ID: 1086399535

View in Genome Browser
Species Human (GRCh38)
Location 11:86449087-86449109
Sequence TAGGAAGCTCAGTTCTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086399532_1086399535 -8 Left 1086399532 11:86449072-86449094 CCCCATATGGAACAATAGGAAGC 0: 1
1: 1
2: 1
3: 10
4: 179
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399534_1086399535 -10 Left 1086399534 11:86449074-86449096 CCATATGGAACAATAGGAAGCTC 0: 1
1: 0
2: 0
3: 11
4: 96
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399527_1086399535 24 Left 1086399527 11:86449040-86449062 CCAAGGCTAAGTTCCTTTCAGCA 0: 1
1: 1
2: 0
3: 19
4: 197
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399529_1086399535 11 Left 1086399529 11:86449053-86449075 CCTTTCAGCAGAAATCTGGCCCC 0: 1
1: 0
2: 8
3: 116
4: 509
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193
1086399533_1086399535 -9 Left 1086399533 11:86449073-86449095 CCCATATGGAACAATAGGAAGCT 0: 1
1: 0
2: 1
3: 11
4: 111
Right 1086399535 11:86449087-86449109 TAGGAAGCTCAGTTCTGCTGAGG 0: 1
1: 0
2: 3
3: 24
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086399535 Original CRISPR TAGGAAGCTCAGTTCTGCTG AGG Intronic