399536 11:86449104-86449126 CTGAGGATCTCTGCCATTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399533 Original CRISPR AGCTTCCTATTGTTCCATAT GGG (reversed) Intronic