ID: 1086409968

View in Genome Browser
Species Human (GRCh38)
Location 11:86535251-86535273
Sequence CTGGAAGAACAGATGAAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 428
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 393}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086409968_1086409973 26 Left 1086409968 11:86535251-86535273 CCTACCTTCATCTGTTCTTCCAG 0: 1
1: 0
2: 3
3: 31
4: 393
Right 1086409973 11:86535300-86535322 TCACATCTATGTCGTCCACTTGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086409968 Original CRISPR CTGGAAGAACAGATGAAGGT AGG (reversed) Intronic
900731110 1:4260971-4260993 CAGGAAGAAGAGAGGAAGGGGGG - Intergenic
900889900 1:5442073-5442095 CTGGAAGACCTGATGGAGGGAGG + Intergenic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
902329785 1:15725602-15725624 CTGGATGAACAGCTGATGCTGGG - Intronic
902603457 1:17555768-17555790 AAGCAAGAACAGATGCAGGTGGG - Intronic
902873474 1:19327548-19327570 CTGGGTGAACAGATGGAGGGAGG - Intronic
905543410 1:38778411-38778433 GTGGGAGAACAGAGGTAGGTAGG - Intergenic
905574672 1:39034311-39034333 CTGGAAAAACAGATCAATTTTGG - Intronic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
906824919 1:48969101-48969123 CTGGAAGAAAAGAGGGAGGGAGG - Intronic
908646513 1:66284138-66284160 CTGGAAGGACACAGGAAGGCAGG + Intronic
910280876 1:85500176-85500198 AAGGAAGAAAAGATGAAGGAAGG - Intronic
911871692 1:103107884-103107906 CTGGAGAAAGAGATGAATGTAGG - Intronic
913698750 1:121353973-121353995 ATGGAAGAAAAAAAGAAGGTAGG + Intronic
913699172 1:121357460-121357482 AAGGAAGAAATGATGAAGGTAGG - Intronic
914138373 1:144922585-144922607 AAGGAAGAAATGATGAAGGTAGG + Intronic
914138795 1:144926062-144926084 ATGGAAGAAAAAAAGAAGGTAGG - Intronic
914325276 1:146608319-146608341 TTGTCAGAACAGCTGAAGGTCGG + Intergenic
914585763 1:149060346-149060368 CTGGAAGCCCAGATGAGGGATGG - Intronic
915142745 1:153777236-153777258 CTGGATGAATTAATGAAGGTGGG - Intronic
915728599 1:158036847-158036869 CTGGGAGAGCAGATGAATGAGGG + Intronic
915768241 1:158388987-158389009 CTGGCTGAACAGAAGAAAGTTGG + Intergenic
916422740 1:164651634-164651656 AAAGAAGAACAGTTGAAGGTGGG + Intronic
916683808 1:167126911-167126933 CTGAAACACCAGAAGAAGGTGGG + Exonic
916785472 1:168084070-168084092 CTGGAACAGCAGTTGAAGTTTGG - Exonic
917099301 1:171429647-171429669 CTGGAAGATCAACTGAAGGAGGG - Intergenic
917731415 1:177878682-177878704 CAGGAAAAAGAAATGAAGGTGGG + Intergenic
917763717 1:178194460-178194482 CTGGAAGTACAGGAGAAGCTTGG + Intronic
918052877 1:180990050-180990072 CTGGAACAACAGATAAATATGGG - Exonic
918484531 1:185015301-185015323 CTGGAAATACAGATGCAGATTGG - Intergenic
918652450 1:186982597-186982619 CTGAATGAACAAATGAAGGTAGG + Intronic
918802635 1:188991433-188991455 CTGGAAGACCAGCTGGTGGTTGG - Intergenic
919325402 1:196100400-196100422 CTGAAAGGAAAGATGAAGGCTGG + Intergenic
919486057 1:198148482-198148504 CAGGAAGAAGAGCTGAAAGTTGG - Intergenic
919505477 1:198392982-198393004 CTGGAAGGAGAGAAGAAGGCAGG - Intergenic
919820760 1:201470375-201470397 CTGGAGGAACTGATCAAGATGGG - Intergenic
920443108 1:205994510-205994532 CAGGAAGAAGAGATGGGGGTGGG + Intronic
920486157 1:206372610-206372632 ATGGAAGAAAAAAAGAAGGTAGG + Intronic
920486582 1:206376172-206376194 AAGGAAGAAATGATGAAGGTAGG - Intronic
921264157 1:213408592-213408614 CTGGAAGAGCAGATGATAGTTGG - Intergenic
921568063 1:216744732-216744754 CTAGAAGAACAGATGGAAGATGG - Intronic
923077548 1:230623437-230623459 ATGGAAAAAAAGAAGAAGGTGGG - Intergenic
923666514 1:236003018-236003040 CAGGAAGCAGAGATGCAGGTGGG - Intronic
923914659 1:238488471-238488493 ATAGAAGAAAAGAGGAAGGTAGG + Intergenic
1063008800 10:2002262-2002284 CTGGAAGAACACATCAAGCCAGG - Intergenic
1063497602 10:6524828-6524850 CTGGAAGCACAGAGGGAGGTGGG - Intronic
1063989857 10:11548753-11548775 CTAGAAGAACAAATGATGGTTGG - Intronic
1064725303 10:18273075-18273097 ATGGAAGGAAAGCTGAAGGTTGG + Intronic
1064764206 10:18654287-18654309 CTGGAAGAACAGAAAAAGGGAGG - Intronic
1065320676 10:24506184-24506206 CTGCAGGAACAGATCCAGGTGGG + Intronic
1069115342 10:64498290-64498312 ATGCAAGAACAGATCAAAGTAGG - Intergenic
1070162182 10:73873469-73873491 CAGCAGGAACAGTTGAAGGTCGG + Intronic
1070813147 10:79308336-79308358 CAGGAAGAACAGTTGGAGTTTGG + Intronic
1070976613 10:80610403-80610425 TGGGAAGAATGGATGAAGGTGGG + Intronic
1071477144 10:86034790-86034812 CTGGATGAACAGATGTATGATGG + Intronic
1073732242 10:106303031-106303053 GTGGAAGATCATATGAAAGTGGG - Intergenic
1074674322 10:115831106-115831128 CTGGAAGAACAAGGGCAGGTGGG - Intronic
1074732257 10:116391861-116391883 CTAGAAGTAAAGATGAAGATGGG + Intergenic
1074983992 10:118641477-118641499 CTGGGAGACCAGAGGAAGGGAGG + Intergenic
1076533393 10:131160343-131160365 CTGGGAGCACAGAGGAAGGATGG - Intronic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1077195392 11:1277254-1277276 CTGGAAGCAAAGATCAAGTTTGG + Intronic
1077221082 11:1416749-1416771 CTGGAGGAACACACCAAGGTGGG - Intronic
1078178124 11:8985982-8986004 CTGGAACAACATATGTAGGATGG - Intronic
1078757445 11:14224294-14224316 TTGGAAGCACAGAGGAAGGGTGG + Intronic
1079356696 11:19735852-19735874 TGGGAAGAACAAATGGAGGTTGG + Intronic
1080914408 11:36641171-36641193 CTGGCTGAACAGAAGAAAGTTGG - Intronic
1084236742 11:67792548-67792570 CGTGAAGAACAGAAGAAGATAGG - Intergenic
1084429815 11:69104923-69104945 CTGGCAGCACAGGTGAAGCTGGG + Intergenic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1085225164 11:74913458-74913480 CTGGAATAGCAGCTGAAAGTGGG - Intronic
1085782536 11:79422737-79422759 CTGGTAGAACAGAGGGAGGGAGG + Intronic
1086409968 11:86535251-86535273 CTGGAAGAACAGATGAAGGTAGG - Intronic
1086543010 11:87935060-87935082 CTGGAAGACAAGAAGAAGGGAGG - Intergenic
1086930680 11:92689648-92689670 ATGGAAGAACAGATGGGAGTGGG + Intronic
1086943347 11:92820631-92820653 CTGGAAGCTCAAATGGAGGTTGG - Intronic
1087180129 11:95133817-95133839 CTGAAGGTACAGATGAGGGTTGG + Intergenic
1087779642 11:102288621-102288643 CTGCTACAACAGATGGAGGTCGG - Intergenic
1088468094 11:110163754-110163776 CTGGAAGACAAGAGGCAGGTAGG + Intronic
1088743376 11:112784956-112784978 CTGGAAGCCCAGATGGAGGGTGG + Intergenic
1089401295 11:118166165-118166187 CTGGAAGAGCAGCTCCAGGTAGG - Exonic
1089618796 11:119710541-119710563 CAGGAAGAAATGATGAATGTGGG + Intronic
1089732699 11:120529134-120529156 CTGCAAGAGCACATGAGGGTCGG - Intronic
1089745146 11:120611575-120611597 CTTGAAGAACAGATGAGAGCTGG - Intronic
1090117190 11:123985350-123985372 TTGGAAGAACTGCTGAGGGTGGG - Intergenic
1090268704 11:125370924-125370946 CTAGAACCACAGATGAAGGAAGG + Intronic
1090306329 11:125694288-125694310 CTGGAAGATCTGATGGGGGTTGG + Intergenic
1090421202 11:126576235-126576257 AAGGAAGGACAAATGAAGGTAGG - Intronic
1090961393 11:131560587-131560609 CTGGAAGAAAGGAGGAAGGGAGG - Intronic
1091416893 12:295673-295695 CTGGAAGAACTTATGATGGTTGG - Exonic
1095848303 12:46771829-46771851 GTGGAAGAGCAGATGAGGCTTGG - Intronic
1095955865 12:47805559-47805581 CTGGCAGAGAAGATGAAGGCTGG + Intronic
1096769481 12:53925605-53925627 CTGAAACAACAGATAAGGGTCGG + Intergenic
1096817057 12:54208475-54208497 CTAGAAGAGCAGAGGAAGATGGG + Intergenic
1098147129 12:67509241-67509263 CTGAAAGAACACATGAAGCAGGG + Intergenic
1099981175 12:89604896-89604918 CTGGAAGTAGGGGTGAAGGTAGG + Intronic
1100067872 12:90672302-90672324 CTGGAGTAACAGAAGAATGTGGG + Intergenic
1101906839 12:108833287-108833309 CTGGTAGAGCAGATGATGCTTGG - Intronic
1102783541 12:115585520-115585542 CTGGGAGGACAGATGCAGGGAGG + Intergenic
1103294645 12:119876073-119876095 CTGGAAGAACAGATTCAGCCTGG + Exonic
1104137416 12:125953742-125953764 CTGGGGGATCCGATGAAGGTAGG + Intergenic
1105587518 13:21758767-21758789 TAGGAAGAACAAATAAAGGTTGG + Intergenic
1105931939 13:25060708-25060730 ATGGAAGAAGAGGTGAGGGTGGG + Intergenic
1106027755 13:25971495-25971517 CTGAAAGATCAGATGAGGGTAGG - Intronic
1108107897 13:47032926-47032948 CTGTGAGAACAGAAAAAGGTGGG - Intergenic
1108338226 13:49468620-49468642 CTGAAAGAACAAATGAAATTAGG - Intronic
1109013338 13:56976989-56977011 GTGGTAGAATAGATGAAGGATGG - Intergenic
1110546598 13:76763021-76763043 CTGGATGAACCGGTGGAGGTTGG - Intergenic
1111670636 13:91325212-91325234 CTGGCAGAACGGATGAAGATGGG - Intergenic
1111961857 13:94820047-94820069 CTGTAAGACAAGATGAAGATGGG - Intergenic
1112354573 13:98662982-98663004 CTGGAAGAAAAGGGAAAGGTGGG + Intergenic
1112357197 13:98683569-98683591 ATAGATGAACAGATAAAGGTAGG - Intergenic
1112687574 13:101849040-101849062 CTGGAAGAACTGAGCAAGGAAGG - Intronic
1113060070 13:106313580-106313602 CTGGAAGAACCAATGCAGGATGG + Intergenic
1113383079 13:109821272-109821294 CAGGAAGAGCAGATGCAGGGAGG - Intergenic
1115627933 14:35213687-35213709 ATGGAAGAACAGCTGATGGGTGG + Intronic
1116170656 14:41397814-41397836 CTTCAAGATCAGATGAATGTAGG + Intergenic
1116395263 14:44440847-44440869 CTTGAAGATCAGATGATTGTAGG - Intergenic
1116646839 14:47539586-47539608 TTGGAAGAAAGGATGCAGGTAGG - Intronic
1117116422 14:52517791-52517813 CTGGAAGAATATATGGAGTTAGG - Intronic
1117879396 14:60296284-60296306 CTGAAAGAACTGATGAAATTGGG + Intronic
1119564805 14:75619462-75619484 ATGGATGAGCAGATGAACGTTGG - Intronic
1119898363 14:78239568-78239590 CTTGAAGAACAGCAGGAGGTAGG - Intergenic
1120244361 14:81989097-81989119 CTGAAAGCTCAGATGATGGTCGG + Intergenic
1120579538 14:86228793-86228815 CTGGAAGAGCAGAACAAAGTTGG - Intergenic
1122355091 14:101118162-101118184 CTGGAAGGAGAGATGGAGGGAGG - Intergenic
1123118774 14:105907482-105907504 CTGGCAGAACAGAGGAGGGGAGG - Intergenic
1123759591 15:23422205-23422227 CTGAACGAACAGATGAATGAGGG + Intergenic
1124162100 15:27281345-27281367 CTGGAAAAACAGGCAAAGGTGGG - Intronic
1124260696 15:28187790-28187812 AAGGCAGAACAGAGGAAGGTTGG - Intronic
1125294302 15:38185595-38185617 ATGGAAGAAAAGAGGGAGGTTGG + Intergenic
1125838828 15:42778996-42779018 TGGGAAGGAAAGATGAAGGTGGG + Intronic
1126489796 15:49224617-49224639 GTGGAAGATCAGATGGATGTAGG + Intronic
1126775429 15:52096287-52096309 CTGGAATTAAAGATGATGGTTGG + Intergenic
1128389625 15:67174284-67174306 CTGGAAACACCGATGAAGTTTGG + Intronic
1128606602 15:69040978-69041000 CTTCAAGAACTGGTGAAGGTGGG - Intronic
1128652201 15:69425557-69425579 CTGTATGACAAGATGAAGGTTGG - Intronic
1128879800 15:71232559-71232581 CTGGAAGTACAGAAGTAGGTAGG + Intronic
1129943854 15:79522383-79522405 CTGGAAAAACAATAGAAGGTGGG - Intergenic
1132113545 15:99119466-99119488 CTGGAAGACAAGATGAAGGATGG + Intronic
1132580522 16:682671-682693 CTGGAAAAGCAGGTGAGGGTGGG + Exonic
1132608690 16:804415-804437 CTGGAAGGACAGAAGCAGGCTGG + Intergenic
1133039856 16:3054875-3054897 TTGGACGGACAGATGATGGTAGG + Intronic
1133635025 16:7657055-7657077 CAGGAAGAACAGATTTAGGTTGG - Intronic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1134456757 16:14400691-14400713 CTGAACGAACAGATGAATGGGGG - Intergenic
1135007497 16:18839592-18839614 CTGGAGGGACAGAGGAAGGAAGG + Intronic
1136129286 16:28209666-28209688 CTGAAAGAATAAATGAAGGAAGG + Intronic
1136221578 16:28832852-28832874 CTGGAAGAACTGAGAAAGTTTGG + Exonic
1136232579 16:28895245-28895267 AAGGAATAACAGATGAAGTTGGG - Intronic
1137942859 16:52705802-52705824 ATGGATGAACAAAAGAAGGTAGG + Intergenic
1138876088 16:60951836-60951858 CAGGAAGATCAAATGTAGGTAGG + Intergenic
1139001933 16:62521348-62521370 CTGTAATAACAGCTGAATGTTGG + Intergenic
1140008287 16:71102628-71102650 TTGTCAGAACAGCTGAAGGTCGG - Intronic
1140511521 16:75512259-75512281 CTGGAACACAAGATGAAAGTGGG - Intergenic
1140887456 16:79257409-79257431 CTGGAAGAACAGAGCAAAGTAGG - Intergenic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1143766312 17:9139821-9139843 ATGGATGAACAGATGATGGAAGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146943103 17:36857421-36857443 CTGTAAGAATAGATGGAGATGGG - Intergenic
1147142573 17:38467616-38467638 AAGGAAGAACAGATGATGGATGG - Intronic
1147702323 17:42403939-42403961 ATGGAAAAATAGAAGAAGGTCGG - Exonic
1148452883 17:47791540-47791562 CTGGAAGTGGAGAAGAAGGTAGG - Intergenic
1149263985 17:54907917-54907939 ATGGAAGAAGATATGGAGGTGGG - Intronic
1150280999 17:63929591-63929613 CTGCAAGAACAGCTGAATGAAGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1152110361 17:78354370-78354392 GTGGAAAGACAGAGGAAGGTTGG + Intergenic
1153439408 18:5100297-5100319 CTGGCAAAACAGATTAAGGGAGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155917756 18:31572809-31572831 CTGGGAGAACAGGTTAAAGTAGG - Intergenic
1156436503 18:37135943-37135965 CTTGAAGATCAGATGACAGTAGG + Intronic
1156598822 18:38579708-38579730 CCAGAAGAACAGAAGGAGGTGGG + Intergenic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1156931727 18:42652937-42652959 TTGGAAGATCAGATGATTGTAGG - Intergenic
1157159152 18:45297062-45297084 CTGGAAGAAGGAAAGAAGGTTGG + Intronic
1157299109 18:46466959-46466981 CTGGAAGAACACTTGAGGCTAGG + Intergenic
1157913264 18:51639352-51639374 CTGGAAGAACAGTCGAAGATAGG - Intergenic
1158882643 18:61795872-61795894 AGGGAAGAACAGAAGAAGGAAGG + Intergenic
1160131215 18:76226436-76226458 TGGGAAGAACAGATGAAGTGAGG - Intergenic
1160740156 19:681860-681882 CTGGAAGGACTGAGGAAGGGAGG + Exonic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1161675734 19:5647504-5647526 TTGGAAGAGGAGATGAAGGAGGG + Intronic
1161795408 19:6383536-6383558 CTGCAAGCACAGATGCAGGGTGG - Intronic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1162559013 19:11405232-11405254 CTGGAAGGACAGGAGAAGGGTGG + Intronic
1163244642 19:16085766-16085788 CTGGTAGTAAAGATGAAGGGAGG + Intronic
1164473243 19:28553223-28553245 CTGGCACAGCAGATGAAGGTAGG - Intergenic
1165369948 19:35398786-35398808 TTGGGAGAACAGAGGAAGGAAGG - Intergenic
1167075134 19:47243966-47243988 CAGGAAGAAGAGACAAAGGTGGG - Intergenic
1167192976 19:48004589-48004611 CTGGAGGAACAGATGGAGGAGGG - Intronic
1167233755 19:48301637-48301659 ATGGATGAACAGATGGATGTGGG + Intronic
1168241583 19:55091645-55091667 CTGGAGGAGGAGCTGAAGGTGGG - Exonic
925352357 2:3210342-3210364 CTGGAAAAACAGATGTGGGTGGG - Intronic
925601992 2:5617517-5617539 GGGGAAGCACAGATGATGGTGGG + Intergenic
926008399 2:9390149-9390171 CTGGAAGAAGAAATGATGCTAGG - Intronic
927058967 2:19395942-19395964 GTGCAATAACAGATGAAGATGGG + Intergenic
928058091 2:28078893-28078915 ATGGAAGGACAGAGGAAGGGAGG - Intronic
928220834 2:29401560-29401582 GTGGAAGAACAGAGGTGGGTGGG + Intronic
928244482 2:29615309-29615331 CTAGAAGAACAGAAGAAAGAGGG - Intronic
928255246 2:29716596-29716618 CTGGGAGAAAAAATGAAAGTAGG + Intronic
930125887 2:47796046-47796068 GAGGAAGAAGAGATGGAGGTGGG + Exonic
930222532 2:48759611-48759633 TTGGAAGAAAAGGTGAATGTAGG + Intronic
930321180 2:49856680-49856702 CTGTAAGCCCAGATGAAGGTAGG + Intergenic
930569460 2:53066553-53066575 CTGGATGAATAGATGATGGATGG + Intergenic
930888634 2:56357219-56357241 CTTGAAGAAGAGATCAAGATAGG + Intronic
931097150 2:58954014-58954036 CTGGAAGGACAGGTGAAGATGGG - Intergenic
931107330 2:59070815-59070837 CTGAGCGAAAAGATGAAGGTAGG - Intergenic
932160967 2:69459200-69459222 CTAGAAGAAAGGATGAAGGAAGG - Intronic
932312947 2:70758842-70758864 CTGGAAGCAGGGAAGAAGGTGGG + Intronic
932601146 2:73126817-73126839 CTGGACCACCTGATGAAGGTGGG - Intronic
933450908 2:82449964-82449986 CTGGAAGATCTGCTGAAAGTGGG - Intergenic
933638639 2:84735045-84735067 CTGAAAGAGCAGATGGAGGGAGG - Intronic
935978010 2:108598442-108598464 TTGGAAGGAAAGCTGAAGGTAGG + Intronic
936135627 2:109891036-109891058 TTGGAAGGAAAGTTGAAGGTAGG + Intergenic
936209070 2:110480449-110480471 TTGGAAGGAAAGTTGAAGGTAGG - Intergenic
936514776 2:113174606-113174628 CTGGAAGGCAAGATGAAGCTGGG - Intronic
936572976 2:113631681-113631703 CTGGAAGACAGGATGAAGGAGGG - Intronic
936633445 2:114229611-114229633 GTGGAAGATCAGATGGTGGTAGG + Intergenic
936878288 2:117218862-117218884 CTGGAAGAGCAGAGGAGGGTGGG + Intergenic
938041215 2:128077811-128077833 CTGAAACAAGAGATGAAGATTGG - Intergenic
938904307 2:135824214-135824236 ATGAAAGAAGAGGTGAAGGTGGG - Intronic
939437865 2:142201864-142201886 CTGAGATAATAGATGAAGGTGGG + Intergenic
939729506 2:145764680-145764702 CTGTAAGAGAAGATGAAGGAGGG - Intergenic
940714079 2:157198564-157198586 AAGGAAGAACAGAGGAAGGAAGG + Intergenic
940936407 2:159500308-159500330 CTTGAAGATCAGATGATTGTAGG + Intronic
942384838 2:175431740-175431762 CTTGAAAAACAGATGAAGAGTGG + Intergenic
942556659 2:177178449-177178471 CTGGAAAAGCAGGTGAGGGTGGG + Intergenic
943235951 2:185319807-185319829 CTTGAAGATCAAATGAAAGTAGG + Intergenic
944883951 2:204043782-204043804 GTGGAAGAACTGATTATGGTAGG + Intergenic
945953889 2:216067136-216067158 CTGGCGGAAGAGATGAAGTTGGG + Intronic
946079676 2:217106643-217106665 AGGGAAGAAAAGAAGAAGGTGGG - Intergenic
946413754 2:219529006-219529028 CTGGTAGAACAGATGTGGGGAGG - Intronic
946491997 2:220157544-220157566 CTGGAAGAAAAGAAGAAATTTGG + Intergenic
946725856 2:222660418-222660440 AAGAAAGAAAAGATGAAGGTGGG + Intergenic
947696739 2:232196730-232196752 GTAGAAGAACAAATGTAGGTAGG + Intronic
948092428 2:235305736-235305758 CTGGCATGACAGATGAGGGTTGG - Intergenic
948533185 2:238626552-238626574 CTTGAAGAACTGAGGAAGGCAGG - Intergenic
1170095844 20:12645270-12645292 CTGGATGAATGGATGAAAGTAGG + Intergenic
1170341543 20:15333517-15333539 CTGGAAGAAGAGTTTCAGGTAGG + Intronic
1170441461 20:16383955-16383977 CTGGAAGAACAAGTGACGGAGGG - Intronic
1170793064 20:19523764-19523786 CTTGAAGAACACATGAAAGCAGG + Intronic
1173073242 20:39790499-39790521 CAGGAAGAACAGAGGAAGAAGGG + Intergenic
1173096050 20:40029574-40029596 ATGGAAGAACAGAGAAAGGGAGG + Intergenic
1173788725 20:45813594-45813616 CTGGAAGAAATGGTGTAGGTGGG - Intronic
1174747025 20:53073241-53073263 ATGGAAGGATAGATGAAGGAAGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175477387 20:59286444-59286466 TTTGAAGTAGAGATGAAGGTTGG + Intergenic
1175823288 20:61923428-61923450 CTGGAACAACAGATCAGGGCTGG - Intronic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1178375892 21:32067323-32067345 CTGGAAGAACAGAGGCAAGTAGG - Intergenic
1178467831 21:32864752-32864774 CTGGGAGAACAGTGGAAGGAAGG - Intergenic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179336693 21:40463450-40463472 CTGGAAGAACTGATGGAAGAAGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1180575096 22:16766193-16766215 CTGGGAGAAGAGATTAAGGAAGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182476448 22:30579141-30579163 CTGGAAGAGCAGAGGATGGAGGG - Exonic
1182945745 22:34319817-34319839 GTGGAAGCAGAGATGGAGGTGGG + Intergenic
1184892036 22:47386022-47386044 CTGGATGAATAAATGAAGGAAGG - Intergenic
1185427213 22:50779193-50779215 CTGGAAGACAGGATGAAGGAGGG + Intronic
949488116 3:4560698-4560720 CTGGAGGAACAGATTAACTTTGG + Intronic
949966261 3:9359057-9359079 CTGGCAAAACAGATTATGGTGGG + Intronic
950223459 3:11214195-11214217 CTGGAAGAAGAGAGGCTGGTCGG + Intronic
950538375 3:13594888-13594910 TTGGAAGAACTGATGAAGATGGG + Intronic
953005738 3:38977636-38977658 CTGGAAAGGCAGGTGAAGGTAGG - Intergenic
953116832 3:40001017-40001039 CTGGTGGACCAGATGAATGTGGG + Intronic
954152200 3:48663136-48663158 CTGGAAGGACAGAAAAAGGCTGG - Intergenic
954318282 3:49813122-49813144 CTGGAGGAGCAGCTGAAGGTGGG - Exonic
955889389 3:63633826-63633848 CTGGAAGAACAGAGCTGGGTAGG + Intergenic
955962764 3:64357897-64357919 AGGGAAGAACAGAGGAAGGAAGG - Intronic
956258786 3:67314078-67314100 GTGGAAGAAAAGATAAAGGGAGG - Intergenic
958945659 3:100359239-100359261 CTGCAAGAACAGAACATGGTGGG + Intergenic
959198788 3:103220428-103220450 CTGCAAAAACTGATGAAGTTCGG + Intergenic
959568715 3:107859171-107859193 CTGGAAGAAGAGCTGAATGGTGG + Intergenic
959890616 3:111551161-111551183 CTGGAAGAAGAGATGTTTGTAGG + Intronic
961868161 3:129969159-129969181 CTGAAAGAATAAATCAAGGTTGG + Intergenic
962049359 3:131796508-131796530 TTGGAGGAAATGATGAAGGTTGG + Intronic
962866036 3:139448626-139448648 TTGACAGGACAGATGAAGGTGGG - Intergenic
964052825 3:152417669-152417691 GTGAAAGAACAAATGAAGGAAGG + Intronic
964127965 3:153256376-153256398 CTGGAAGAAAAGATGAGGGTGGG - Intergenic
964388349 3:156173095-156173117 CTGGAAGAAGATCTGAATGTCGG + Intronic
965180491 3:165396412-165396434 GTGGAAGATCAGATGACTGTAGG - Intergenic
965262022 3:166499436-166499458 GTGGAAGGACGGAGGAAGGTGGG - Intergenic
966393681 3:179478902-179478924 CTGGAAGAAGAGAGAGAGGTGGG - Intergenic
967220595 3:187244988-187245010 TTGGAGGAAAAGATGAAGGAGGG + Intronic
971154291 4:24065220-24065242 TTGGAGGAGCAGATGCAGGTAGG - Intergenic
971155399 4:24076107-24076129 CTGGAAGCATAGTTGAGGGTGGG - Intergenic
972193874 4:36629058-36629080 CTGGAAGATTAGATGAATGATGG - Intergenic
972947439 4:44273539-44273561 CTGGGAAAAAAGATGAAGATGGG + Intronic
973115785 4:46456789-46456811 TTGGAAGACCAGAAGAAAGTGGG + Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974706534 4:65524508-65524530 CTAGAAGACCAGATTAATGTTGG + Intronic
978713473 4:111813723-111813745 CTGGTAGGATAGATGAGGGTGGG - Intergenic
978915998 4:114126959-114126981 CTTCAAGAACAGATAAAGGAGGG + Intergenic
979392513 4:120143277-120143299 TTGGAAGCACAGATAAAGCTTGG - Intergenic
979734801 4:124070164-124070186 CAGGAAGAAGAGATAGAGGTAGG + Intergenic
979916749 4:126444563-126444585 GTGGAAGAACTGGTCAAGGTCGG + Intergenic
980333166 4:131435819-131435841 GTGGAAGATCAGATGATTGTAGG + Intergenic
981348620 4:143702548-143702570 CTGGAAGTAGAGATGGATGTGGG + Intergenic
981803436 4:148684504-148684526 CTGGAAGTAGAGAGGAAGGCAGG - Intergenic
982980238 4:162124491-162124513 CTTTAAGAACAGAGGAAGGGAGG - Intronic
984324819 4:178239031-178239053 GTTGAAGATCAGATGAATGTAGG - Intergenic
984502692 4:180576541-180576563 ATGGAAGAAGATATGCAGGTGGG + Intergenic
984601577 4:181733067-181733089 CTGAAAATGCAGATGAAGGTTGG + Intergenic
985304592 4:188524604-188524626 CGGGAAGACCATATGAAAGTGGG - Intergenic
985629376 5:1006814-1006836 CTGGGAGGACAGGTGGAGGTGGG - Intergenic
986319395 5:6615678-6615700 CTGGAAGGACAGCAGCAGGTGGG + Intronic
987386570 5:17335452-17335474 CAGGGAGAACAGATTTAGGTTGG + Intergenic
987410159 5:17606835-17606857 TTGGAAGAACTGATGGAGATGGG + Intergenic
987410816 5:17613041-17613063 TTGGAAGAACTGATGGAGATGGG + Intergenic
987686642 5:21212890-21212912 GAGAAAGAAGAGATGAAGGTAGG + Intergenic
988717501 5:33842638-33842660 CTGGAAAAACAGAGGAAAGTGGG + Intronic
988921718 5:35948474-35948496 ATGGAAGGACACATGAAGGGTGG + Intergenic
989604475 5:43230730-43230752 AAGAAAGAACAGATGAAGGGGGG + Intronic
991601084 5:68351775-68351797 CTGGAAGACCAGAGGTAGGAAGG - Intergenic
992501710 5:77350008-77350030 CTGGAGGAACAGGTGCAGCTGGG - Intronic
992728881 5:79638092-79638114 ATGTAAGAACAGAAGAAGGCTGG - Intronic
993144835 5:84080472-84080494 CTGCAAGAACAGAAGAGAGTTGG - Intronic
993322623 5:86492090-86492112 AGGGAAGGACAGATGAAGGAAGG - Intergenic
993572391 5:89557606-89557628 CTGGTAAAAAAGATGATGGTGGG + Intergenic
994037201 5:95215163-95215185 CTTGGAGAAGAGAGGAAGGTAGG - Intronic
994056122 5:95417989-95418011 GTGAAACCACAGATGAAGGTGGG - Intronic
994075425 5:95644539-95644561 CTAAAAGAACAAATGAAGGAAGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
994764368 5:103898853-103898875 TTGGAAGAACAGGTGAAGATGGG - Intergenic
994957438 5:106551455-106551477 GTGGAAGACCAGATGGTGGTAGG - Intergenic
995270108 5:110210224-110210246 ATGGAAGATCAGATGATTGTGGG + Intergenic
995553702 5:113305540-113305562 CTGGAAGAGAAGATGAAGGAAGG - Intronic
998082005 5:139283508-139283530 CTGGAAGAACAGATCATTGTTGG - Intronic
1000702908 5:164475037-164475059 CTTGGAGAACAGATGAATATTGG + Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1002043606 5:176530499-176530521 CTGGGAGCCCAGATGCAGGTCGG + Intronic
1002615172 5:180448620-180448642 CTGGGAGAACAGGTGCAGGCCGG + Intergenic
1002713840 5:181212763-181212785 CTGTAAGAGCAGATGAAATTCGG - Intergenic
1003365861 6:5474308-5474330 CTTGAAGTGGAGATGAAGGTGGG + Intronic
1003382736 6:5639629-5639651 ATAGAAGAAGAGAGGAAGGTAGG - Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005184906 6:23154428-23154450 CTGGAATAGCTAATGAAGGTAGG + Intergenic
1005251187 6:23948348-23948370 GTGGAAGATCAGATGACTGTAGG - Intergenic
1005283140 6:24296177-24296199 GTCGAAGAACAGATGGAAGTAGG - Intronic
1005359077 6:25013525-25013547 CTGGCAGAGCTGATGAAGGTGGG - Intronic
1006408911 6:33860789-33860811 AGGGGAGGACAGATGAAGGTTGG - Intergenic
1007825006 6:44593886-44593908 CAGGAAGAACAGATGCAGCCAGG + Intergenic
1007922235 6:45620809-45620831 CTGAAAGAATTGAAGAAGGTGGG - Intronic
1007954695 6:45906001-45906023 GTGGAAGATCAGATGACCGTAGG + Intronic
1008389086 6:50928530-50928552 CTGGAAGAGAAGATACAGGTGGG - Intergenic
1008433444 6:51447107-51447129 GTGGAAGAACAGAGTAAAGTGGG + Intergenic
1009909925 6:69913466-69913488 CTGAGAGAACAGATGAAGCCAGG + Intronic
1011701582 6:89960156-89960178 CTGGAAGAACAGAAAAGGGAAGG - Intronic
1012633413 6:101502993-101503015 GAGGAATAACAGATGGAGGTGGG + Intronic
1013934978 6:115583100-115583122 ATAGAAAAACAGATTAAGGTAGG - Intergenic
1015427155 6:133084386-133084408 CTGGAGTAACACATGAAGGATGG - Intergenic
1016635320 6:146282479-146282501 ATGAAAGAAAAGATGAAGGAAGG + Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017120637 6:151020905-151020927 CTGGAAGAACGTATGGAGGAGGG - Intronic
1017265562 6:152441599-152441621 AAGGAAGCACAGAAGAAGGTAGG + Intronic
1017385571 6:153878899-153878921 CATGAAGAACAAATGAAGGAAGG + Intergenic
1018287796 6:162259252-162259274 GTGGGAGAACAGAGGCAGGTCGG - Intronic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020290367 7:6718281-6718303 CTGGGACAGCAGAGGAAGGTGGG - Intergenic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021426322 7:20503539-20503561 CTAGAAAGACAGATGAAAGTTGG + Intergenic
1023752289 7:43384256-43384278 CTGGAAATGCAGAAGAAGGTAGG + Intronic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1026316025 7:69228396-69228418 CTGCAAATACAGATGAAGCTTGG + Intergenic
1026355296 7:69552141-69552163 CAGGAAAAGCAGATGAGGGTTGG - Intergenic
1026797168 7:73373786-73373808 GTGGAAGAAAAGATGAGGCTAGG - Intergenic
1028322166 7:89473704-89473726 ATGGGAAAACTGATGAAGGTTGG + Intergenic
1028719217 7:94010606-94010628 CTGGAAGAAAAAAGGAAGGAAGG - Intergenic
1032963437 7:137067403-137067425 CTGGAGGAATAGATGCAGTTGGG + Intergenic
1033454894 7:141493777-141493799 CTAGAAGACCAGGTGAAGGAAGG - Intergenic
1033927885 7:146486507-146486529 CTGGAAGAAGGGATTAGGGTGGG + Intronic
1034725363 7:153330733-153330755 CTGGGATAACAGGTCAAGGTAGG + Intergenic
1035310953 7:157968515-157968537 CTGGAAAAACAGAAGGAGGCTGG - Intronic
1035488901 7:159254904-159254926 ATTGAAGAACAGGTGAAGATGGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1037096169 8:14990397-14990419 CTGAAAGTACAGATGCAGCTTGG - Intronic
1037109771 8:15152238-15152260 CTGGAAGAACAAAGCAAGGCAGG + Intronic
1038407695 8:27334302-27334324 TTAGAAGAGCAGATCAAGGTTGG - Intronic
1039753625 8:40499256-40499278 CTGAAAGAAAAGAGGAAGGGCGG + Intergenic
1039806144 8:41001359-41001381 CAGCAATAACAGATGTAGGTGGG + Intergenic
1041196420 8:55406255-55406277 CTGGAAGAAAAGATGCAACTAGG - Intronic
1041843477 8:62298722-62298744 CTGGAGGAACAGATTTAGGTTGG - Intronic
1044690588 8:94873511-94873533 CAGGAAGAACATATACAGGTAGG - Intronic
1044708673 8:95033815-95033837 CTTAAAGAACAGAAGAAGGCAGG + Intronic
1044830781 8:96245855-96245877 GTGAAAGAAAATATGAAGGTAGG - Exonic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045597440 8:103672544-103672566 CAGGAAGAAGAGAGGATGGTGGG + Intronic
1046620623 8:116525893-116525915 CTGGAAGAATAGAGGCAGCTGGG + Intergenic
1046662905 8:116967955-116967977 CTGCACAAACAGATGAGGGTTGG + Intronic
1047704265 8:127481939-127481961 TTGGAAGAAAAGATCAAGGGAGG + Intergenic
1049596367 8:143485594-143485616 CTAGAAGAAAACATGAATGTGGG + Intronic
1051504206 9:17809969-17809991 CTAGAAGATGAGATGAAGGGAGG - Intergenic
1052660809 9:31428534-31428556 CTGAAAGAACAGATGAGAGAAGG + Intergenic
1054896482 9:70318670-70318692 TTAGAAGAACAGCTAAAGGTTGG + Exonic
1055024103 9:71701019-71701041 TTTGAGCAACAGATGAAGGTGGG - Intronic
1055605195 9:77962216-77962238 CTAGAAGAAGAGAGAAAGGTGGG + Intronic
1056405881 9:86274639-86274661 CAGGAAAAACACCTGAAGGTTGG - Intronic
1056528981 9:87470353-87470375 TTGGAAGAACAGATGAGAGCTGG - Intergenic
1056950907 9:91039986-91040008 CGGTCAGAACAGATGGAGGTGGG + Intergenic
1057042569 9:91858065-91858087 CTGGAAGAAGAAACAAAGGTTGG + Intronic
1058495548 9:105554968-105554990 TGGGAAGTACAGATGAAGCTTGG + Intergenic
1058643464 9:107109025-107109047 CTGGAAGAAGAGATGCTGGAAGG - Intergenic
1059862563 9:118481220-118481242 GTGGAAGAAGAGAGGAAGGAAGG + Intergenic
1061244930 9:129396683-129396705 ATGGATGAAAAGATGAAGGGTGG + Intergenic
1061740934 9:132705514-132705536 CTGGCACAACAGCTGCAGGTGGG - Intergenic
1185638230 X:1570806-1570828 CGGGAAGAACACGGGAAGGTAGG - Intergenic
1185820201 X:3195835-3195857 CTGGAAGAAAAGGGGAAGGAAGG + Intergenic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1186269093 X:7865615-7865637 CTGAAAGATCAGATGTAGGTTGG + Intergenic
1187071099 X:15889223-15889245 CTGTAAGAACAAATGGAGGAGGG + Intergenic
1188771039 X:34154831-34154853 GTGGAAGATCAGATGTATGTAGG + Intergenic
1188796789 X:34476826-34476848 GTGGAAGATCAGATGTATGTAGG + Intergenic
1190047371 X:47123527-47123549 CTGGTAGGACACGTGAAGGTCGG + Intergenic
1190725957 X:53190707-53190729 CTGGAAGACTAGATGAAGCAGGG + Intergenic
1190879843 X:54484276-54484298 CTGCAAGAACACATGAGGGTGGG - Intronic
1191105578 X:56770178-56770200 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191106571 X:56775580-56775602 GTGGAAGCACAGATGAAGACAGG - Intergenic
1191108198 X:56785392-56785414 ATGGAAGCACAGATGAAGATGGG - Intergenic
1191109031 X:56790692-56790714 TTGGAAGCACAGATGAAGACAGG - Intergenic
1195534143 X:105992021-105992043 AGGGAAGGACAGATGAAGGAAGG - Intergenic
1196035539 X:111139829-111139851 TTGGAGGTACAGATTAAGGTAGG + Intronic
1196253557 X:113489466-113489488 CTGGAAATACAAATGAAGGAAGG + Intergenic
1196810591 X:119626082-119626104 CTGGAAGTACAGAAGAAGACAGG + Intronic
1200213909 X:154359042-154359064 CTGGAAGGACTGAGGGAGGTTGG + Exonic