ID: 1086414016

View in Genome Browser
Species Human (GRCh38)
Location 11:86570756-86570778
Sequence CTGTGTACGTCATACATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086414016_1086414023 25 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414023 11:86570804-86570826 GGATTCAATTTTCCTTCCATGGG 0: 1
1: 0
2: 1
3: 21
4: 259
1086414016_1086414022 24 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414022 11:86570803-86570825 AGGATTCAATTTTCCTTCCATGG 0: 1
1: 0
2: 1
3: 26
4: 234
1086414016_1086414019 -4 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414019 11:86570775-86570797 ACAGAAGTTCTTGTTCTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 178
1086414016_1086414021 4 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414021 11:86570783-86570805 TCTTGTTCTGGTTGGGAGATAGG 0: 1
1: 0
2: 0
3: 19
4: 283
1086414016_1086414018 -8 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414018 11:86570771-86570793 GTACACAGAAGTTCTTGTTCTGG 0: 1
1: 0
2: 1
3: 12
4: 111
1086414016_1086414020 -3 Left 1086414016 11:86570756-86570778 CCTTCCATGTATGACGTACACAG 0: 1
1: 0
2: 0
3: 2
4: 57
Right 1086414020 11:86570776-86570798 CAGAAGTTCTTGTTCTGGTTGGG 0: 1
1: 0
2: 1
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086414016 Original CRISPR CTGTGTACGTCATACATGGA AGG (reversed) Intronic
903479438 1:23642428-23642450 CTGTGTACCTGACACATGGTGGG + Intergenic
907601783 1:55779119-55779141 CTATTTAGGTCCTACATGGATGG + Intergenic
907616133 1:55928758-55928780 CTGTGTGTGTCATAAATGGTAGG + Intergenic
912579447 1:110706777-110706799 CTGTGTTAGTCATTCCTGGATGG + Intergenic
917843628 1:179002634-179002656 CTGTGTAGGGCATCCATGCAGGG + Intergenic
922469253 1:225865842-225865864 CTGTGTTGGTCCTACGTGGAGGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1074293188 10:112156988-112157010 CTGTGTATTTCATAAAAGGATGG + Intronic
1075287231 10:121197421-121197443 CTCTGAAAGTCATACATGAAGGG + Intergenic
1080196223 11:29612636-29612658 CTGGGTCTGTCATATATGGAAGG - Intergenic
1085840479 11:80005954-80005976 CTGTGGGCGTCATACCTGGTAGG + Intergenic
1086414016 11:86570756-86570778 CTGTGTACGTCATACATGGAAGG - Intronic
1087378210 11:97370381-97370403 CTGTGTTTGTCATAAATGGCTGG - Intergenic
1107820284 13:44279782-44279804 CTCTGTAAGTCATAGATGGAGGG + Intergenic
1107978170 13:45709873-45709895 GTGTGTACTTCACACATAGAAGG + Intronic
1108123549 13:47215795-47215817 GTGTGTAGGTCTTAGATGGAGGG + Intergenic
1109886967 13:68555853-68555875 CTTTATACGTCATTCAAGGATGG + Intergenic
1119368229 14:74113924-74113946 CTGTGTACATGGTACATGAATGG - Intronic
1121641156 14:95485721-95485743 CTGTGTCAGTCATTCAGGGAAGG - Intergenic
1123893171 15:24801992-24802014 CTGTGTACCTCATTCATTGCAGG - Intergenic
1127334495 15:57970307-57970329 CTGTGTACCCCAAACATGCAAGG + Intronic
1129776984 15:78243429-78243451 CTGTGAATGTCACACCTGGAAGG + Intronic
1134241837 16:12512337-12512359 CTGTTTACGTCCATCATGGAAGG + Intronic
1145854612 17:28141995-28142017 CTGTGTCTGTCAAACATAGATGG - Intronic
1148045183 17:44739367-44739389 CTGTGTGCCTCAGACAGGGAAGG + Intronic
1150520977 17:65866276-65866298 CTGTGTCCGTGATACCTCGAGGG - Intronic
1163812034 19:19439127-19439149 CTGTGTGCCTCAGACATGGGAGG - Intronic
1165891529 19:39115471-39115493 CTGTGCACGTCACACAGGGCAGG - Intergenic
927815081 2:26208602-26208624 CTGTGCACGGCATAAATAGAAGG - Intronic
937706010 2:124921696-124921718 CTGACTACCTCATACATAGAAGG - Intergenic
1174296408 20:49548413-49548435 CTGTGCACATCATGGATGGATGG + Intronic
1183089502 22:35511656-35511678 CTGTGCAGATCATCCATGGAGGG - Intergenic
964387774 3:156167148-156167170 CTGTGTAAGTCATTCAGTGAGGG - Intronic
965470599 3:169085611-169085633 CTGAGTATGTCAAGCATGGAGGG - Intronic
969145203 4:5116813-5116835 CTGTGTAAGTCATTGATGAAAGG - Intronic
969474660 4:7414825-7414847 CTGGGAACTTCATACATGGTTGG + Intronic
977130018 4:93224506-93224528 CTGTTCATGTCATACATGGCTGG - Intronic
995129583 5:108615875-108615897 CTCTGTACCTCATACATAGAAGG + Intergenic
1001338557 5:170822636-170822658 ATGTGGACTTCATACAGGGAAGG + Intergenic
1004079167 6:12374054-12374076 CTGCCTCAGTCATACATGGATGG - Intergenic
1008158605 6:48048933-48048955 CTGTGTACTTTTGACATGGAAGG + Intronic
1010228260 6:73511945-73511967 ATGTGTATGTCATACATTGGAGG - Intergenic
1011218160 6:85027609-85027631 CTGTGCTCCTCATAAATGGAAGG - Intergenic
1013681717 6:112531400-112531422 GTGTGTGTGTCATACTTGGATGG - Intergenic
1014618420 6:123634044-123634066 GTGTGTGCGTGATAAATGGATGG + Intronic
1024274564 7:47667428-47667450 CTGTGTACCTCCAACAGGGAAGG - Intergenic
1026442448 7:70456210-70456232 CTATGTAAATCTTACATGGATGG - Intronic
1031175929 7:118350206-118350228 CAGTTAACGTCTTACATGGATGG + Intergenic
1033270809 7:139931381-139931403 CTGTGTATGTCATGCAGGAAGGG - Intronic
1035398626 7:158550934-158550956 CTGTGTGGGTCACTCATGGATGG - Intronic
1041499970 8:58529828-58529850 CTGTGTCTGCCATACAGGGAAGG + Intergenic
1047150212 8:122252294-122252316 CTATGTATGTAATACATAGATGG + Intergenic
1051031618 9:12687464-12687486 CTGTGGACATCATAAAGGGATGG - Intronic
1055498535 9:76880235-76880257 ATGTGTACTTAAAACATGGATGG - Intronic
1061120723 9:128640806-128640828 CTGGGTATGTCATACTGGGACGG + Exonic
1189316657 X:40061673-40061695 CTGTGTAGGTCACAGAGGGAGGG - Intronic
1195572650 X:106413872-106413894 TTGTCTTTGTCATACATGGAAGG + Intergenic
1196198640 X:112861005-112861027 CTGAGTACCTCTTACATGCAAGG - Intergenic
1196251823 X:113469728-113469750 CTGTGTCTGTAATACATGTATGG - Intergenic
1200749702 Y:6933627-6933649 CTGTGAACCTCATGCTTGGAGGG + Intronic