ID: 1086400779

View in Genome Browser
Species Human (GRCh38)
Location 11:86459592-86459614
Sequence TAGTACCACCAGAATGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086400779_1086400783 30 Left 1086400779 11:86459592-86459614 CCCTGACCATTCTGGTGGTACTA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1086400783 11:86459645-86459667 TTAAGTCCATTTTACAGATAAGG 0: 1
1: 8
2: 153
3: 1141
4: 4324
1086400779_1086400782 -5 Left 1086400779 11:86459592-86459614 CCCTGACCATTCTGGTGGTACTA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1086400782 11:86459610-86459632 TACTAGCTGATGAGCAGTTGTGG 0: 1
1: 0
2: 1
3: 6
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086400779 Original CRISPR TAGTACCACCAGAATGGTCA GGG (reversed) Intronic
902530376 1:17086827-17086849 AAATGCCACCAGAATGGCCATGG + Intronic
906257625 1:44362490-44362512 TACTACCACCAGAGTTGCCAAGG + Intergenic
907998304 1:59655127-59655149 TAGTACCCACAGCATGGTGAAGG + Intronic
909801833 1:79819714-79819736 TTGTACCACCAAAAAAGTCAGGG - Intergenic
910186681 1:84549223-84549245 TAGTAGCAATAGAGTGGTCAAGG + Intergenic
911434789 1:97844028-97844050 TATTACAAACAGAATGGTCAGGG + Intronic
914314219 1:146494510-146494532 TAGTATCACGATAATGGTGATGG + Intergenic
914500128 1:148238871-148238893 TAGTATCACGATAATGGTGATGG - Intergenic
916498229 1:165364681-165364703 TGGTACCACCAGAAGGATCAAGG - Intergenic
924804342 1:247350345-247350367 CACTACCACGAGAATGGTCTGGG - Intergenic
1063652572 10:7953101-7953123 TATTACTACCAGGAAGGTCAGGG - Intronic
1069747938 10:70727630-70727652 TGATGCCACCAGCATGGTCAGGG - Intronic
1069747947 10:70727682-70727704 TGATGCCACCAGCATGGTCAGGG - Intronic
1072854197 10:98929326-98929348 TAGTACCACAACCCTGGTCAAGG - Intronic
1073222118 10:101883629-101883651 TAGTACAGACAAAATGGTCATGG + Intronic
1081548594 11:44091590-44091612 TTATACCACCAGCATGGTCTAGG - Intergenic
1084916993 11:72435937-72435959 TATTTTAACCAGAATGGTCAGGG - Intergenic
1086400779 11:86459592-86459614 TAGTACCACCAGAATGGTCAGGG - Intronic
1086557886 11:88133163-88133185 TAAGACAACCAGAATGGTAAGGG + Intronic
1089441365 11:118520311-118520333 TTGTACCACCATAGTTGTCATGG + Intronic
1092791672 12:12076057-12076079 CAGTACAAGCAGAATGGACAGGG + Intronic
1095106152 12:38235366-38235388 TATTACCCCCAGAAGGGTCTGGG - Intergenic
1096725535 12:53558808-53558830 TACTACCTCCAGAATGGACAGGG + Intronic
1097357968 12:58623277-58623299 TAGGACCACCTGAAGGCTCATGG - Intronic
1097566571 12:61277434-61277456 TATTACCATCAACATGGTCATGG + Intergenic
1107636073 13:42393868-42393890 TAGTTCCAACAGAAAGGTCCTGG - Intergenic
1111881586 13:93964278-93964300 TAGTACCACCACGTTAGTCAAGG - Intronic
1112272354 13:97980247-97980269 CAATACCATCACAATGGTCAAGG - Intronic
1113123567 13:106951994-106952016 TAGTACTAGTAGAATGGTGATGG + Intergenic
1118352725 14:64985074-64985096 CAGTACCACTAAAATGGACATGG + Intronic
1119955470 14:78794088-78794110 TAATAACACCAGACTGGGCATGG + Intronic
1120702314 14:87711690-87711712 TATGAACACCAGAATGTTCAAGG + Intergenic
1129140864 15:73596866-73596888 CACTACAACCAGAAGGGTCATGG + Intronic
1132180758 15:99751049-99751071 TGATACCATCACAATGGTCATGG - Intergenic
1140636807 16:76924565-76924587 TAGTAGCATCAGAATGACCAAGG - Intergenic
1146801070 17:35823084-35823106 TGGTACCAGCAGTATTGTCAAGG - Intronic
1147194440 17:38756230-38756252 TAGTCCCACCAGAGTGTTCTGGG + Intronic
1147484838 17:40802482-40802504 TTTTGCCACCAGAATAGTCAGGG + Intergenic
1150671443 17:67202561-67202583 TAGTTCCATCAGAGTGGTTATGG + Intronic
1151047631 17:70940337-70940359 TAGTGCCACCAGACTTATCATGG - Intergenic
1151631710 17:75315597-75315619 TAGTTCCACCTGACTGTTCATGG - Intergenic
1151877385 17:76874585-76874607 TTGAACCTCCAGAAAGGTCAGGG + Intronic
1152443337 17:80323645-80323667 TAGTTTCACCATATTGGTCAGGG + Intronic
1159909329 18:74129877-74129899 TAGTACAATAAGAATGTTCAAGG - Intronic
1162005153 19:7773586-7773608 TAGGACCACTAGATTGGTAACGG - Intergenic
1164242735 19:23404203-23404225 TAGAGCCACAAGTATGGTCATGG - Intergenic
1164312069 19:24054822-24054844 TAGGGCCACAAGTATGGTCATGG + Intronic
1165385334 19:35507190-35507212 AAGTAACAGAAGAATGGTCAAGG - Intronic
933689429 2:85168267-85168289 TAATACCATCACCATGGTCAGGG - Intronic
935076856 2:99753784-99753806 TGGTAACACCAGAATGGAGAAGG - Intronic
937029508 2:118726472-118726494 TAGTACCAGCAAAATCTTCAGGG - Intergenic
939577118 2:143909179-143909201 TAGGAACACCAGACTGGTAAGGG + Intergenic
1182765104 22:32752983-32753005 TGAAACCACCAGAAGGGTCAGGG + Intronic
1184903649 22:47464165-47464187 TAGTCCCACCAGCAGGGCCAGGG + Intronic
1184942159 22:47776926-47776948 AAGTACCAGCAGAGTGGGCATGG - Intergenic
952090445 3:29878510-29878532 TGCTACAACCAGAAGGGTCAAGG - Intronic
953637154 3:44673151-44673173 GAGTACAACCAGAAAGTTCAAGG + Intergenic
954656076 3:52195079-52195101 TAGTACCCACCCAATGGTCAAGG - Intergenic
954967715 3:54625869-54625891 TAGGACCCCCAAAATGATCACGG - Intronic
956634437 3:71349847-71349869 TAGTACCTCCTGAAGGGTTAGGG - Intronic
957212433 3:77276924-77276946 TACTACCACCAGAATAGTATGGG + Intronic
957415126 3:79891815-79891837 TACTAGCTCCAGAATGGTCAGGG - Intergenic
959332623 3:105024901-105024923 GAGTACCACCAGAATCTTGAAGG + Intergenic
959917525 3:111834525-111834547 TAATACCATCAGTAAGGTCATGG - Intronic
964026932 3:152085470-152085492 AAGGGACACCAGAATGGTCAAGG - Intergenic
967553425 3:190826444-190826466 TAGTACAATAGGAATGGTCAAGG - Intergenic
969218552 4:5743721-5743743 CAGTATCACCACCATGGTCATGG + Intronic
969312853 4:6364167-6364189 TAGTTCCGACAGACTGGTCAAGG + Intronic
969470691 4:7385768-7385790 CAGTACCACCTGAAGGGGCAGGG + Intronic
970940177 4:21622814-21622836 AAGTAACACCTGAATTGTCAGGG + Intronic
971526433 4:27624282-27624304 TACTACTTCCAAAATGGTCAAGG + Intergenic
973696301 4:53494176-53494198 TACTACCACAAGAATGGTATGGG - Intronic
983167866 4:164498833-164498855 GATTTCCACCTGAATGGTCATGG + Intergenic
983418633 4:167489731-167489753 TAGTACCATAAGCATGGGCAAGG + Intergenic
987015687 5:13816364-13816386 TAGAACCACAAGACAGGTCATGG - Intronic
987931628 5:24406948-24406970 GAGTACCACCAGGATGTTAACGG - Intergenic
993424269 5:87742956-87742978 TATTAAGACCAGAAAGGTCAAGG - Intergenic
1003682850 6:8272808-8272830 CAGTAGCTCCACAATGGTCAGGG + Intergenic
1006067988 6:31476182-31476204 TAGTCCAACGAGACTGGTCAGGG + Intergenic
1006189904 6:32201347-32201369 CAGTACCACCAGCAGGGCCAGGG + Exonic
1012628260 6:101430998-101431020 TAGTACTACTAGTATTGTCATGG - Intronic
1021546338 7:21817019-21817041 TAGTAACACAAGAATTGTCAAGG + Intronic
1022073126 7:26937467-26937489 CAGAAGCAGCAGAATGGTCATGG + Intronic
1031177428 7:118370879-118370901 TAGCATCACTAAAATGGTCAGGG - Intergenic
1040979342 8:53229608-53229630 TAGGATCACCAGACTGGTCCTGG - Exonic
1058814375 9:108669835-108669857 TATGACCACCCCAATGGTCATGG + Intergenic
1059595874 9:115720271-115720293 GAGTCCTCCCAGAATGGTCAGGG + Intergenic
1188979571 X:36714901-36714923 AAGTACCACCAGAAGGTGCATGG + Intergenic
1192590096 X:72352328-72352350 AAGTACCAACAGAATGCTCTTGG - Intronic
1199785405 X:151100791-151100813 TACTGCCAACAGGATGGTCAAGG + Intergenic
1199890827 X:152079110-152079132 TATTAACACCAGAATGGGAAAGG - Intergenic