ID: 1086399534

View in Genome Browser
Species Human (GRCh38)
Location 11:86449074-86449096
Sequence GAGCTTCCTATTGTTCCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 96}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399534_1086399536 7 Left 1086399534 11:86449074-86449096 CCATATGGAACAATAGGAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1086399536 11:86449104-86449126 CTGAGGATCTCTGCCATTCTTGG 0: 1
1: 0
2: 1
3: 16
4: 192
1086399534_1086399535 -10 Left 1086399534 11:86449074-86449096 CCATATGGAACAATAGGAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399534 Original CRISPR GAGCTTCCTATTGTTCCATA TGG (reversed) Intronic