ID: 1086402035

View in Genome Browser
Species Human (GRCh38)
Location 11:86468902-86468924
Sequence CTGTTTCCAGAGAAGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 376}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086402033_1086402035 -7 Left 1086402033 11:86468886-86468908 CCTTATGATGTAGGCGCTGTTTC 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG 0: 1
1: 0
2: 2
3: 29
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086402035 Original CRISPR CTGTTTCCAGAGAAGGAATC TGG Intronic
900124393 1:1063036-1063058 CAGTGCCCAGAGGAGGAATCTGG - Intergenic
900806295 1:4770193-4770215 TTGGATCCAGAGAAAGAATCTGG - Intronic
901599883 1:10415136-10415158 CTGTATCCAGAGGAGCAAACAGG - Intronic
901791529 1:11655709-11655731 CCATTTACAGAGAAGGAAACAGG + Intronic
902294848 1:15460113-15460135 CCATTTCCAGAGAAGGCAACTGG + Intronic
902297592 1:15478926-15478948 CCATTTCCAGAGAAGGTAACTGG + Intronic
902780214 1:18700163-18700185 CAGTCTCCAGAGAAAGAACCCGG + Intronic
903301648 1:22383449-22383471 TTGGTTTTAGAGAAGGAATCTGG - Intergenic
904260366 1:29284324-29284346 CTGCTTCCAGACAGGGAATGTGG + Intronic
905241638 1:36585438-36585460 CTTTTTCCTGAGCTGGAATCGGG + Intergenic
905651583 1:39660587-39660609 CTGTTTCCAGTGAGGGAAACAGG + Intronic
906518564 1:46453798-46453820 CTTTCTCCAGAAAAGGACTCTGG + Intergenic
906652921 1:47525874-47525896 GTGGTTCCAGAGAAGGAAGAGGG + Intergenic
906689637 1:47784120-47784142 CAGTTTCCAGATGAGGAAACAGG + Intronic
907595868 1:55719267-55719289 CTGAAACCAGAGAAGGAACCTGG - Intergenic
908385580 1:63638256-63638278 CATTTTACAGAGAAGGAAACAGG - Intronic
908508332 1:64828175-64828197 CTTTTTCCAGACAAGGAAAATGG - Intronic
909031341 1:70544950-70544972 ATGTTTCAAGAGAAGGAAAATGG + Intergenic
909071577 1:71000295-71000317 CACTTTCCAGATAAGGAAACTGG - Intronic
910851227 1:91651457-91651479 CTGTTACCAGGGAAGGGACCAGG + Intergenic
912559808 1:110542431-110542453 CATTTTACAGATAAGGAATCTGG - Intergenic
913802309 1:122729462-122729484 CCGTTTCCAAAGAAGGCCTCAGG - Intergenic
913878008 1:124087338-124087360 CCGTTTCCAAAGAAGGCCTCAGG - Intergenic
914866420 1:151433825-151433847 CTATTTCCAGAGGATGAAACAGG + Intronic
916023546 1:160814789-160814811 AAGCTTTCAGAGAAGGAATCTGG - Intronic
916126931 1:161580137-161580159 CTGCTTCCTGAGAAGGCATTTGG + Intergenic
916136850 1:161661941-161661963 CTGCTTCCTGAGAAGGCATTTGG + Intronic
916586870 1:166156856-166156878 CTGTTACCAAAGAAGGGCTCAGG + Intronic
917156959 1:172013158-172013180 CAGTTGCCAGAAAAGTAATCTGG - Intronic
917964436 1:180169495-180169517 ATGTTTACAGACAAGGAAACTGG - Intronic
919750928 1:201037738-201037760 GTGTTTCCAGAGAAGCGATGGGG + Intergenic
920395427 1:205642096-205642118 CAGTTTACAGAAAAGGAAACAGG - Intergenic
922175694 1:223195418-223195440 CTTTCTCCAGAGAAGCACTCAGG + Intergenic
922617888 1:226973914-226973936 CTGTTTACAGAGAAGGGCTCGGG - Intronic
923247964 1:232151679-232151701 CTATTTACAGTGAAGGAAGCTGG - Intergenic
924230044 1:241955449-241955471 CTACTTCCGGAGAATGAATCAGG + Intergenic
1063180718 10:3596622-3596644 CAGTTTCTAGAGGAGGAAACGGG - Intergenic
1064449926 10:15432549-15432571 GTGTTTCCAGGCAAGGAATTTGG + Intergenic
1065825557 10:29567449-29567471 CTGCTTCCTTAGAAGAAATCTGG - Intronic
1069627886 10:69879654-69879676 CTGTTCCCAGAGGAGGTATGTGG + Intronic
1071244347 10:83746546-83746568 AAGCTTCCAGAGAAGGGATCAGG - Intergenic
1071251034 10:83820041-83820063 TTGTTTCTAGAAAAGGATTCTGG - Intergenic
1071438336 10:85667512-85667534 CAGTCTACAGAGGAGGAATCTGG + Intronic
1071504285 10:86223291-86223313 CTCTTTCCAGGGAAGGTGTCTGG - Intronic
1072333800 10:94379468-94379490 ATTTTTCTATAGAAGGAATCAGG + Intergenic
1073057034 10:100709648-100709670 AAGTTTCCAGAGCAGGAATAGGG - Intergenic
1073109193 10:101050663-101050685 CTGTTTCCTGTAAAGGAACCTGG + Intergenic
1074388686 10:113038083-113038105 CTGCTCCCAGAGAAGGTATTTGG + Intronic
1074574207 10:114653163-114653185 CATTTTACAGAGAAGGAAACTGG - Intronic
1074885537 10:117690125-117690147 CTATTTCCAGATAAGGAAAGTGG - Intergenic
1075039037 10:119093002-119093024 CTGTTCCCAGAGCTGGAATGCGG - Intergenic
1075103223 10:119520110-119520132 CTTCTTCCAGAGATGGAATGTGG + Intronic
1075479477 10:122767757-122767779 ATGTTTGCAGAGGAGAAATCAGG + Intergenic
1075924279 10:126237491-126237513 GTGTTTCCAGTGAAGATATCTGG - Intronic
1076054026 10:127356775-127356797 CTGTGTCCAGAGAAGAGGTCTGG - Intronic
1077615263 11:3669531-3669553 CTGTTTCCTCAGCAGGAATATGG + Intronic
1078964154 11:16318169-16318191 CTTTTTCCAGAGTAGGATTATGG + Intronic
1080753563 11:35173738-35173760 CTCTTTCCTGAGCAGGAAGCAGG - Intronic
1082778692 11:57269224-57269246 CATTTTCCAGAGAAGGAAACAGG + Intergenic
1084319328 11:68364761-68364783 CTGTTCCCAGAGCAGGACACAGG + Intronic
1084642427 11:70433896-70433918 GTGTGTGCAGAGATGGAATCCGG - Intronic
1084698047 11:70768099-70768121 CACTTTACAGAGAAGGAAACAGG - Intronic
1084698538 11:70770770-70770792 CTGATCCCAGAGCAGGAACCTGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1086778195 11:90866627-90866649 CTGTATCTAAAGAAGGCATCAGG + Intergenic
1087424687 11:97971572-97971594 CTGTTCACAGAGAAGGCATAAGG + Intergenic
1088299995 11:108347631-108347653 CAGATTCAAAAGAAGGAATCAGG + Intronic
1088709614 11:112496182-112496204 CAGTTCCCAGCTAAGGAATCAGG - Intergenic
1089412948 11:118262535-118262557 CAGTTTCCAGAGAAGGATGGAGG + Exonic
1090933581 11:131321581-131321603 CTGTCTTCTGAGAAGGAATGAGG + Intergenic
1091181547 11:133608845-133608867 CTATTTGCAGAAAAGAAATCTGG - Intergenic
1091602896 12:1928704-1928726 CTGTTTCCAGAGAGGGAACCGGG - Intergenic
1092215528 12:6679122-6679144 CTGTTGCCAGAGAAGGGCTGTGG - Exonic
1092385954 12:8035705-8035727 CTGATTCCAGAGAAGCAAGCAGG - Intronic
1093081230 12:14813926-14813948 CTGTCTTCAGAGAAGGCACCAGG + Intronic
1093505127 12:19856266-19856288 CTGTTGCCAGAAAAGTAATTAGG + Intergenic
1098258195 12:68639312-68639334 CTTTTTGTAGACAAGGAATCTGG + Intronic
1099930760 12:89071580-89071602 TTATTTCCAGATGAGGAATCTGG - Intergenic
1100405743 12:94271616-94271638 CTGTTTACAGAAGAGGAAACAGG - Intronic
1100511335 12:95277402-95277424 CTGTTGCCAGTGAAACAATCAGG + Intronic
1100808358 12:98311517-98311539 AAGCTTCCAGAGAAAGAATCAGG + Intergenic
1103235752 12:119371124-119371146 CTGTCTCAAGAAATGGAATCAGG - Intronic
1103716887 12:122950185-122950207 CTGTTTTCCAAGTAGGAATCTGG - Intronic
1104304580 12:127597922-127597944 CTGGATCCTGAGAAGGAATCTGG - Intergenic
1105791478 13:23804143-23804165 ATGATTACAGAGAAGAAATCTGG + Intronic
1106205468 13:27589673-27589695 CTGTCTTCAGTGTAGGAATCAGG - Intronic
1107564984 13:41593193-41593215 CTGTTTCCAGCAAGGGTATCAGG - Intronic
1108343267 13:49518639-49518661 CATTTTCCAGAGGAGGAAACTGG + Intronic
1108556268 13:51595874-51595896 ATGCCTCCAGAGAGGGAATCAGG - Intronic
1108983208 13:56546797-56546819 CTGCTTCTAGTGAAGGACTCAGG - Intergenic
1114482344 14:23043740-23043762 CTCTTTACAGAAGAGGAATCAGG + Exonic
1115573684 14:34690670-34690692 CTGTTTTCAGACGAGGACTCTGG + Intergenic
1118506263 14:66415447-66415469 CAGTTCTCAGAGAAGGGATCTGG - Intergenic
1119354931 14:73998385-73998407 CTGTTTCGAAAGAAGGGGTCAGG - Intronic
1119537698 14:75416427-75416449 CTGTTTTCAGATAAAGAACCAGG + Intergenic
1120065821 14:80039566-80039588 AAGCTTCCAGAGAAAGAATCAGG + Intergenic
1124143197 15:27095857-27095879 CTGCATGCAGAGAAGGGATCAGG - Intronic
1125044860 15:35233585-35233607 CTGTTCCCAGGGAAGAAACCAGG - Intronic
1126078503 15:44936128-44936150 CTGTTAACAGAAAAGGAAACAGG + Intergenic
1126079345 15:44944197-44944219 CTGTTAACAGAAAAGGAAACAGG - Intergenic
1126417793 15:48436316-48436338 CTTTTTCCATACAAGAAATCAGG - Intronic
1126872022 15:52999926-52999948 CAGTTTACAGAAAAGGAAACTGG + Intergenic
1127227437 15:56947515-56947537 TTGTTTCCAGATAGGAAATCAGG + Intronic
1127308678 15:57731938-57731960 CGGTTCCAAGAGAAGGAATGTGG - Intronic
1128099167 15:64984123-64984145 GTTCTTCCAGAAAAGGAATCTGG + Intronic
1128562552 15:68678222-68678244 CTGTTGTCAGAGAAGGAGTCAGG + Intronic
1129408463 15:75335883-75335905 TTTTTTCCAGGGAAGGATTCTGG + Exonic
1129449759 15:75644588-75644610 CTGTTTCCTGTGTATGAATCAGG + Intronic
1129471558 15:75758403-75758425 TTTTTTCCAGGGAAGGATTCTGG + Intergenic
1129733441 15:77944747-77944769 TTTTTTCCAGGGAAGGATTCTGG - Intergenic
1130196631 15:81785446-81785468 CACTTTACAGAGAAGGAAACTGG + Intergenic
1130387208 15:83422374-83422396 GTTTTGCCAGAGAAGGAAGCTGG + Intergenic
1130750837 15:86711231-86711253 CTGTTTCCAAAGAACTAAGCTGG - Intronic
1133923169 16:10172653-10172675 CTGTTGCCATAGGGGGAATCGGG + Intronic
1135256550 16:20945945-20945967 CTATTTACAGATAAGGAAACTGG - Intronic
1136901885 16:34049473-34049495 CTATTTGCAGAGAATGTATCAGG - Intergenic
1137464940 16:48699234-48699256 CTTTTTCCAGACAGGGTATCTGG + Intergenic
1137541450 16:49364968-49364990 CTGTCTCCACAGAAGGCAGCTGG - Intergenic
1137880925 16:52047506-52047528 CATTTTCCAGAGAAGAAACCTGG + Intronic
1138622388 16:58222532-58222554 CTGATTCCAGAGAAGGGAGGAGG + Intergenic
1138774605 16:59706401-59706423 ATGTCTCCAGAGAGGGGATCAGG - Intergenic
1139255945 16:65542890-65542912 CTTTTTCCAGAGAAGGCCACAGG - Intergenic
1141260081 16:82444795-82444817 CATTTTTCAGAGAAGGAAACTGG + Intergenic
1141260162 16:82445620-82445642 CATTTTTCAGAGAAGGAAACTGG - Intergenic
1143390238 17:6555888-6555910 CTCCTTCCCGAGAAGGAATCTGG + Intronic
1143555961 17:7660481-7660503 TTGTTTTCTGAGATGGAATCTGG - Intergenic
1143623733 17:8096181-8096203 GCTTTTCCAGAGAAGGAAGCTGG + Intronic
1144958546 17:19032056-19032078 GTGTTTCCTGGGAAGGGATCTGG - Intronic
1144976614 17:19142468-19142490 GTGTTTCCTGGGAAGGGATCTGG + Intronic
1145241188 17:21241825-21241847 CTGTTGCTGGAGAAGGAATGTGG + Exonic
1145925864 17:28646070-28646092 CATTTTACAGAGAAGGAAGCAGG - Intergenic
1146176491 17:30668831-30668853 GAGTTTCCAGAGAGGGAAACTGG + Intergenic
1146349951 17:32084945-32084967 GAGTTTCCAGAGAGGGAAACTGG + Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1146827631 17:36037193-36037215 TTGCTTCCAGAGAAGGAAATGGG + Intergenic
1146926387 17:36748787-36748809 TTGTTTCTGGAGAAGGAAGCTGG - Intergenic
1146949105 17:36893454-36893476 CTGGGTGCAGACAAGGAATCAGG - Intergenic
1147452612 17:40515183-40515205 CTGTCTGCAGAGAAGGCCTCTGG - Intergenic
1147529732 17:41264447-41264469 CTGTTTTCAGTGAGGGAATTAGG - Intergenic
1147883087 17:43666279-43666301 ATGTTGCCATAGAAGGTATCTGG - Intergenic
1149623901 17:58066133-58066155 CTGTTTCCTGAGAGGCAATATGG - Intergenic
1149918470 17:60633943-60633965 CTACTGCCAGAAAAGGAATCTGG - Exonic
1150294753 17:64001789-64001811 CTGTATCCAGAGCAGGAAGCTGG - Exonic
1150522843 17:65887808-65887830 CTGTTTCCAGAGAAAGCCTGAGG - Intronic
1151335091 17:73435054-73435076 ATGTTTCCAAAGAAGAAAACTGG - Intronic
1153501291 18:5752515-5752537 CTGTTTCCTAAGAAGGAAAGTGG + Intergenic
1153943484 18:9997095-9997117 CAGTTTCCTGAGAGGGAAGCTGG - Intergenic
1154498752 18:14982808-14982830 CTGCTTTCATAGAATGAATCAGG - Intergenic
1155043477 18:22084276-22084298 TTGTTAACAGAGAAGGACTCAGG - Intergenic
1155095206 18:22548842-22548864 TTGTTTCCTGAGAAGGAAGCTGG - Intergenic
1155372043 18:25112019-25112041 TGGTTTCCAGAGAAGCAGTCTGG - Intronic
1156266132 18:35490075-35490097 CTGGTTCCTGAGAAGGAAGGTGG + Intronic
1156335135 18:36164605-36164627 CTGTTTCCAGAGATCGAACCTGG + Exonic
1156949696 18:42880234-42880256 GTATTTCCAGAGATGGAGTCAGG - Intronic
1156985176 18:43342266-43342288 CTCTCTCCAGAGAAAGGATCAGG - Intergenic
1157779804 18:50428195-50428217 CTGTTTCCAAAGAGGGTTTCGGG + Intergenic
1158017549 18:52802281-52802303 CTATTGCCAGAGTAGCAATCTGG + Intronic
1158285611 18:55878242-55878264 CTGATTCCAGAGTTGGAATCTGG - Intergenic
1159912040 18:74154708-74154730 CTGTGTTCAGAGTAGGAATATGG - Intronic
1160997085 19:1887611-1887633 CAGCTGCCAGGGAAGGAATCAGG + Intergenic
1162976023 19:14207273-14207295 CCGTCTCCCGAGAAAGAATCCGG - Intergenic
1163075340 19:14886022-14886044 CTGTCTCAAGACAAGGCATCAGG + Intergenic
1163748508 19:19061836-19061858 CTATTTACAGAGAGGGAAACAGG + Intergenic
1164670124 19:30067717-30067739 AAGTCTCCAGAAAAGGAATCTGG + Intergenic
1164703590 19:30303462-30303484 TTGTTTCCTGAAAGGGAATCAGG + Intronic
1165553254 19:36606229-36606251 GTGTTTCCAGGAAATGAATCTGG - Intronic
1166539912 19:43598448-43598470 CATTTTCCAGATAAGGAAACTGG + Intronic
1166542753 19:43616401-43616423 TTTCTTCCAGAGAAGGAAACAGG - Intronic
1167605222 19:50478352-50478374 CTTTTTCCAGAAGAGGAAACGGG + Intronic
1168320138 19:55504106-55504128 CCGTTTCCAGAGCCGGAAGCGGG + Intronic
1168320252 19:55504798-55504820 TTTTTTCCAGAGAAAGAAACAGG - Intronic
1168679799 19:58306219-58306241 CAGTTCCCTGAGAAGGTATCGGG + Intronic
925547826 2:5037645-5037667 CCGTCTCCTGAGAAGGCATCTGG - Intergenic
925838177 2:7965785-7965807 TTTTTTCCTGAGAAGGAGTCTGG - Intergenic
926359594 2:12073620-12073642 CATTTTACAGAGAAGGAAGCAGG + Intergenic
928777765 2:34787572-34787594 CTGTTTTCAGAGAATAAACCAGG - Intergenic
928791480 2:34960781-34960803 CTGTTTGCAGAGATGAAGTCTGG - Intergenic
929520810 2:42648952-42648974 CTGTTTAAAGAGAAAGAAACAGG - Intronic
929728309 2:44457150-44457172 TTATTTCCAGAGAGGGAAACTGG - Intronic
930704614 2:54491999-54492021 ATGTTTCCAGAGAAATAATGTGG + Intronic
931178069 2:59873337-59873359 CTTTGTTCACAGAAGGAATCAGG + Intergenic
932021745 2:68094578-68094600 CAGTTTCCTGAGAAGAAACCAGG - Intronic
933632958 2:84677246-84677268 CTCTTTCCTGAGCAGGAAGCAGG + Intronic
934666893 2:96178026-96178048 CTATTTCCAGAAACGTAATCAGG + Intergenic
935014330 2:99165699-99165721 TTGTTTCCATAGAAGGAAGTAGG - Intronic
935322222 2:101900307-101900329 CTGTCTCCAGAGGAGGAATGAGG - Intergenic
935402138 2:102671146-102671168 GAGTTTACAGAGAAGGAAGCGGG + Intronic
936343983 2:111661405-111661427 CAGTTTACAGAGGAGGAAACTGG + Intergenic
936547350 2:113404107-113404129 CAGTTGCAAGAGAAGGGATCTGG + Intergenic
936968428 2:118150348-118150370 CTGAGTCCAGAGAAGAAATCTGG - Intergenic
937997985 2:127709498-127709520 CTGTTTCCATCCCAGGAATCTGG + Exonic
938722875 2:134081833-134081855 TTGGTTCCAGTGAAGGAATTAGG - Intergenic
939336342 2:140833559-140833581 CTGTTTCTAGAGCATGTATCTGG - Intronic
939851373 2:147310163-147310185 CTCTTTACAGAGAAAGAAACTGG - Intergenic
941499715 2:166257132-166257154 CTGTTTGCAGAGAAAGCAGCTGG + Intronic
941642681 2:168006025-168006047 CTGTTTCCTGAGAAGGGAGCTGG - Intronic
941839651 2:170067029-170067051 CATTTTCCAGACAAGGAAGCAGG + Intronic
944790684 2:203122085-203122107 CTGTTTTAAAAGAAAGAATCAGG - Intronic
944978989 2:205092276-205092298 CAGCTTCCAGAGGAGGAAACAGG + Intronic
946122375 2:217527618-217527640 CTGTCTCCTGAGAAGGAACTGGG + Intronic
946337278 2:219046389-219046411 CTGTTTACAGATAAGGAACCTGG - Intergenic
946998527 2:225425190-225425212 CAGCTACAAGAGAAGGAATCAGG + Intronic
947443488 2:230143674-230143696 ATCTTTCCAGGGAAGGCATCAGG + Intergenic
947558024 2:231115367-231115389 CTGTTTCCAGAGTTGGTATGTGG + Intronic
948331983 2:237176835-237176857 CTGTTTTCTGAGAGGGACTCAGG - Intergenic
948909791 2:240997311-240997333 CTGTTTGCAGAGAGGCAAACTGG - Intergenic
948943866 2:241209725-241209747 CTGTGCCCAGAGGAGGCATCTGG - Intronic
1169027701 20:2384358-2384380 CACTTTCCAGAGAAGGAAATCGG + Intronic
1169201177 20:3710919-3710941 CTGTTTCCAGAACAGTTATCTGG - Intergenic
1169362253 20:4960994-4961016 CTGCCTCCAGAGATGGAAACTGG + Intronic
1169620900 20:7505730-7505752 CTATTTCCAGGGAATGAAACTGG - Intergenic
1169620910 20:7505798-7505820 CTGTTTCCAGGGAATGAAGCTGG - Intergenic
1169620919 20:7505869-7505891 CTGTCTCCAGGGAATGAAGCTGG - Intergenic
1173719406 20:45241061-45241083 ATGTGTTCAGAGAATGAATCAGG - Intergenic
1173854025 20:46238177-46238199 CTGATGCTAGAGAAGGAAGCAGG - Intronic
1175160163 20:57002463-57002485 CTGTTTTGTGAGATGGAATCTGG + Intergenic
1175778470 20:61667491-61667513 CTGTTTCCAGAGAGGGTGGCCGG + Intronic
1177095514 21:16826969-16826991 CTGTCTCCAGACACTGAATCTGG + Intergenic
1178499341 21:33112802-33112824 CAGCTTCCAGAGAAGGATTTAGG + Intergenic
1179581332 21:42346504-42346526 CTGGTTCCAGAGGATGCATCTGG - Exonic
1179903626 21:44407969-44407991 CTTTTTCCCGAGAGGGAGTCAGG + Intronic
1180634955 22:17256873-17256895 CTGTCTCTGGAGAAGGAAACAGG + Intergenic
1183023347 22:35044940-35044962 CCTTTTCCAGAGGAGGAAACTGG - Intergenic
1183236616 22:36623491-36623513 CATTTTCCAGAGAGGGAAACTGG - Intronic
1183525380 22:38319500-38319522 ATTCTTTCAGAGAAGGAATCAGG + Intronic
1183529536 22:38345843-38345865 CATTTTACAGAGAAGGAAACTGG + Intronic
1183864629 22:40694451-40694473 CAGCTTCCAGAGAAGGAAGATGG - Intergenic
1184026896 22:41864653-41864675 TTGTGTTCAGAGAAGGGATCTGG + Intronic
1184310102 22:43635756-43635778 GTGTTTGGAGGGAAGGAATCAGG - Intronic
1184640557 22:45867886-45867908 CTGTTTCCAGAGCTGGAAGGAGG - Intergenic
1185125694 22:49009538-49009560 CAATTTCCAGAGAAGGAAGCAGG - Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
950639639 3:14340454-14340476 CATTTTACAGAGAAGGAAACAGG - Intergenic
950866837 3:16196381-16196403 CACTTTCCAGAGGAGGAAACTGG + Intronic
950974509 3:17226492-17226514 CAGTTTCCAGAGAAGAACTCAGG - Intronic
951038097 3:17955739-17955761 CAGTTGCCACAAAAGGAATCAGG - Intronic
951717001 3:25659925-25659947 CTATTTGCAGAGAAGGAAACGGG - Intronic
952222031 3:31332634-31332656 CTGTGTCCAGAGATGCCATCTGG - Intergenic
952983543 3:38757668-38757690 TTCTTTACAGATAAGGAATCTGG + Intronic
954239036 3:49278932-49278954 CGGTCTCCAGAGAATTAATCTGG + Intronic
954318988 3:49818090-49818112 CTGCTTCCAGTGAAGGCATTAGG - Intergenic
954364099 3:50137276-50137298 CAGTTTCCAAAGAAGGAGGCTGG - Intergenic
955433377 3:58872909-58872931 CAGTATCCAGAATAGGAATCCGG - Intronic
955525712 3:59817768-59817790 CTTTTTTTAAAGAAGGAATCTGG - Intronic
955894848 3:63688148-63688170 CAGTGCCCAGAGAAGCAATCTGG - Intergenic
956596842 3:70976541-70976563 CTATCTCCAGAGATGGAACCTGG - Intronic
958005384 3:87803081-87803103 CTGTTTTGAGAAAAGGAACCTGG + Intergenic
959863240 3:111238992-111239014 CTTTTTACAGATAAGGAAACAGG + Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960017665 3:112911163-112911185 ATCTTTCCAGTGAAGGCATCAGG - Intergenic
960179513 3:114558791-114558813 ATGTGTTCAGAGAAGGAATCAGG - Intronic
960455220 3:117862980-117863002 CTCTTTCCATAGAAGAAATGAGG - Intergenic
961388488 3:126537853-126537875 CTGTTTACAGACAAGGACACAGG + Intronic
962426892 3:135278075-135278097 CAGTTTCCACATAAGGAATAGGG + Intergenic
962840500 3:139228128-139228150 CTGTCTCGAGACATGGAATCTGG + Intronic
964624841 3:158748965-158748987 GTGTTTGCAGGGAAGGGATCGGG - Intronic
966440849 3:179942580-179942602 CTGGGTCGAGAGAGGGAATCCGG - Intronic
966812734 3:183862346-183862368 CTTTTTACAGATAAGGAAACCGG - Intronic
967225911 3:187291271-187291293 CTCTTTCCAGAGGAGGAACACGG + Intronic
967581370 3:191159660-191159682 CAGTTTCCAAAGCAGAAATCTGG + Intergenic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
968860580 4:3166267-3166289 ATGTTTCCAGAGGAAGGATCAGG - Intronic
969374363 4:6753410-6753432 CTGTTTTCAGATGGGGAATCTGG - Intergenic
969490599 4:7497329-7497351 CTGTTGCCAGAGGAGGACTGGGG + Intronic
971268858 4:25118455-25118477 CTGTTTCCAGAGGATCACTCTGG + Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
972633603 4:40863009-40863031 CTGTTTCCAGAGAAGGGGACTGG + Intronic
972768596 4:42174462-42174484 GTCTTACCAGAGCAGGAATCAGG - Intergenic
973873172 4:55187262-55187284 CTTTTTCCTGACAAGGAATGAGG + Intergenic
974456360 4:62133736-62133758 CTTCCTCCAGAGAAGGAAGCAGG - Intergenic
974941927 4:68479791-68479813 CTGTTTTTAAAAAAGGAATCAGG - Intronic
978165600 4:105603009-105603031 CTGTCTCCAGATAAGGACTCTGG + Intronic
979386007 4:120066566-120066588 CTGATACCAGAGAAGTAATCTGG - Intronic
980900659 4:138902127-138902149 ATGCTTCCAGAAAAGAAATCAGG - Intergenic
981603073 4:146513102-146513124 TTGTCTCCAGAGAAGAAAACTGG + Intronic
981660182 4:147157704-147157726 CTGATTGAAGAGAAGAAATCAGG + Intergenic
982256827 4:153459093-153459115 CTGCTTCCAGTGAAGGCCTCAGG + Intergenic
983637429 4:169912205-169912227 CTGCCTCCAGGGAAGGAAACTGG - Intergenic
983668369 4:170207870-170207892 AAGTTTCCAGAGGAAGAATCAGG + Intergenic
983694357 4:170510436-170510458 AAGTTTCCAGAGAAAGGATCAGG - Intergenic
983906515 4:173188632-173188654 CTGTCTTCAGGGGAGGAATCTGG + Intronic
983977515 4:173953261-173953283 GTGATTCCACAGAAGGAGTCAGG + Intergenic
988321103 5:29697843-29697865 CTTTTTCAATAGAAAGAATCAGG - Intergenic
989145468 5:38245361-38245383 AGGTTTCCAGAGAGGGAACCTGG - Intergenic
990431478 5:55738801-55738823 TTTTTTCCAAAGAAGGAATTAGG - Intronic
990983365 5:61620911-61620933 GTGTTTCCAGAGCAGGGATCTGG - Intergenic
991463500 5:66884503-66884525 CTGTTTCCTGAGAAGGACCCGGG + Intronic
992093287 5:73338529-73338551 CTGCTCCCAGAGCAGAAATCTGG - Intergenic
992238449 5:74737490-74737512 GTTTTTACAGAGAAGGAAACTGG - Intronic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993254978 5:85579203-85579225 CTTTATCCAGAGAAGGAGTAGGG - Intergenic
994247424 5:97495568-97495590 CTGATTCCAAAGAAGGAAGAAGG + Intergenic
994471626 5:100215230-100215252 CTGATTCCAGAAGAGGACTCTGG - Intergenic
996365340 5:122695158-122695180 CGGTTTCTGGAGATGGAATCTGG - Intergenic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998682516 5:144485967-144485989 CTATTTACAGATAAGGAAACTGG - Intergenic
1000993099 5:167931228-167931250 CTGTTTGCATAGCAGGAATCAGG - Intronic
1001533793 5:172483711-172483733 CTAATTCCAGATAAGGAATATGG + Intergenic
1001563498 5:172685124-172685146 CTCTTTCTACAGAAGGAAACAGG - Intronic
1001891775 5:175345380-175345402 CTGCTTCCAGAGCTGGAACCAGG - Intergenic
1002038370 5:176491259-176491281 GGGTTTCCAGAGAAGGCAACAGG - Intronic
1002057304 5:176605881-176605903 TGTTTTCCAGAGAAGGAAACAGG - Intronic
1002543219 5:179920036-179920058 CTGTTTCCAGAGAAGAGGCCGGG - Intronic
1003165806 6:3677529-3677551 AAGTTTCCAGAGAAAGGATCAGG - Intergenic
1003191188 6:3876295-3876317 CTGTTTCCAGTAAAGCAATGGGG + Intergenic
1003241256 6:4347592-4347614 CTGATTCCAGACAATGAGTCAGG - Intergenic
1003298886 6:4858813-4858835 CTTTTTCCAGAGGAGGAACTGGG - Intronic
1003555001 6:7131490-7131512 CTGTTTACAGATGAGGAAGCTGG + Intronic
1004617054 6:17300745-17300767 CTGCTTCCAGTGAGGGCATCAGG + Intergenic
1004900869 6:20192756-20192778 CATTTTGCAGATAAGGAATCAGG + Intronic
1004903882 6:20218468-20218490 CTGTTTCCCGAACAGTAATCTGG - Intergenic
1005083482 6:21980747-21980769 CTGGTTCCAGAGCAGGAAGGAGG - Intergenic
1005083515 6:21980909-21980931 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1005083549 6:21981076-21981098 CAGTTTCCAGAGCAGGAAGGAGG - Intergenic
1006016545 6:31085795-31085817 CTGTTTTCAGAGAAGGATATGGG + Intergenic
1006357917 6:33571615-33571637 CTATTTACAGATAAGGAAACGGG - Intergenic
1006645616 6:35512458-35512480 GGGTTTCCAGGGAAGGAATAGGG - Intronic
1007473647 6:42105777-42105799 CTGATGGCAGAGAAGGACTCAGG - Exonic
1007993832 6:46285288-46285310 CTATTTCCAGAGATGGAGCCTGG + Intronic
1010407501 6:75521483-75521505 AAGTTTCCAGAGCAGGAATGAGG - Intergenic
1011304136 6:85908378-85908400 ATGTTTCCAGAGGAAGGATCAGG - Intergenic
1013395442 6:109733128-109733150 CAGTTTCCTGAGAAGGAATATGG + Intronic
1014069429 6:117163992-117164014 CTGTTGGCAGAGAAGGAGGCAGG - Intergenic
1014975173 6:127871837-127871859 TTGTTTCCAGTGAAACAATCAGG - Intronic
1015360733 6:132336307-132336329 CTTTTTCCAGAGATGGATTACGG - Intronic
1016124904 6:140387932-140387954 CTCTTTCAAGAGAAGGGGTCTGG - Intergenic
1016473503 6:144400693-144400715 CTGTATCAAGAGAATGAATGCGG + Intronic
1016714404 6:147207105-147207127 CTGGTTCCTGAGAAGGAGTGAGG + Intronic
1018670352 6:166171842-166171864 AAGTTTCCAGAGGAGAAATCGGG + Intergenic
1018791931 6:167155208-167155230 CTGTTTCAAGGGAAGAAAACAGG + Intronic
1019585600 7:1800809-1800831 CTTCTTCCAGATAAGAAATCTGG - Intergenic
1021197261 7:17687451-17687473 CCATTTTCAGAGAAGAAATCAGG - Intergenic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1022411437 7:30141497-30141519 CTGTTTCCAGGACAAGAATCAGG + Intronic
1022991670 7:35714668-35714690 CCGTTCCCAGAGCAGGAATGAGG + Intergenic
1025974272 7:66357213-66357235 CTGTTTACTGATAAGGAAGCTGG + Intronic
1026778847 7:73249863-73249885 GTGAGTCAAGAGAAGGAATCTGG - Intergenic
1027019707 7:74803271-74803293 GTGAGTCAAGAGAAGGAATCTGG - Intronic
1027068319 7:75142670-75142692 GTGAGTCAAGAGAAGGAATCTGG + Intronic
1027601341 7:80245039-80245061 CAATTCCCAGAGAAGGAATGAGG + Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1029088290 7:98028459-98028481 CTGTTTGCAGAGTAGGCATTTGG - Intergenic
1030344741 7:108420126-108420148 CTGTACCCAGTTAAGGAATCTGG + Intronic
1030900402 7:115116371-115116393 CATTTTACAGATAAGGAATCTGG + Intergenic
1031152685 7:118073005-118073027 TTTTTTTCAGAAAAGGAATCTGG - Intergenic
1031301133 7:120062140-120062162 CTGATTTCAGAGAAATAATCAGG + Intergenic
1032614005 7:133446164-133446186 CTGATACCAGAGAAAGAATGTGG - Intronic
1033438945 7:141361123-141361145 CTGTTTCAAGGGAAGCAGTCTGG + Intronic
1034985177 7:155508488-155508510 AGGTTTCCACATAAGGAATCAGG - Intronic
1035283299 7:157791309-157791331 CTGTTTTCAAACATGGAATCGGG - Intronic
1036681572 8:10878218-10878240 CTGCTTCTGAAGAAGGAATCTGG - Intergenic
1036720591 8:11171667-11171689 CTGTTTCCAGTGAGGGCCTCAGG - Intronic
1036943602 8:13073713-13073735 TTGTTTTCAGAGATGGGATCTGG - Intergenic
1038664697 8:29528194-29528216 CAATTTCCAGACAAGGAAACTGG - Intergenic
1039218549 8:35301127-35301149 CTGATTCCAGAGATGGAACAGGG + Intronic
1039534485 8:38295726-38295748 CTGTATCCAGAGTATGAAACTGG + Intronic
1041191580 8:55360974-55360996 CTGTTCAGAGAGCAGGAATCAGG + Intronic
1041517386 8:58715432-58715454 CTATCTCCAGAGGAGGAACCTGG - Intergenic
1042494390 8:69440042-69440064 GTTGTTCCAGAGAAGGGATCTGG + Intergenic
1043944114 8:86230666-86230688 TTGTTTCCAGAGCAGGGAACTGG - Intronic
1044641496 8:94387044-94387066 CTGTTTACTGAAAAGGAGTCAGG - Exonic
1044833180 8:96270025-96270047 CTGTTTACTGAGGAGGAAACTGG + Intronic
1045246756 8:100448788-100448810 GTGTTTCCAGAGAGGAACTCTGG - Intergenic
1045398806 8:101790268-101790290 CTGTTTAGAGAGAAATAATCGGG - Intronic
1046947714 8:119989567-119989589 CAGTTTACAGATAAGGAAACTGG - Intronic
1047880281 8:129185501-129185523 CTGTTTACTGATAAGGAACCTGG - Intergenic
1048813462 8:138309356-138309378 CTCTCTCCTGGGAAGGAATCAGG - Intronic
1048843075 8:138581881-138581903 TTGATCCCACAGAAGGAATCAGG - Intergenic
1048937054 8:139366128-139366150 CTGTTTAGAGATAAGGAAGCAGG - Intergenic
1049103819 8:140598722-140598744 CAGTTTTCAGAGGAGGAAACGGG - Intronic
1049250149 8:141583887-141583909 CTGCTTCCAGAGATGGAAAGTGG + Intergenic
1049418571 8:142506609-142506631 CTGTTTGCAGAGATGGGAACAGG + Intronic
1051565069 9:18488303-18488325 TTGCTTCCAGATAAGGAAACAGG - Intronic
1051669480 9:19495238-19495260 GTGTTTCAAGCTAAGGAATCCGG - Intergenic
1052546463 9:29887096-29887118 CTGTTTCCAGATAAGAAATCTGG + Intergenic
1052601776 9:30642274-30642296 CTGTTTCCACACAAGAAATTTGG - Intergenic
1057264337 9:93604065-93604087 CTGTTTCCAGAGTTAGAAGCTGG - Intronic
1057421400 9:94915880-94915902 CTTTTTCCAGACAAGGAACATGG + Intronic
1057828268 9:98387849-98387871 CTGCTTGCAAAGAAGGAATTTGG - Intronic
1057905398 9:98978847-98978869 TTGTCTCCAGGGAAGGAAGCTGG - Intronic
1058923423 9:109639969-109639991 CGGTTTCCAGAGCAGGGACCTGG - Intergenic
1059439600 9:114299580-114299602 CTGTTTACAGATGAGGAAACAGG - Intronic
1060120442 9:120984259-120984281 ATGTTTCTAGAGAAAGAATTAGG - Intronic
1060933912 9:127505179-127505201 CATTTTACAGAGAAGGAAACAGG - Intergenic
1061033364 9:128100135-128100157 CATTTTACAGAGAAGGAAACAGG - Intronic
1061408884 9:130407616-130407638 CTGTCTCCAGAGAAGACAGCGGG + Intronic
1061551374 9:131336721-131336743 CTGTTTACAGAGGAGGACTCTGG - Intergenic
1061710717 9:132485868-132485890 CATTTTACAGACAAGGAATCGGG + Intronic
1061954362 9:133953825-133953847 CTGTCTCCAAAGAAGGCACCTGG + Intronic
1062675460 9:137740526-137740548 CTGTGTCCAGGGAAGGGGTCTGG - Intronic
1185840313 X:3383445-3383467 CTATTTGCAGAGAAGGAAGGTGG - Intergenic
1187157991 X:16738902-16738924 CGTTTTCCAGATAAGGAAACTGG + Intronic
1187374445 X:18739477-18739499 AAGTTTCCAGAGAAAGGATCAGG - Intronic
1188700549 X:33255651-33255673 CTGTTTACAGATATGAAATCTGG - Intronic
1188836551 X:34963602-34963624 CTGTTTACTGATAAGGAATTAGG - Intergenic
1189365580 X:40385419-40385441 CTGTTTCCGTAGAAAGAATATGG - Intergenic
1192196496 X:69032174-69032196 CATTTTCCAGAGAAGGATTCTGG - Intergenic
1192767732 X:74159769-74159791 CTGTTTCCTGAAAATGATTCAGG - Intergenic
1193170896 X:78334163-78334185 CATTTTACAGACAAGGAATCTGG - Intergenic
1193270879 X:79529787-79529809 CAGCTTCCAGAGAGGGAAACTGG - Intergenic
1194031050 X:88815665-88815687 CTGTCTCCTGAGACAGAATCAGG - Intergenic
1197524377 X:127544585-127544607 TTGTTTCCAGAGATGCTATCCGG + Intergenic
1197686452 X:129444255-129444277 CATTTTCCAAACAAGGAATCAGG + Intergenic
1199866972 X:151860664-151860686 CTGTGTCCACAGAAGGGCTCAGG + Intergenic
1200827542 Y:7659764-7659786 GTGTGTCCAGAGAGGGAATGTGG + Intergenic
1201755032 Y:17477964-17477986 CATTTTCCAAACAAGGAATCCGG + Intergenic
1201846520 Y:18428021-18428043 CATTTTCCAAACAAGGAATCCGG - Intergenic