ID: 1086411350

View in Genome Browser
Species Human (GRCh38)
Location 11:86547772-86547794
Sequence ACATATAAGCAGGAGTTGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 192}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086411350_1086411354 1 Left 1086411350 11:86547772-86547794 CCACTCAACTCCTGCTTATATGT 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1086411354 11:86547796-86547818 CGTATTTCCTTCTCAGGGCTAGG 0: 1
1: 0
2: 0
3: 20
4: 110
1086411350_1086411352 -5 Left 1086411350 11:86547772-86547794 CCACTCAACTCCTGCTTATATGT 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1086411352 11:86547790-86547812 TATGTACGTATTTCCTTCTCAGG 0: 1
1: 0
2: 1
3: 10
4: 129
1086411350_1086411353 -4 Left 1086411350 11:86547772-86547794 CCACTCAACTCCTGCTTATATGT 0: 1
1: 0
2: 0
3: 23
4: 192
Right 1086411353 11:86547791-86547813 ATGTACGTATTTCCTTCTCAGGG 0: 1
1: 0
2: 2
3: 15
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086411350 Original CRISPR ACATATAAGCAGGAGTTGAG TGG (reversed) Intronic
903996152 1:27306634-27306656 ACATGAAAGCAGGAGATGGGGGG - Exonic
904285650 1:29451789-29451811 ACTTGGAAGCAGGAGGTGAGTGG + Intergenic
904419771 1:30384236-30384258 ACTTGGAAGCAGGAGGTGAGTGG - Intergenic
906063618 1:42964094-42964116 AAATTTAAGCAGGGGTGGAGGGG - Intergenic
906442518 1:45860855-45860877 AGATAATAGCAGGAGTTGAGAGG - Intronic
906568068 1:46814453-46814475 ACATATTAGCAGGGGTTCAGAGG + Intronic
908296645 1:62719419-62719441 TCAGATCAGTAGGAGTTGAGAGG - Intergenic
908640906 1:66222250-66222272 AAATATAAGCAGAAGTTGTTGGG - Intronic
908798704 1:67856700-67856722 AGATATAAGCTGGAGATGATAGG + Intergenic
909252041 1:73370905-73370927 AAAGATAAGCAGAAGTCGAGTGG - Intergenic
911457039 1:98138495-98138517 ACTTATAAGCAGGAGCTAAACGG - Intergenic
913538170 1:119794174-119794196 AAAAACAAGCAGGAGTTGAGTGG + Exonic
913575288 1:120166948-120166970 AAACATAAGGAGGAGTTTAGGGG + Intronic
914371319 1:147027147-147027169 ACTTATGAGCAGGAGCTGAGAGG + Intergenic
914557593 1:148782588-148782610 AAACATAAGGAGGAGTTTAGGGG + Intergenic
914615241 1:149347642-149347664 AAACATAAGGAGGAGTTTAGGGG - Intergenic
914872273 1:151485038-151485060 AAATATAAGCTGGAGTAGAGTGG + Intergenic
917921163 1:179751126-179751148 ATATACAGGCAGGAGTTCAGAGG + Intronic
921925191 1:220705470-220705492 ATGTAGAAGCAGGGGTTGAGGGG + Intergenic
922115171 1:222606530-222606552 ACCTCTAAGCAGGATTTTAGTGG + Intergenic
1064835175 10:19519326-19519348 ACATATAAGCATGAAGTGAAAGG + Intronic
1065482115 10:26206098-26206120 TCATCTAAGCTGGAGTTCAGTGG + Intronic
1071085127 10:81861420-81861442 CTATGTAAGCAGGAGGTGAGGGG - Intergenic
1071131637 10:82400514-82400536 ACAGAAAAGCTGGGGTTGAGAGG + Intronic
1073866059 10:107805251-107805273 ACATATAAGGAGAATTTGAGTGG + Intergenic
1074334558 10:112558058-112558080 ACACATGAACAGGAGTTGAGGGG - Intronic
1074812370 10:117118533-117118555 ATATATAACCAGGAGTGGAATGG - Intronic
1079980433 11:27145778-27145800 ACATATATCTAGGAGTTGAATGG - Intergenic
1081401398 11:42647277-42647299 ACATGTCAGCAGGTGTTGAAAGG - Intergenic
1083150032 11:60786117-60786139 ACAGAAAGGCAGGAATTGAGAGG - Intronic
1084866531 11:72062748-72062770 ACAAATAAGCAGGTATTAAGTGG + Intronic
1086194209 11:84117477-84117499 ATCTATAAGTAGGAGTTGGGAGG - Intronic
1086411350 11:86547772-86547794 ACATATAAGCAGGAGTTGAGTGG - Intronic
1088482069 11:110303726-110303748 TCATCTCAGCAGGAGGTGAGAGG + Intergenic
1088624257 11:111717858-111717880 ACGTATAAGTAGGAGTTGAATGG + Intronic
1089820092 11:121217753-121217775 ACAAATTAACAGGGGTTGAGAGG + Intergenic
1091714815 12:2769141-2769163 ATATATAAGCACGAGGTGATTGG - Intergenic
1091865139 12:3827574-3827596 GCAAATAAGCAGGATTTAAGAGG - Intronic
1092117721 12:6021298-6021320 ACTTATGAGCAGGACTTCAGAGG + Intronic
1094201078 12:27795015-27795037 ACATAAACACAGGAGTTCAGGGG - Intronic
1094755644 12:33465054-33465076 AAAAAAAAGCAGGGGTTGAGGGG + Intergenic
1096338105 12:50772983-50773005 ACTTATAAGTAGGAGCTGAATGG - Intronic
1097810069 12:64009465-64009487 ACATATAAACAGTATTTGAATGG - Intronic
1098213550 12:68191719-68191741 ACAAACAAGCAGGAGTGGGGGGG - Intergenic
1099654168 12:85468427-85468449 AGAAAGAAGTAGGAGTTGAGGGG - Intergenic
1099722087 12:86376701-86376723 ATAAATAAGCAGGACTTAAGGGG + Intronic
1101284724 12:103298986-103299008 CTATATAATCAGGAGGTGAGGGG + Intronic
1102902338 12:116648071-116648093 ACATCTAAGCGGGAGTTGATGGG + Intergenic
1103433911 12:120909494-120909516 AACTATAAGCAGCAGTTAAGAGG - Intergenic
1104930170 12:132334647-132334669 ACAGAAAAGCAGGAGGGGAGGGG - Intergenic
1106697024 13:32185944-32185966 ATATGTAAGCAGCAGCTGAGTGG + Intronic
1107925775 13:45260426-45260448 AAATAGAAGCATTAGTTGAGGGG + Intronic
1108084569 13:46772653-46772675 ACTTATAAGCAGGAGCTGAATGG - Intronic
1108780715 13:53828096-53828118 AAAAAAAAGTAGGAGTTGAGGGG - Intergenic
1111072779 13:83189789-83189811 ACATAAAAGCAGGAATTTTGAGG + Intergenic
1113268689 13:108648323-108648345 ACATGTAAGAAAGAGTTGAGAGG - Intronic
1114367028 14:22040088-22040110 AAATAAAAGATGGAGTTGAGGGG - Intergenic
1117329937 14:54702517-54702539 ACAGATGAGGAGGAGTAGAGGGG - Exonic
1117657502 14:57971697-57971719 TCATAGAAGCAGGAGTCGAATGG + Intronic
1119271857 14:73312779-73312801 AAATATCAGAAGCAGTTGAGGGG - Intronic
1124505804 15:30272248-30272270 AAATGGAATCAGGAGTTGAGAGG + Intergenic
1126386913 15:48102895-48102917 AAAGATAAGCAGAAGTTGATAGG - Intergenic
1127616837 15:60694580-60694602 AGATATAACCAGGACTGGAGGGG + Intronic
1128943298 15:71805890-71805912 TCACATAAGCTGGAGTTCAGTGG - Intronic
1131976781 15:97954706-97954728 ACATCTGAACAGGAGTTCAGTGG + Intergenic
1134756123 16:16668982-16669004 AAATATTGGCATGAGTTGAGGGG + Intergenic
1134989945 16:18690182-18690204 AAATATTGGCATGAGTTGAGGGG - Intergenic
1135241193 16:20807956-20807978 ACAAAGCAGCAGGAGGTGAGCGG + Intronic
1135881415 16:26261238-26261260 ACATACATGTTGGAGTTGAGTGG + Intergenic
1137759360 16:50927928-50927950 ATAAATAAGCTGGAGTTGTGTGG - Intergenic
1138549807 16:57741212-57741234 ACACACAAGCAGCAGCTGAGAGG + Intronic
1139898180 16:70305222-70305244 CCATCTAGGCAGGAGTTTAGAGG - Intronic
1140996537 16:80265340-80265362 ACATTTAAGCATGAGCAGAGAGG - Intergenic
1141144860 16:81521988-81522010 GCGTATAAGCAGGATTTCAGAGG + Intronic
1141352055 16:83307056-83307078 ACATATAAGCTACAGTTGGGTGG + Intronic
1141663916 16:85456075-85456097 ACAGATGAGGATGAGTTGAGAGG - Intergenic
1143522356 17:7451959-7451981 GCATGAAAGCAGGGGTTGAGGGG - Intronic
1143778626 17:9217157-9217179 ACAAATAAGCAGGAAGTGAGTGG - Intronic
1146839689 17:36142037-36142059 CCATATGAGAAGGACTTGAGTGG + Intergenic
1148984579 17:51610618-51610640 AGATATAAGCAGGAAGTGAGAGG + Intergenic
1149749788 17:59134872-59134894 TCATACAAGCAGGAGTGCAGTGG + Intronic
1152378845 17:79931810-79931832 CCACATCAGCAGGAGGTGAGTGG + Intergenic
1155172768 18:23279303-23279325 AGATATAAGCAGAAGTTGATGGG - Intronic
1156111565 18:33733316-33733338 AAACAGAAGAAGGAGTTGAGAGG - Intronic
1157002104 18:43539053-43539075 ACTCATAGGCAGGAGTTGAACGG - Intergenic
1158257900 18:55573637-55573659 ACAGATGAGGAGGAGTTAAGTGG - Intronic
1158450991 18:57564945-57564967 ACAGATAAACAGCATTTGAGTGG + Intronic
1161781024 19:6292052-6292074 AGATGACAGCAGGAGTTGAGAGG + Intergenic
1164054772 19:21613333-21613355 ACTTATAAGTAGGAGTTGAATGG - Intergenic
1165236378 19:34425113-34425135 ACAGAAAAGCAGGAGTCAAGAGG - Intronic
1166265169 19:41677242-41677264 GCTTAGAAGCAGGAGTTTAGTGG + Intronic
925643029 2:6005606-6005628 GCAAATCAGCAGAAGTTGAGAGG - Intergenic
925908147 2:8551857-8551879 GCATAGAAGCAGGTGTTCAGAGG - Intergenic
927482487 2:23465360-23465382 ACAGAGAGGCAGGAGGTGAGAGG - Intronic
928574052 2:32636895-32636917 TCATATGAGCAGGAATTTAGAGG + Intronic
930262203 2:49160932-49160954 ACATCTTAGCAGGAGATTAGTGG + Intergenic
930892197 2:56403487-56403509 ACATACATGCAGGAGTGGAGTGG - Intergenic
931844108 2:66185039-66185061 AAACAAAAGCAGGAGGTGAGGGG + Intergenic
934947512 2:98552419-98552441 ACTTATAAGCAGTACTTAAGTGG - Intronic
937890421 2:126934268-126934290 ACATATAAGTTGGAGTGGATGGG + Intergenic
938236978 2:129713097-129713119 ACAAAGGAGCAGGAGGTGAGAGG - Intergenic
939880761 2:147628831-147628853 AAATATCAGCAGGTGTTGAATGG - Intergenic
940172822 2:150847178-150847200 ACATATTCGCTGGAGTTCAGAGG + Intergenic
940828687 2:158443127-158443149 AGATATAAGTAGGAGTAAAGGGG + Intronic
940906472 2:159174315-159174337 AGAGATAAGTTGGAGTTGAGAGG - Intronic
941657930 2:168164444-168164466 TCATATAAGCTGGAGTGCAGTGG + Intronic
941799361 2:169639656-169639678 ACAGATGTGAAGGAGTTGAGAGG + Exonic
942333562 2:174854998-174855020 TCCTATAAGCAGGATTTGATGGG - Intronic
943110688 2:183601395-183601417 AAATATGATAAGGAGTTGAGCGG - Intergenic
944206792 2:197164973-197164995 ACAAATAAACAGTAGTTTAGAGG - Intronic
1169336757 20:4763075-4763097 TCATATAGGCTGGAGTGGAGTGG - Intergenic
1169854776 20:10090801-10090823 AAATTTTAGCAGGAGCTGAGAGG - Intergenic
1170352910 20:15461527-15461549 ACATACAAGCTGGAGTACAGTGG + Intronic
1172515488 20:35529877-35529899 ATAAATAAACAGGGGTTGAGAGG + Intergenic
1172686722 20:36761284-36761306 AAATATAATCATGACTTGAGGGG - Intronic
1176943382 21:14950857-14950879 AAACATAAGCAGGAGTATAGGGG + Intergenic
1178733907 21:35131560-35131582 TATTATAAGAAGGAGTTGAGGGG + Intronic
1178991161 21:37357983-37358005 ACATAGATGCTGGAGTTGAGGGG - Intergenic
1179954867 21:44732997-44733019 ACAGATGAGCAGCAGGTGAGGGG + Intergenic
1180569162 22:16699711-16699733 ACTTATGAGCAGGACTTCAGAGG + Intergenic
949098578 3:115802-115824 AAAAATAAAAAGGAGTTGAGTGG + Intergenic
949729012 3:7085651-7085673 AAAGTTAAGAAGGAGTTGAGTGG + Intronic
954461675 3:50630340-50630362 ACATGTTTGCAGGAGTTGGGAGG + Intronic
955260723 3:57387677-57387699 ACACATAAGCAGTTGTTGGGTGG + Intronic
955338799 3:58108923-58108945 ACTTAAATGCAGGAATTGAGTGG + Intronic
957490762 3:80923890-80923912 ACAGAGAAGCAGGATTTTAGAGG - Intergenic
958933347 3:100231116-100231138 AAATAATAGCAGGATTTGAGAGG + Intergenic
959462559 3:106644405-106644427 ACCAATCAGCAGGAGGTGAGTGG + Intergenic
959878625 3:111416775-111416797 ACATTGAAGGAGGACTTGAGAGG + Intronic
960290814 3:115882164-115882186 ACCTATAAGCAGGAGAGAAGTGG - Intronic
961165747 3:124762642-124762664 ACAGACAAGCAAGGGTTGAGTGG - Exonic
961760377 3:129162791-129162813 ACATATTAGCAGGATTCAAGAGG + Intergenic
962315013 3:134353945-134353967 ACAATTAACCAGGAGGTGAGAGG + Intergenic
962735504 3:138321957-138321979 ACATCCAAGCAGGAGAGGAGGGG + Intronic
962772290 3:138623798-138623820 AGATGAAAGCAGGAGTTGTGGGG - Intronic
963002322 3:140694023-140694045 TCATAGAAGGATGAGTTGAGTGG + Intronic
963532241 3:146485119-146485141 AAAAAAAAGCAGGGGTTGAGGGG + Intronic
964195088 3:154054562-154054584 AGATATAAACAGTAGTGGAGAGG + Intergenic
964687647 3:159414932-159414954 ACCTAACAGCAGGAGGTGAGTGG - Intronic
964732537 3:159882739-159882761 AAATATGCACAGGAGTTGAGAGG - Intronic
965401579 3:168218947-168218969 ACATCTGAGTGGGAGTTGAGGGG + Intergenic
965946538 3:174248923-174248945 GCAGAGAAGCAGGAGTGGAGAGG - Intronic
966390623 3:179449316-179449338 ACATTTAACTAGGAGTAGAGTGG + Intronic
968761705 4:2445538-2445560 TCCTATAAGTAGGTGTTGAGTGG + Intronic
970948299 4:21721560-21721582 ACTTATAAGCAAAAATTGAGTGG - Intronic
971887630 4:32473609-32473631 CCATATAAGCCCGAGTTAAGTGG - Intergenic
974276534 4:59727387-59727409 ACATATAAACTGGAGTTTATTGG - Intergenic
975032151 4:69634319-69634341 ACATATAAGAAGGAATTGGAAGG + Intronic
975823798 4:78299047-78299069 ATATATAAACAGGATTTTAGGGG + Intronic
975859327 4:78659522-78659544 CCATTTGAGCAAGAGTTGAGAGG + Intergenic
976385627 4:84454361-84454383 ACTTGGAAGCAGGAGTTGAAAGG + Intergenic
978340534 4:107717854-107717876 ACATTTAAGGAAGAGTTGAGAGG - Intronic
979000364 4:115209832-115209854 ACTTATAAGTAGGAGTTATGAGG + Intergenic
980528741 4:134022811-134022833 CCATATATGCAGGAGTTTTGGGG + Intergenic
980990643 4:139735699-139735721 GCATATAGGCTGGAGTCGAGAGG - Intronic
981798422 4:148627112-148627134 ACATAGAAGCAGGAGTAGAATGG + Intergenic
981936436 4:150244970-150244992 AAAAATAAGGGGGAGTTGAGTGG + Intronic
982342599 4:154318344-154318366 AAATATAAGCAAGCGATGAGAGG + Intronic
983433484 4:167681393-167681415 ACAGAGAAGCAGGAGCTGAGTGG - Intergenic
984849099 4:184137826-184137848 TCAGAAAAGCAGCAGTTGAGAGG - Intronic
985269552 4:188181086-188181108 ACATATAATCAGAATTTGAGAGG + Intergenic
985955826 5:3265487-3265509 ACCTGTAAGCAGGACCTGAGTGG - Intergenic
987835339 5:23153589-23153611 TCATATAGGCTGGAGTTCAGTGG + Intergenic
987856030 5:23422098-23422120 TCATAAAAGCAGGAGTTTTGTGG - Intergenic
991950171 5:71939479-71939501 CCAGATCAGCAGGAGCTGAGAGG + Intergenic
992095188 5:73356612-73356634 ACACAGAAGCAGGAGTGAAGTGG + Intergenic
994159418 5:96539460-96539482 ACATAGAAACATGAGTTGAAAGG - Intronic
995571144 5:113483970-113483992 ACATATAAGCGGGAGCTAAATGG + Intronic
997048649 5:130351366-130351388 AGATACAGGCAGGAGTTGATGGG - Intergenic
999547241 5:152643176-152643198 ACAGAAAAGCTGGAGTAGAGAGG - Intergenic
1000966661 5:167665788-167665810 ACATTTAAGAAAGAGTGGAGAGG - Intronic
1001871706 5:175161699-175161721 ACATAAGTGCTGGAGTTGAGAGG + Intergenic
1004296179 6:14413555-14413577 ACAGGTAAGCAGGGGTTCAGGGG - Intergenic
1004619192 6:17318613-17318635 ACATCTACGCAAGAGTTGAAGGG - Intergenic
1007277673 6:40687324-40687346 AGATATAATGAGGAGTTAAGAGG + Intergenic
1011787946 6:90867416-90867438 ACAAATGAACTGGAGTTGAGAGG - Intergenic
1012071342 6:94621423-94621445 ACATAGAAGCAGGGGTATAGAGG + Intergenic
1012937663 6:105384950-105384972 ACATAAAAAGAGGAGCTGAGTGG - Intronic
1013938555 6:115631423-115631445 AAATATTAGCTGGAGTTTAGGGG + Intergenic
1015156148 6:130098403-130098425 TCATAGAGGCAGGAGTGGAGTGG + Intronic
1020480156 7:8649419-8649441 ACATACACACAGGTGTTGAGAGG - Intronic
1021632967 7:22664910-22664932 ACAGAGGGGCAGGAGTTGAGGGG + Intergenic
1022351868 7:29573721-29573743 ATATATAAACAGAACTTGAGTGG + Intergenic
1027859207 7:83553876-83553898 AAAAATATGCAAGAGTTGAGAGG + Intronic
1028290800 7:89062729-89062751 AAATAAAAGCATGAGTTGACTGG - Intronic
1032125835 7:129192181-129192203 ACACATAAGCAGGAATTGCCTGG + Intronic
1035390110 7:158497915-158497937 ACACATGAGCAGGAGCTGGGAGG + Intronic
1037961475 8:23101697-23101719 AGATCTAGGCAGGAGGTGAGAGG - Intronic
1038501933 8:28052168-28052190 ACATATCAGCTGAAGTTAAGTGG - Intronic
1039179194 8:34845514-34845536 ATATATGAGGTGGAGTTGAGGGG - Intergenic
1040054106 8:43042415-43042437 GCATATATGTAGGAGTGGAGTGG - Intronic
1040642206 8:49349161-49349183 ACATATAGTTAGGATTTGAGTGG + Intergenic
1040673820 8:49725134-49725156 ACAGATCAGCACGAGGTGAGAGG + Intergenic
1042523136 8:69735595-69735617 ACTTATAAGTAGGAGCTGAATGG + Intronic
1043506073 8:80904450-80904472 AATTGTAAGGAGGAGTTGAGAGG - Intergenic
1046659443 8:116933299-116933321 AGATATAAGCAGGAATTGTTAGG - Intergenic
1047804054 8:128340303-128340325 AAATATAGGCAGGATTTAAGTGG - Intergenic
1051084807 9:13336195-13336217 AAATATCAGCAGGATTTGAGAGG - Intergenic
1051511524 9:17883972-17883994 ATATATCAGCAGAAGTTGAATGG + Intergenic
1052734939 9:32332331-32332353 AGATGTGAGAAGGAGTTGAGAGG + Intergenic
1056648748 9:88439035-88439057 AAATATCAGAAGCAGTTGAGGGG - Intronic
1059334246 9:113558791-113558813 ACCTCTAAGCATGAGATGAGTGG - Intronic
1060845030 9:126829629-126829651 AGATATAAACAGGAGTTTAATGG + Intronic
1060994086 9:127866435-127866457 AGAAATAAACAGGAGTTCAGCGG - Intergenic
1061889915 9:133613339-133613361 ACAGATCATCTGGAGTTGAGTGG - Intergenic
1187274709 X:17807160-17807182 ACAGATGAGCAGGAGTTGGCTGG - Intronic
1187903207 X:24043657-24043679 ACTTATAAGTGGGAGCTGAGTGG + Intergenic
1187904449 X:24053206-24053228 ACTTATAAGTGGGAGCTGAGTGG + Intergenic
1194773410 X:97932640-97932662 ACATATAAACTGGAGCTGAGAGG - Intergenic
1195266525 X:103186140-103186162 AGGAATGAGCAGGAGTTGAGGGG - Intergenic
1196117254 X:112011188-112011210 ACATATAAGGAGAAATTGGGGGG - Intronic
1198688236 X:139250656-139250678 ACAGATATGCAGGAGGTGATTGG + Intergenic
1198810867 X:140534930-140534952 ACAGAAAAGAAGGAGCTGAGAGG - Intergenic
1200415238 Y:2903092-2903114 GCATAAAAGCAGGGGTTCAGAGG - Intronic
1200912895 Y:8546688-8546710 AAATATCAGCAGGATTTGTGAGG + Intergenic
1201744323 Y:17353854-17353876 ACAAATCAGCAGGATGTGAGTGG - Intergenic