ID: 1086418434

View in Genome Browser
Species Human (GRCh38)
Location 11:86613172-86613194
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 942
Summary {0: 2, 1: 17, 2: 108, 3: 175, 4: 640}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086418434_1086418438 9 Left 1086418434 11:86613172-86613194 CCCCATTGCTTATTTTTTCAGGT 0: 2
1: 17
2: 108
3: 175
4: 640
Right 1086418438 11:86613204-86613226 ATCAGATGGTTGTAGATGTGTGG 0: 4372
1: 5112
2: 8328
3: 3977
4: 2156
1086418434_1086418437 -5 Left 1086418434 11:86613172-86613194 CCCCATTGCTTATTTTTTCAGGT 0: 2
1: 17
2: 108
3: 175
4: 640
Right 1086418437 11:86613190-86613212 CAGGTTTGTCGAAGATCAGATGG 0: 226
1: 6443
2: 4435
3: 2408
4: 1876

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086418434 Original CRISPR ACCTGAAAAAATAAGCAATG GGG (reversed) Intronic
900734429 1:4287380-4287402 GTCTACAAAAATAAGCAATGAGG - Intergenic
905242641 1:36590740-36590762 AAGTGAAACAATAAGCCATGAGG - Intergenic
905711966 1:40112878-40112900 ATCGACAAAAATAAGCAATGAGG + Intergenic
905712010 1:40113176-40113198 ATCTAACAAAAAAAGCAATGGGG + Intergenic
906176416 1:43777503-43777525 ACCTGACAAAACAAGCAATGGGG + Intronic
906181125 1:43820184-43820206 GCCTACAAAAATAAGCAATAGGG + Intronic
906499971 1:46334580-46334602 ACCTGAAAAAAAAAGCAGGGGGG - Intergenic
906571065 1:46841028-46841050 GCTTGACAAAATAAGCAATGGGG - Intergenic
906575015 1:46880939-46880961 ACCTGACAAAAAAATAAATGGGG + Intergenic
906600210 1:47120276-47120298 GCTTGACAAAATAAGCAATGGGG + Intergenic
906874428 1:49521526-49521548 ATCAACAAAAATAAGCAATGGGG + Intronic
906897335 1:49790056-49790078 ACCTGACAAAAAAAGCAATGGGG + Intronic
907001233 1:50859978-50860000 GCCTACAAAAATAAGCAATAGGG + Intronic
907852586 1:58270288-58270310 ACCGAGAAAAACAAGCAATGGGG - Intronic
907929439 1:58985675-58985697 ACTTGAAGTATTAAGCAATGTGG + Intergenic
908503830 1:64774441-64774463 ACCTGCCAAAACAAGCGATGGGG - Intronic
908629076 1:66082158-66082180 ACCTGATGAAGTATGCAATGAGG - Intronic
908735865 1:67276294-67276316 ACCTGACAAAAAAAGCAATGGGG + Intergenic
908933474 1:69344650-69344672 ACCTGACAAAAACAGCAATGGGG - Intergenic
908939675 1:69416570-69416592 ACCTGACAAAAACAGCAATAGGG - Intergenic
909424441 1:75506115-75506137 ATCAACAAAAATAAGCAATGGGG - Intronic
909678232 1:78261975-78261997 ACCTGAAAAAGCAAGCAATGGGG + Intergenic
911307631 1:96250372-96250394 CCCTGAAAAAAAAAACAATTAGG - Intergenic
911522583 1:98946366-98946388 ACTTGAATTAAAAAGCAATGTGG - Intronic
911540915 1:99157419-99157441 ACCTGACAAAAACAGCAATGGGG - Intergenic
911675337 1:100652466-100652488 ACCTGACAAAACAAGCAATGGGG + Intergenic
911822059 1:102435498-102435520 ACCAGAGAAACTAAGCAATTGGG - Intergenic
911932310 1:103920609-103920631 GCCAGCAAAAATAAGCAATGAGG - Intergenic
912019767 1:105093193-105093215 ACCTGATAAAACAAGCAGTAAGG + Intergenic
912034301 1:105291906-105291928 ACCTGACAAAACAAGAAATGAGG - Intergenic
912352373 1:109026345-109026367 ACCTGAAAAAAAAAAAAAGGTGG - Intronic
912656943 1:111494872-111494894 AACTGACAAAACAAGCAGTGGGG + Intronic
913362538 1:117998319-117998341 ACCAACAAAAACAAGCAATGAGG - Intronic
913399065 1:118407994-118408016 CCCTGACAAAAACAGCAATGGGG + Intergenic
914708928 1:150195261-150195283 ACCTTGATGAATAAGCAATGAGG + Intergenic
914842146 1:151257204-151257226 AGCTGACAAAACAAGCAGTGAGG - Intronic
915011508 1:152691084-152691106 ACCTGACCAAAAAAGCAATGGGG + Intergenic
915024851 1:152818015-152818037 TCCTGACAAAATAAGAAATGGGG - Intergenic
915643570 1:157250080-157250102 AAATTAATAAATAAGCAATGTGG - Intergenic
915691441 1:157695082-157695104 ACCAGAAAAAAAAATGAATGGGG + Intronic
915846657 1:159273422-159273444 ACCTGACAAAAAAAGCAATAAGG + Intergenic
916641606 1:166734812-166734834 ACCAACAAGAATAAGCAATGAGG + Intergenic
917272177 1:173289170-173289192 ACCTCTAAAAATATGCAATGTGG + Intergenic
917373632 1:174324223-174324245 ACCTCAAAATGTAAGAAATGAGG + Intronic
917389089 1:174513296-174513318 ACCTGAAAAAATAAACTTTGAGG + Intronic
917528604 1:175812191-175812213 ACCTGACAAAAAAAGCAATGGGG + Intergenic
917714080 1:177716273-177716295 ATCTGACAAAACAAGAAATGGGG + Intergenic
917994482 1:180421008-180421030 ACTTGAAAAAAAAATCATTGAGG - Intronic
918947875 1:191093236-191093258 AGGCGACAAAATAAGCAATGAGG + Intergenic
919154721 1:193749094-193749116 ACCTGACAAAAACAACAATGGGG - Intergenic
919235143 1:194831260-194831282 AGCTGACAAAGAAAGCAATGGGG + Intergenic
919354635 1:196505349-196505371 ACCTGAGAAAACAAGCAATGGGG - Intronic
920753776 1:208707746-208707768 CCTGAAAAAAATAAGCAATGGGG + Intergenic
921292918 1:213675508-213675530 ACCAACAAAAATAAGCAATGGGG - Intergenic
921336293 1:214090095-214090117 AACTGAAAAAACAAGCCATGGGG - Intergenic
921521582 1:216162168-216162190 ACATGAAAAAAAGAACAATGAGG - Intronic
921739145 1:218663999-218664021 ACATGAAAACAGAAGCCATGGGG + Intergenic
921768280 1:219000560-219000582 AATTGAAAAAATAAGGAATTGGG - Intergenic
922040761 1:221894007-221894029 ATCAGCAAAAATAAGCAATGAGG + Intergenic
924069990 1:240266824-240266846 ATCAATAAAAATAAGCAATGGGG + Intronic
924091704 1:240508004-240508026 TCCTGAAAAGCTAAACAATGAGG + Intronic
924307485 1:242705668-242705690 ACCTTACAAAAACAGCAATGAGG + Intergenic
924613716 1:245594433-245594455 ACCTGACAAAACAAGCAATGGGG - Intronic
924639597 1:245821272-245821294 ACCTGACAAAAGAAGCAATGGGG + Intronic
924876178 1:248106840-248106862 ACCAGACAAAACAAGCAATGGGG - Intergenic
924884106 1:248193826-248193848 ACCTGACAAAAAAAGCAATGGGG + Intergenic
924912306 1:248527256-248527278 ACCTGACAAAACAAGAAATAGGG - Intergenic
924919015 1:248606485-248606507 AGCTTAAAACATAAGCAATGGGG - Intergenic
1062953143 10:1520640-1520662 AGCAGACAAACTAAGCAATGTGG - Intronic
1063880274 10:10524135-10524157 ACCTAAAATAATAAGAAATGGGG + Intergenic
1064510466 10:16084275-16084297 ATCTGCTAAAACAAGCAATGGGG - Intergenic
1064760072 10:18609843-18609865 ACTTGTAAAAATAAGTAACGGGG + Exonic
1064765002 10:18661650-18661672 ACATGAAAAAAAATGCAGTGTGG + Intronic
1064837726 10:19553197-19553219 AACTAAAAAAATAAACAATTGGG + Intronic
1065691898 10:28342782-28342804 AGCTGACAAAATAAGCGATAGGG - Intergenic
1066153291 10:32648092-32648114 ACCAACAAAAACAAGCAATGAGG - Intronic
1066165087 10:32778444-32778466 CCCAGAAAAAATAAGCAATAGGG - Intronic
1066608835 10:37212829-37212851 AACTGAAAAAAAAAGCAATGGGG - Intronic
1067207035 10:44227223-44227245 ACTTGACAAAACAAGCAATGGGG - Intergenic
1067675858 10:48376114-48376136 ACCTACAAAAACAAGCAGTGGGG + Intronic
1067958718 10:50823262-50823284 ACATAATAAAATAAGCCATGTGG - Intronic
1068161274 10:53268184-53268206 ACCAATAAAAATAAGCAATTAGG + Intergenic
1069320406 10:67163886-67163908 ACCTGAAAAATGAAACAATTAGG + Intronic
1069443611 10:68452543-68452565 CCCTGGAAAAAGAAGCAATGTGG + Intronic
1071050680 10:81444624-81444646 ACCAGAAAAAATTAGGCATGCGG - Intergenic
1072373413 10:94789609-94789631 ACCTGACAAAAAAAGAAATAGGG - Intronic
1072408197 10:95174516-95174538 ACCTGACAAAACAAGCAATGGGG - Intergenic
1073616189 10:104998662-104998684 ATCTGAAAAACTAAGCATTAAGG - Intronic
1073927127 10:108530184-108530206 ACCTGACAAAACAAGCAATGGGG + Intergenic
1074612160 10:115032334-115032356 AGTTGACAAAATAAGCAATGAGG - Intergenic
1075058413 10:119237410-119237432 ATTTGAAAAAATAAGCACTATGG + Intronic
1075655567 10:124158825-124158847 ACCTCCCAGAATAAGCAATGGGG - Intergenic
1078120095 11:8498808-8498830 ACCTGACACAAACAGCAATGGGG + Intronic
1078278074 11:9870580-9870602 ACCTGACAGAACAAGCAATGGGG + Intronic
1078497373 11:11832402-11832424 AACTGAAAAAATTAGCCATTTGG + Intergenic
1078574311 11:12485631-12485653 AACTGAACAAATAAGCAAATGGG + Intronic
1078813628 11:14797128-14797150 ACCTGACACAACAAGCAATGGGG - Intronic
1080182816 11:29444822-29444844 ATCAACAAAAATAAGCAATGGGG - Intergenic
1080379266 11:31750681-31750703 CCCTGAAACAGTAAGAAATGTGG + Intronic
1080405233 11:31972777-31972799 ACCTGACAAAGTAATCTATGTGG - Intronic
1080866093 11:36196497-36196519 TCCTGAAACAATAAGCTATAAGG + Intronic
1081035027 11:38133474-38133496 ACCTGACAAAATAAGGAATGGGG + Intergenic
1081225567 11:40517986-40518008 ACCTGACAAAATAAGCAATGGGG + Intronic
1081336746 11:41875897-41875919 ACCTGAAAAAGTAAGTCATCAGG - Intergenic
1081402045 11:42654699-42654721 ACCTGACAAAACAAGCAATGGGG - Intergenic
1082638290 11:55623580-55623602 TTCTACAAAAATAAGCAATGGGG - Intergenic
1082680927 11:56169041-56169063 ACCAACAAAAACAAGCAATGAGG + Intergenic
1082745131 11:56952910-56952932 GCCAACAAAAATAAGCAATGTGG + Intergenic
1082753318 11:57046028-57046050 ACCTGATAAAAAAAGCAATGGGG + Intergenic
1082871698 11:57948817-57948839 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1084437275 11:69151057-69151079 AACTGACAAAAAAAGCAATGGGG + Intergenic
1086004572 11:82022834-82022856 ACTTGAATAAATAAGGCATGAGG - Intergenic
1086041272 11:82482334-82482356 ACCAGACAAAACAAGCAATGGGG - Intergenic
1086418434 11:86613172-86613194 ACCTGAAAAAATAAGCAATGGGG - Intronic
1086678025 11:89633991-89634013 ACATCAAAAAATAAGCATTTTGG + Intergenic
1086756015 11:90562979-90563001 GCATATAAAAATAAGCAATGGGG + Intergenic
1086756666 11:90572521-90572543 CCCTACAAAAATAAGCAACGAGG - Intergenic
1087404146 11:97708856-97708878 ACCTGAAGAAAGAAATAATGAGG + Intergenic
1087573686 11:99963423-99963445 ACCTGACAAAAAAAGAAATGGGG - Intronic
1087668251 11:101075196-101075218 ATCTGACCAAAAAAGCAATGGGG + Intronic
1087741907 11:101897620-101897642 ACCTGACAAAAAAAGCAATGGGG - Intronic
1088052118 11:105529709-105529731 AGCTGGCAAAACAAGCAATGAGG + Intergenic
1088061470 11:105656247-105656269 ACCTGACAAAATGAGCAATGGGG + Intronic
1088176344 11:107056747-107056769 AACTGACAAAACAAGCAATGGGG + Intergenic
1088690936 11:112326881-112326903 ACCTGACAAAATAAGCAACAGGG - Intergenic
1088781482 11:113138323-113138345 ACCAGAAAGAATAGGAAATGCGG - Intronic
1090160384 11:124487133-124487155 AAATGAACAAATAAGGAATGAGG + Intergenic
1090741298 11:129663320-129663342 ACCTGAAAAAACAAGCGATGGGG + Intergenic
1091474504 12:758693-758715 ATCCTAAAAAATAAGGAATGTGG - Intronic
1091983365 12:4884768-4884790 GCCAGCAAAAATATGCAATGGGG + Intergenic
1092774038 12:11926438-11926460 TCAACAAAAAATAAGCAATGGGG + Intergenic
1092997179 12:13961398-13961420 ACCTGGACAAAGAGGCAATGTGG + Intronic
1093498297 12:19781933-19781955 ACCAACAAAAACAAGCAATGAGG + Intergenic
1093498764 12:19785836-19785858 ACTAACAAAAATAAGCAATGGGG - Intergenic
1093544609 12:20331904-20331926 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1093636548 12:21477968-21477990 ATCTGAAAAAACAAACAAAGTGG + Exonic
1094764654 12:33578641-33578663 TCTGGCAAAAATAAGCAATGGGG + Intergenic
1095120154 12:38407385-38407407 TCTGAAAAAAATAAGCAATGGGG - Intergenic
1095620665 12:44249718-44249740 CCATGTAAAAACAAGCAATGGGG + Intronic
1095817437 12:46440135-46440157 TCCTGAAAGAAAAAGCCATGTGG + Intergenic
1095914648 12:47465048-47465070 ACCTGACAAAACAAGCAATGGGG - Intergenic
1095916058 12:47480205-47480227 GTTGGAAAAAATAAGCAATGGGG + Intergenic
1096005575 12:48168220-48168242 TCCTGAAAAGAAGAGCAATGAGG + Intronic
1096036042 12:48471607-48471629 ACCAAGAAAAACAAGCAATGGGG - Intergenic
1096736614 12:53660463-53660485 AACTCAGAAAATAAGCAGTGGGG + Intronic
1097070976 12:56354719-56354741 ACCTGGAAAAATGAGGGATGTGG - Intronic
1097317671 12:58189467-58189489 AAATAAATAAATAAGCAATGAGG - Intergenic
1097317713 12:58189778-58189800 TTCTTTAAAAATAAGCAATGAGG - Intergenic
1097781554 12:63712313-63712335 ACCTGAAAGAATATATAATGGGG + Intergenic
1098371426 12:69764407-69764429 ATCAACAAAAATAAGCAATGAGG - Intronic
1098892233 12:76021189-76021211 ACTTGAAAAAATAGTCAATGCGG - Intergenic
1099199011 12:79653777-79653799 TTCTTAAAAAATAAGCACTGAGG - Intronic
1099233500 12:80054610-80054632 ACCTGAATAAATAAGAAACATGG - Intergenic
1099558017 12:84134854-84134876 TCATCAAAAACTAAGCAATGGGG + Intergenic
1100138062 12:91579397-91579419 TTCTGAGAAAATAAGCACTGAGG - Intergenic
1100750427 12:97692575-97692597 ACCTGACAAAACAAGAAATGGGG - Intergenic
1100894180 12:99160803-99160825 ATCAACAAAAATAAGCAATGAGG - Intronic
1101069398 12:101058127-101058149 ACCTGACAAAAACAGCAATGGGG - Intronic
1101263576 12:103060700-103060722 ACCAACAAAAACAAGCAATGGGG + Intergenic
1102832354 12:116015273-116015295 ACCTGAAAAAAAAGGCAATTTGG + Exonic
1103254155 12:119526139-119526161 AGGTGACAAAACAAGCAATGGGG + Intronic
1104173604 12:126306581-126306603 GTCAAAAAAAATAAGCAATGAGG - Intergenic
1104305399 12:127606130-127606152 GCCAACAAAAATAAGCAATGGGG - Intergenic
1105047101 12:133014077-133014099 ACTGGTAAAAATAAGCCATGGGG - Exonic
1105276375 13:18931480-18931502 ACCTCCAAAAATAAAGAATGAGG - Intergenic
1106710998 13:32332713-32332735 ACATGAAGAAATATGCAATAGGG - Exonic
1107158747 13:37200177-37200199 ACCAACAAAAATAAGCAATGGGG - Intergenic
1107203889 13:37757086-37757108 ACATTAAAAAATATGCAATGTGG + Intronic
1107232665 13:38129398-38129420 AGTTGACAAAACAAGCAATGAGG - Intergenic
1107397924 13:40037463-40037485 ATTTGACAAAACAAGCAATGAGG - Intergenic
1107615698 13:42164770-42164792 AGCTGAGAAAATAAGCATGGGGG + Intronic
1107764293 13:43717268-43717290 ATCAAAAAAAATATGCAATGGGG + Intronic
1108426298 13:50305098-50305120 TAGTCAAAAAATAAGCAATGGGG - Intronic
1108609875 13:52074358-52074380 ATCGACAAAAATAAGCAATGGGG + Intronic
1108697322 13:52913894-52913916 AGCAGAAAAAAACAGCAATGTGG - Intergenic
1108985113 13:56576939-56576961 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1109176258 13:59160638-59160660 ATCCAAAAAAATAAGCAATTTGG + Intergenic
1109388093 13:61658672-61658694 ACCTCGCAAAACAAGCAATGGGG - Intergenic
1109480656 13:62947498-62947520 ACAGGAAATAATATGCAATGTGG - Intergenic
1109526469 13:63581811-63581833 AAGTCAACAAATAAGCAATGGGG - Intergenic
1109941348 13:69370185-69370207 ACCTTCAAAAATGAGCAATATGG + Intergenic
1110071711 13:71186002-71186024 ACCTGACAAAACAAGAAATGGGG + Intergenic
1110128932 13:71982219-71982241 ACCAACAAAAACAAGCAATGGGG - Intergenic
1110220149 13:73063421-73063443 AAATGAAAAAAGAAGAAATGTGG + Intronic
1110977681 13:81861438-81861460 ACCGATAAAAACAAGCAATGAGG + Intergenic
1111355526 13:87096113-87096135 ACCTGTAAAAATAATAAATCAGG + Intergenic
1111434855 13:88193169-88193191 ACCTGACAAAACAAGAAATGGGG - Intergenic
1111439868 13:88267234-88267256 ACCTGAAACAATAAACATTCTGG - Intergenic
1111622823 13:90746453-90746475 CCCTGTAAAAAGAAGGAATGTGG - Intergenic
1111786624 13:92795260-92795282 ACCTACAAAAACAAGAAATGGGG + Intronic
1111960689 13:94806811-94806833 GCATGAAAAAATAAGCTATGTGG - Intergenic
1111967517 13:94875953-94875975 ACCTGACAGAACAAGAAATGGGG + Intergenic
1112653981 13:101428854-101428876 AAATGAAAAAATAAGAAATATGG - Intergenic
1113488551 13:110674441-110674463 ACCTGACAAAAAAAGAAATGGGG + Intronic
1114054019 14:18950637-18950659 ACATCAAAAAATAATAAATGTGG - Intergenic
1114058819 14:19000578-19000600 ACCTTAAAAAAAATTCAATGAGG + Intergenic
1114103725 14:19401176-19401198 ACCTTAAAAAAAATTCAATGAGG - Intergenic
1114108538 14:19451295-19451317 ACATCAAAAAATAATAAATGTGG + Intergenic
1114191363 14:20441711-20441733 ACCTGAAAGGAGAAGCAATGAGG - Intergenic
1114224170 14:20723363-20723385 AACTGAAAAAGTAGGAAATGGGG + Intergenic
1114345277 14:21788143-21788165 ATCGACAAAAATAAGCAATGGGG + Intergenic
1114358185 14:21938367-21938389 GCCAACAAAAATAAGCAATGGGG - Intergenic
1115080336 14:29443178-29443200 AACTAAAAAAATAAGAATTGAGG + Intergenic
1115469585 14:33754820-33754842 ACCTGAAAGAATAAACCATCTGG + Intronic
1115947251 14:38676024-38676046 ACCTGACAAAACAAGAAATGGGG + Intergenic
1116026258 14:39519104-39519126 ACCAACAAAAATAAGCAATGGGG + Intergenic
1116123623 14:40753572-40753594 CCCAACAAAAATAAGCAATGGGG - Intergenic
1116354050 14:43905107-43905129 ACCTGACAAAACAAGCACTGGGG - Intergenic
1116395264 14:44440872-44440894 AGTTGACAAAATAAGCAAAGAGG + Intergenic
1116671727 14:47850835-47850857 ACCAGACAAAACAAGCAATGGGG + Intergenic
1117030334 14:51662524-51662546 ACCTGACAAAACAAGCAATGGGG + Intronic
1117386466 14:55218805-55218827 AACAGAAAAAAAAAGCAATGAGG - Intergenic
1117626797 14:57648604-57648626 AATTGAAAAAATAAGAAAAGGGG - Intronic
1117640249 14:57790860-57790882 ACCTGACAAAAAATGCAATGGGG + Intronic
1117655888 14:57956166-57956188 ACCTAACAAAACAAGAAATGGGG + Intronic
1117893069 14:60447919-60447941 ACCTGACAAAAACAGCAACGGGG + Intronic
1117947679 14:61046681-61046703 ACCTGTAAAAATAATTAAGGAGG - Intronic
1118082396 14:62375860-62375882 CCCTGACAATATAAGTAATGTGG - Intergenic
1118258341 14:64224575-64224597 ACTTTAAAAAATAACCAGTGAGG - Intronic
1119998204 14:79276303-79276325 ACATGAAAAAATTAACAGTGGGG + Intronic
1120563397 14:86024734-86024756 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1121513039 14:94527285-94527307 AGCTGAAAAAACAAGCAACAGGG + Intergenic
1122093989 14:99357881-99357903 AGCTGGAAAAATTAGCAATTAGG + Intergenic
1122833111 14:104413293-104413315 ACCTGACAAAAAAAGAAATGGGG - Intergenic
1123157629 14:106244170-106244192 ACCTGACAAAACAAGAAATGGGG - Intergenic
1123179406 14:106454272-106454294 GGCTGACAAAACAAGCAATGGGG - Intergenic
1123221149 14:106857128-106857150 ACCTGACAAAAACAGCAATGGGG - Intergenic
1202891655 14_KI270722v1_random:164883-164905 ACCTGAAATTACAAGAAATGAGG + Intergenic
1123550479 15:21374098-21374120 ACCTGAAAAATAAATTAATGAGG + Intergenic
1124223217 15:27867861-27867883 TCCTTAAAAAATAAGCAAAAAGG - Intronic
1124955760 15:34359301-34359323 ACCTGGACAAATAAGAGATGGGG + Exonic
1124998866 15:34751413-34751435 AACTGAAAAAATAATAAATCAGG + Exonic
1125238370 15:37543574-37543596 GCCAGCAAAAACAAGCAATGAGG + Intergenic
1125996751 15:44168977-44168999 ACCTGAAGTAATAAGCGATGGGG - Intronic
1126233851 15:46358849-46358871 AAATGGAAAAACAAGCAATGGGG + Intergenic
1126278039 15:46907786-46907808 ACCTGGAAAAACAAGCAATGAGG - Intergenic
1127185641 15:56477084-56477106 ACCTGAAAAAAAAAGAAATGGGG - Intergenic
1127190287 15:56523175-56523197 CTCAGCAAAAATAAGCAATGGGG + Intergenic
1127745987 15:61973506-61973528 ACCTGAAATAATAGGAATTGAGG + Exonic
1127778873 15:62293932-62293954 AGCTGAGAAAACAAGCAATGGGG + Intergenic
1128214620 15:65925675-65925697 TCCTGAAAAATAAAGCAAGGGGG - Intronic
1129758126 15:78110985-78111007 CTCTGAATAAATAAGCTATGTGG - Intronic
1129921303 15:79321310-79321332 ACCTGCAAAAATATTCAGTGTGG - Intronic
1134156835 16:11851100-11851122 ACCTGCAAAACTAAGCGATTCGG + Intronic
1134188552 16:12103418-12103440 ACCTGACAAAATAAGCAATGGGG + Intronic
1134424169 16:14123545-14123567 ACCTATACAAACAAGCAATGGGG - Intronic
1135376179 16:21949383-21949405 ACCTGTGAAAATAAGCTATCAGG + Intergenic
1135432105 16:22393817-22393839 ATCAACAAAAATAAGCAATGGGG - Intronic
1135579100 16:23609976-23609998 CCATGGAAAAATAAGCACTGGGG - Intronic
1136600118 16:31280002-31280024 ACCTGAAAAAACAAGAAATGGGG - Intronic
1137558379 16:49487816-49487838 ACCTGAAGAAATAAGGGAGGTGG - Exonic
1138924758 16:61577308-61577330 ACCTAATATTATAAGCAATGAGG - Intergenic
1138953717 16:61945508-61945530 ACCTGAACTCATAGGCAATGTGG + Intronic
1139090141 16:63635530-63635552 AAATTAAAAAATAAGAAATGCGG - Intergenic
1139125178 16:64069207-64069229 ATCAGAAAAAATAACTAATGTGG - Intergenic
1139479295 16:67220141-67220163 ATCTGGAAAAATAAGCCAGGTGG - Intronic
1139945309 16:70637167-70637189 AACTGAAAAAATTAAAAATGGGG - Intronic
1140258971 16:73360896-73360918 CCATGCAAAAAAAAGCAATGGGG + Intergenic
1140527856 16:75638573-75638595 ACTAGAAAAACTAAGAAATGAGG + Intronic
1141252372 16:82370104-82370126 ACTTGAAAAAATGGGCTATGGGG - Intergenic
1141975986 16:87516970-87516992 AAGTGAAAAAATATGCAATATGG - Intergenic
1142526396 17:544774-544796 ATCTAAGAAAATAAGCAATATGG + Intronic
1143415377 17:6744460-6744482 ACTGACAAAAATAAGCAATGGGG + Intergenic
1144383084 17:14722317-14722339 AGCTGACAAAACAAGTAATGGGG + Intergenic
1145357906 17:22180249-22180271 ACAGGAAATAATACGCAATGTGG + Intergenic
1145742327 17:27285721-27285743 ATCTGAAAGAGTAAGCAGTGGGG - Intergenic
1146597089 17:34178918-34178940 AACTGAAAAAAGAAACATTGAGG - Intergenic
1146622477 17:34409783-34409805 AGCTGACAAAAACAGCAATGGGG + Intergenic
1146743698 17:35309066-35309088 ACCTGATAAAACAAGCAATGGGG + Intergenic
1146765537 17:35517774-35517796 AACTGACAAAACAAACAATGGGG + Intronic
1147905752 17:43821788-43821810 ACAGGAAAAAAAAAGCAATCAGG + Intronic
1148320626 17:46748801-46748823 ACCTGGTAAACTAAGCAAAGGGG + Intronic
1149235447 17:54584970-54584992 AGCTGAGAAAACAAGCAATAGGG + Intergenic
1150885056 17:69075508-69075530 AACAGACAAAATAAGCAATCGGG - Intergenic
1151071843 17:71223062-71223084 ACCTGACAAAATAATCACTATGG + Intergenic
1152482550 17:80564710-80564732 ATCTGAAAAAAAAAGCTATTGGG - Intronic
1153207983 18:2724143-2724165 ATTTGAAAAAAGATGCAATGTGG - Intronic
1153542271 18:6168553-6168575 ACCTGAGAAAAAAAGCAATGGGG + Intronic
1153701921 18:7702943-7702965 ACCTGACAAAAACAGCAATGGGG - Intronic
1153703329 18:7718440-7718462 ACCTGAAACCATAAGCATTCTGG + Intronic
1154288144 18:13079901-13079923 ACCTGACAAAAAAAGAAATGGGG - Intronic
1154288740 18:13085659-13085681 ACTTGACAAAACAAGAAATGGGG - Intronic
1154451499 18:14479480-14479502 ACCTGAAAAATAAAGTAATAAGG + Intergenic
1155735729 18:29220161-29220183 ACCTGACAAAAAAAGAAATGGGG + Intergenic
1155856887 18:30845530-30845552 ACCTGACAAATCAAGCAAGGGGG - Intergenic
1155861636 18:30908981-30909003 AGTTGACAAAAAAAGCAATGGGG + Intergenic
1156402315 18:36750749-36750771 AGCTGACAAAACAAGCAATGGGG - Intronic
1156551015 18:38016805-38016827 ACCTGACAAAACAAGCAATGGGG - Intergenic
1156561689 18:38132824-38132846 ACTTGAAAATATAACCAAGGGGG - Intergenic
1157003526 18:43554881-43554903 ATCTACAAAAACAAGCAATGAGG - Intergenic
1157025039 18:43832437-43832459 ACCAGAAACAATAAACACTGAGG - Intergenic
1157199130 18:45643965-45643987 ACCTGGAAACAAAAGCATTGGGG - Exonic
1157396890 18:47349492-47349514 ACCTGGAAAAACAAGCAATGGGG - Intergenic
1158078347 18:53559017-53559039 AGTTGATAAAATAAGCAATGAGG + Intergenic
1158095776 18:53768953-53768975 ACCTGACAAAACAAGCAATGGGG + Intergenic
1158098430 18:53802143-53802165 ACCTGACAAAAACAGCAATCAGG - Intergenic
1159374162 18:67570437-67570459 ACATTAAAAAATAAACAATATGG + Intergenic
1159619959 18:70625684-70625706 ACCTGCAAGCATAATCAATGAGG - Intergenic
1160079909 18:75715898-75715920 ATCTGAAAAAAGAAGAAATATGG - Intergenic
1160320126 18:77883196-77883218 CCGACAAAAAATAAGCAATGAGG - Intergenic
1162672941 19:12273507-12273529 ACATGAAAAAATACACACTGGGG - Exonic
1163789803 19:19300076-19300098 ATCTCAAAAAATAAAAAATGAGG - Intronic
1164036350 19:21459225-21459247 ACCAGAAAAAATAATCTATTAGG + Intronic
1164266029 19:23618377-23618399 ACCTGACAAAAAAAGAAATGGGG + Intronic
1164406323 19:27950079-27950101 ATGTAAAAAAAAAAGCAATGAGG + Intergenic
1164866531 19:31608901-31608923 GCCTGAGAAAGAAAGCAATGTGG + Intergenic
1165930694 19:39356668-39356690 TCCTGAAAAAGGAAGCAAAGGGG - Exonic
1166433352 19:42745212-42745234 ACTTGAGAAAACAAGCAATGGGG - Intronic
1166632801 19:44422137-44422159 ACCTGACAAAAAAAGCAATGGGG - Intronic
1167461647 19:49627809-49627831 ATCTCAAAAAATAAAAAATGTGG + Intergenic
1167477813 19:49711094-49711116 ATCTCAAAAAAAAAGAAATGGGG - Intronic
1168230982 19:55031438-55031460 ACTTAAAAAAATTAGCGATGGGG - Intronic
1168602752 19:57732147-57732169 ACCTGAAAAAACAAACAATGGGG + Intronic
925053793 2:839450-839472 ACCTGACAAAAACAGCAATGGGG + Intergenic
925133044 2:1507149-1507171 ACCTGACAAAAACAACAATGGGG - Intronic
925419462 2:3700263-3700285 TCTTAAAAAAACAAGCAATGGGG - Intronic
925647356 2:6050024-6050046 AGCTGACAAAAAAAGCAATGGGG + Intergenic
925889388 2:8421450-8421472 ACCTGAAAAGGAAAGCAAGGTGG - Intergenic
926381894 2:12299286-12299308 TGCTTAAAAAATCAGCAATGTGG - Intergenic
926494604 2:13569586-13569608 AAATGAAAAAACAAGTAATGTGG - Intergenic
926902741 2:17773279-17773301 ACCTGAAACAATAACAAATCAGG - Exonic
927015501 2:18955949-18955971 ATCTGACCAAAAAAGCAATGGGG + Intergenic
928258609 2:29746889-29746911 ACATGACGAAATAAGCCATGAGG + Intronic
928486898 2:31741427-31741449 ACCTGACAAAACAAGAAATGGGG - Intergenic
928488003 2:31752185-31752207 ACCTGACAAAACAAGAAATGGGG + Intergenic
928812099 2:35240297-35240319 CCTGAAAAAAATAAGCAATGGGG + Intergenic
929062467 2:37937169-37937191 ACCTGACAAAAACAGCAATAGGG - Intronic
929358570 2:41055578-41055600 ACCTGACAAAAAAAGAAATAGGG - Intergenic
930127900 2:47817412-47817434 CCCTGAGAAACTAAGCAATAAGG + Intronic
930270173 2:49247045-49247067 ACCTGACAAAATAAAAAATGGGG + Intergenic
930278977 2:49347242-49347264 ATCAACAAAAATAAGCAATGGGG + Intergenic
930303454 2:49647181-49647203 GCCAACAAAAATAAGCAATGGGG - Intergenic
930433684 2:51313970-51313992 ACCTCAGAAAACAAGCAATGGGG - Intergenic
930598693 2:53418906-53418928 ATCTGACAAAACAAGCAATGGGG - Intergenic
930933354 2:56916837-56916859 ACCTGACAAAACAAGCAATGGGG + Intergenic
931083179 2:58798855-58798877 CCCAGAAAAAGGAAGCAATGAGG - Intergenic
931215303 2:60236594-60236616 ACCTGCAAAAACAAGATATGGGG - Intergenic
931420991 2:62127602-62127624 ACCTGACAAAAAAAGCAATGGGG + Intronic
931532889 2:63236705-63236727 GCCAACAAAAATAAGCAATGGGG + Intronic
931846661 2:66211099-66211121 ACCTGAGAAAACAAGCAATGGGG + Intergenic
932098872 2:68878219-68878241 ACCTGAAAGGAAAAGAAATGTGG + Intergenic
932523595 2:72440165-72440187 ACCTGCTAAAATAAGCAGTCTGG + Intronic
933214553 2:79614463-79614485 ACCTGGAAAAATACTCAATTTGG + Intronic
933497993 2:83075629-83075651 ATCTGCACCAATAAGCAATGTGG - Intergenic
933512135 2:83254279-83254301 AAATGAAAGAATTAGCAATGTGG - Intergenic
933822613 2:86127902-86127924 GACAGAAAAAATAAACAATGAGG - Intronic
933944253 2:87271252-87271274 ACCTGACAAAACAAGAAATGGGG - Intergenic
935020706 2:99228283-99228305 ACCTGACAAAACAAGAAATGGGG + Intronic
935485874 2:103652960-103652982 AGCAGAAAAAATATGAAATGTGG + Intergenic
935835069 2:107041880-107041902 GCTTGCAAAAATAAGCAATGAGG + Intergenic
936335963 2:111590327-111590349 ACCTGACAAAACAAGAAATGGGG + Intergenic
936605965 2:113954577-113954599 ATCTGAAAAAAAAAAAAATGTGG - Intronic
936669113 2:114635121-114635143 AACAGAAAAAAAAAACAATGAGG - Intronic
936947521 2:117943911-117943933 ACTAGAGAAAATAAGTAATGAGG - Intronic
937498957 2:122456793-122456815 ATCTACAAAAATAAGCAATAGGG + Intergenic
937525677 2:122766473-122766495 ATGGGCAAAAATAAGCAATGAGG + Intergenic
937599314 2:123710902-123710924 ATATGAAAAAATAGCCAATGAGG - Intergenic
937780428 2:125830395-125830417 CCCAAGAAAAATAAGCAATGGGG + Intergenic
938152459 2:128899318-128899340 ACCTACAAAAATAGGCCATGGGG - Intergenic
938259461 2:129884727-129884749 GCCTGGAAAAATGAGCACTGAGG - Intergenic
938472019 2:131573390-131573412 ACATCAAAAAATAATAAATGTGG - Intergenic
938478706 2:131639686-131639708 ACCTGAAAAAATAAAAGCTGGGG + Intergenic
938691620 2:133795773-133795795 AGCTGAAAAAAAAAACAAAGAGG - Intergenic
939208065 2:139133420-139133442 GCCAACAAAAATAAGCAATGGGG - Intergenic
939288169 2:140159413-140159435 CCTGGCAAAAATAAGCAATGGGG - Intergenic
939393398 2:141598281-141598303 ACTTGAAATAAAAAGCAATAAGG + Intronic
939753560 2:146079902-146079924 AACTCAAAGAATAAGCCATGAGG + Intergenic
939941384 2:148355544-148355566 ACTGGCAAAAACAAGCAATGGGG - Intronic
940683522 2:156817940-156817962 ACCTGTAAAACTAAACAATTAGG + Intergenic
941119981 2:161517345-161517367 AACTGAATAAATAAATAATGTGG - Intronic
941146165 2:161848645-161848667 GCCAATAAAAATAAGCAATGAGG - Intronic
941278704 2:163523166-163523188 ACTGGAAAAAAGAAGCAATGGGG - Intergenic
941622913 2:167798549-167798571 GCCAGCAAAAACAAGCAATGGGG - Intergenic
941762756 2:169262971-169262993 ACCTGAGAAAAAAAGCAATGGGG + Intronic
941847384 2:170147106-170147128 TCTTGAAAAACCAAGCAATGTGG + Intergenic
942122124 2:172788294-172788316 ACATGAAATAATAAATAATGGGG + Intronic
942362921 2:175191605-175191627 ACCTGACAAAATAAGAAATGGGG + Intergenic
943136067 2:183914409-183914431 ACCTGAGAAAAACAGCAATGGGG - Intergenic
943232406 2:185271614-185271636 ACCTGACAAAACAAGCAATGGGG - Intergenic
943555827 2:189402658-189402680 ACCTGACAAAAGCAACAATGGGG - Intergenic
943765112 2:191652504-191652526 ACCTGAAAAGAATAGGAATGGGG - Intergenic
943789827 2:191919838-191919860 ACTTCAAAAAATAAGCAAGCAGG - Intergenic
944098233 2:195993971-195993993 AAATGAAAAAATATGCAATCAGG - Intronic
944194649 2:197039879-197039901 ACTTGTAAAAATAGGCAAAGAGG + Intronic
944537053 2:200721224-200721246 ACTGGAAAAAAAAAGAAATGAGG + Intergenic
945254920 2:207795470-207795492 AAATGGAAAAATAGGCAATGGGG - Intergenic
945346796 2:208727709-208727731 GTCTACAAAAATAAGCAATGGGG - Intronic
945347430 2:208734583-208734605 ATCTACAAAAATAAGCAAAGGGG - Intronic
945427905 2:209730050-209730072 ACCTGGACAAATAAGAAGTGGGG + Intronic
945461300 2:210112221-210112243 ACCTAACAAAAACAGCAATGGGG + Intronic
945744075 2:213699214-213699236 AACAGAAAAAATAAAGAATGTGG - Intronic
945752020 2:213799014-213799036 ACCTTAAAAAATAACAAATTTGG - Intronic
945830898 2:214783745-214783767 ACCTAACAAAACAAGCAATGGGG + Intronic
945941445 2:215955001-215955023 ACCTTAACAAATAATGAATGTGG - Intronic
946019178 2:216628557-216628579 AGTTGAGAAAATAAGCAATGGGG - Intergenic
946091818 2:217232696-217232718 CCTTGAAAAAGAAAGCAATGGGG - Intergenic
946515614 2:220407806-220407828 ACTGACAAAAATAAGCAATGGGG - Intergenic
947688204 2:232109603-232109625 ACCTGACAAAATAAGCAAGGGGG + Intronic
947766811 2:232643199-232643221 AAAAGAAAAAATAAACAATGAGG + Intronic
947978649 2:234388975-234388997 ACCTGACAAAACAAGCAACGGGG + Intergenic
948240011 2:236422927-236422949 ACCTGAAAAAACAAGAAATGGGG + Intronic
1169024852 20:2361455-2361477 AGTGGAAAAAATAAGCATTGTGG - Intergenic
1169959894 20:11147970-11147992 CCTGGCAAAAATAAGCAATGGGG - Intergenic
1170228933 20:14023665-14023687 ACCTGACTAAACAAGCAATGGGG - Intronic
1170754157 20:19183691-19183713 ACCTGAAAAAAGAATGAATTTGG - Intergenic
1171575083 20:26302347-26302369 ACCTGAGAAAACAAGCAACGGGG - Intergenic
1172109075 20:32534970-32534992 GGCTGAAAAAAGAAGCAAGGGGG + Intronic
1173055635 20:39609801-39609823 ACCTGACAAAACACGCAATGGGG + Intergenic
1173189360 20:40864378-40864400 ACCTGCAAAATTAAACAAAGTGG + Intergenic
1173574335 20:44101146-44101168 AACTAAAAGAATAAGTAATGGGG + Intergenic
1174333291 20:49838317-49838339 ACCTGAAAAAATAAGAACATGGG + Intronic
1174373249 20:50108439-50108461 ACCTCAGAGAATAAGAAATGGGG + Intronic
1176308730 21:5138281-5138303 AACAGAAAAAATGAGCAAAGTGG + Intronic
1176444645 21:6810748-6810770 ACCTGAAAAATAAAGTAATAAGG - Intergenic
1176822811 21:13675786-13675808 ACCTGAAAAATAAAGTAATAAGG - Intergenic
1176909001 21:14540018-14540040 ACCTGAGAAAACAAGCAATGGGG + Intronic
1176967059 21:15223262-15223284 ACATGGAATTATAAGCAATGTGG + Intergenic
1176982002 21:15392922-15392944 ATCAACAAAAATAAGCAATGAGG - Intergenic
1177315096 21:19449622-19449644 AAATAAAAAAACAAGCAATGGGG + Intergenic
1177388575 21:20438090-20438112 AACTGACAAAAAAAGCTATGGGG + Intergenic
1177463795 21:21447276-21447298 ACCTGACAAAACAAGCAATGGGG + Intronic
1177657103 21:24031928-24031950 TCTTGAAAAAATAATTAATGTGG + Intergenic
1177870580 21:26568339-26568361 GTCAGCAAAAATAAGCAATGGGG + Intronic
1177951361 21:27542079-27542101 ATCTGACAAAACAAGTAATGGGG + Intergenic
1178079420 21:29047767-29047789 ACTCAAAAAAAAAAGCAATGGGG - Intronic
1178768905 21:35484063-35484085 TCCTGAACAAATCAGCAATAGGG - Intronic
1179144989 21:38760263-38760285 ACCTGCAGAAATAAGAATTGAGG + Intergenic
1179848329 21:44123751-44123773 AACAGAAAAAATGAGCAAAGTGG - Intronic
1179946225 21:44678839-44678861 AGCTGAAAAAGTAAGCAAAAAGG + Intronic
1180472490 22:15673018-15673040 ACATCAAAAAATAATAAATGTGG - Intergenic
1180477304 22:15723194-15723216 ACCTTAAAAAAAATTCAATGAGG + Intergenic
1180524271 22:16239907-16239929 ACCTGCAAAAACAAGCAATGGGG + Intergenic
1180739925 22:18046104-18046126 ACCTCAAAAAATAACCCATTGGG - Intergenic
1180795910 22:18605261-18605283 ACCTTAAAAAGTAAGCATTCAGG + Intergenic
1181137083 22:20775557-20775579 ACTTGAATAAATAAGCATTCAGG - Intronic
1181225814 22:21390010-21390032 ACCTTAAAAAGTAAGCATTCAGG - Intergenic
1181252819 22:21544803-21544825 ACCTTAAAAAGTAAGCATTCAGG + Intergenic
1181884995 22:26014402-26014424 ACCTGAAAGAATAATTAATATGG - Intronic
1181921995 22:26327878-26327900 TCCAGAAAAAGGAAGCAATGTGG + Intronic
1182076028 22:27496005-27496027 ACCTAAAATATTAAGAAATGAGG + Intergenic
1182173649 22:28260016-28260038 AACTGAAAATATAAGAATTGTGG - Intronic
1182761742 22:32727966-32727988 ACCTGACCAAACAAGCAATGGGG + Intronic
949367173 3:3295229-3295251 GCCAACAAAAATAAGCAATGAGG + Intergenic
949432773 3:3995601-3995623 ACCTGACAAAACAAGCAATGAGG - Intronic
949734073 3:7150496-7150518 ACTTGAAAGAATAAGTATTGAGG - Intronic
950171022 3:10839195-10839217 ACCTGAAAACAAAACAAATGTGG + Intronic
950246798 3:11427972-11427994 ACCTGGATAAAGAAGCCATGAGG + Intronic
950542136 3:13619008-13619030 ACCTGCAAAGGTAAGCAGTGTGG + Exonic
951014658 3:17717196-17717218 CTCTGAAAAAATATGCCATGAGG + Intronic
951070411 3:18321753-18321775 AGCTGATAAAACAAGCAATGAGG - Intronic
951197670 3:19842169-19842191 ACCTGACAAAACAAGTAATGGGG - Intergenic
951233458 3:20206949-20206971 ACCAACAAAAACAAGCAATGAGG - Intergenic
951296863 3:20947875-20947897 GCCAAAAAAAAAAAGCAATGGGG - Intergenic
951346774 3:21556487-21556509 CCCGTCAAAAATAAGCAATGGGG - Intronic
951488373 3:23240111-23240133 ACCTTAAATAATAAGCAGTAAGG - Intronic
952010010 3:28889874-28889896 ACCTGACAAAAAAAGCAATGGGG - Intergenic
952522235 3:34173086-34173108 ACCTGACAAAACAAGCAATGGGG - Intergenic
952574001 3:34752511-34752533 ACCAACAAAAACAAGCAATGGGG + Intergenic
952685438 3:36142467-36142489 GTCAGCAAAAATAAGCAATGGGG - Intergenic
952863242 3:37832484-37832506 ACCTGAAAAAATAAAACATGAGG + Intergenic
952998994 3:38913758-38913780 AGCTGACAAAACAAGCAATGAGG - Intronic
953113613 3:39968589-39968611 ACTGACAAAAATAAGCAATGGGG - Intronic
953116620 3:39998903-39998925 ACCTGACAAAACAAGCAATGGGG + Intronic
953230446 3:41060197-41060219 GCCAACAAAAATAAGCAATGGGG - Intergenic
953721450 3:45358896-45358918 AGTTGACAAAACAAGCAATGGGG - Intergenic
954525460 3:51266554-51266576 ACCTGACAAAAGAAGCAATGGGG + Intronic
954748287 3:52799303-52799325 ACCTGCAAGAATAGTCAATGTGG + Intronic
955439036 3:58935649-58935671 ACCTGAGAAAAACAGCAATGGGG + Intronic
955637684 3:61047851-61047873 ACATGAAAAAACAAGCAATGGGG + Intronic
955638094 3:61052306-61052328 TCCTGAAAATATAAGTAAGGTGG - Intronic
955854683 3:63260446-63260468 ACCTGACAAAACAAGAAATGGGG + Intronic
956134537 3:66085833-66085855 AATTAAAAAAATAAGTAATGAGG - Intergenic
956202100 3:66717354-66717376 ACCTGAAATAATAAACTCTGAGG - Intergenic
956577356 3:70767401-70767423 ACCTGAAAAAATATAGAAGGTGG - Intergenic
956577711 3:70772498-70772520 ACCTGAAAAAATATAGAAGGTGG - Intergenic
956940474 3:74155094-74155116 ACATGAGAAAAAAAGCAAAGTGG + Intergenic
957241403 3:77665385-77665407 ACTTACAAAAACAAGCAATGGGG - Intergenic
957254395 3:77817997-77818019 ACCTCCAAAAATAAAGAATGAGG - Intergenic
957688513 3:83536947-83536969 ACCTGAAAAAAAAAGAAATGGGG + Intergenic
957721855 3:84012473-84012495 ACCTGACAAAATAAGAAATGGGG + Intergenic
957739861 3:84250450-84250472 ACCTAACAAAATAAGCAATAGGG - Intergenic
957865358 3:86015911-86015933 ACCTACAAAAATAAGGATTGTGG + Intronic
958181795 3:90070589-90070611 ATTACAAAAAATAAGCAATGAGG + Intergenic
958570530 3:95876438-95876460 CCTTTAAAAAACAAGCAATGGGG + Intergenic
959118694 3:102207674-102207696 AACTGAAGAAATCAGCAATAGGG - Intronic
959119876 3:102220684-102220706 ACCTGACAAAACAAGCAACGGGG - Intronic
959494804 3:107037830-107037852 ACCTGATAAAACAAGTAATGGGG + Intergenic
959829597 3:110844569-110844591 ACCTAACAAAAAAAGCAATGGGG + Intergenic
960177946 3:114539463-114539485 ACCTTAGGACATAAGCAATGTGG + Intronic
960343273 3:116501306-116501328 AACTGAAAAAACAAGCAATGGGG + Intronic
961583859 3:127905884-127905906 ACCTGACAAAATAAGCAATGGGG + Intergenic
961912899 3:130339086-130339108 ACAAAAAAAAAAAAGCAATGAGG - Intergenic
962003141 3:131321228-131321250 TCTTCCAAAAATAAGCAATGGGG + Intronic
962899070 3:139741595-139741617 TCCTGAAATAATCAGGAATGGGG - Intergenic
962903182 3:139778618-139778640 ACCTGAAAAAAGATGCCATATGG - Intergenic
962941153 3:140125880-140125902 AGCTGAAAAAGGAAGAAATGAGG + Intronic
962981569 3:140495728-140495750 CCTTGCAGAAATAAGCAATGGGG - Intronic
963307285 3:143667207-143667229 ACCTGACCAAAAAAGAAATGGGG + Intronic
963381859 3:144540676-144540698 AATTGACAAAATAAGCAATGGGG + Intergenic
963387507 3:144615873-144615895 ACCTCAAAAAACAAGCAATGGGG - Intergenic
963694251 3:148544837-148544859 ACCTGACAAAAAAAGCAATGAGG + Intergenic
963924959 3:150941952-150941974 ACCAGTAAAAATTAGCAAAGAGG + Intronic
963984858 3:151580244-151580266 TACTGAAAAAATAAAGAATGAGG + Intergenic
964104739 3:153027112-153027134 ACAATAAAAAATAAGTAATGTGG + Intergenic
964241071 3:154595349-154595371 ACCTGAGAAAACAAGCAATGGGG - Intergenic
964296120 3:155235325-155235347 AATTGAAAACAAAAGCAATGGGG - Intergenic
964418800 3:156479044-156479066 ACCAGAAAAAATAAACAAGAGGG - Intronic
964513683 3:157481854-157481876 AAGTCAAAAACTAAGCAATGAGG - Intronic
964780063 3:160327553-160327575 ACCTGACAAAACAAGCAATGAGG + Intronic
964929836 3:162003755-162003777 AGTTGAAAAACTAAACAATGGGG - Intergenic
964966813 3:162504372-162504394 CCTGGCAAAAATAAGCAATGAGG + Intergenic
964995507 3:162874362-162874384 ATCTCAAACACTAAGCAATGAGG + Intergenic
965417421 3:168414436-168414458 AACTGAAACTATAAGCAATGGGG - Intergenic
965762713 3:172096578-172096600 ACTTTAAAAAATAAGCAAGCTGG - Intronic
965771470 3:172186231-172186253 AACTGGAAAAATAAGTAATTGGG + Intronic
965808563 3:172568198-172568220 AGCTGACAAAACAAGCAATGGGG - Intergenic
965930461 3:174036717-174036739 ATCTGAAAAAATAACTAATGGGG - Intronic
966041473 3:175494910-175494932 TCTTGAAAAAATAAGGAATTTGG - Intronic
966291612 3:178366007-178366029 ACCTGACAAAACAAGAAATGGGG + Intergenic
966357602 3:179097916-179097938 AACTTAAAAAATAATAAATGGGG - Intergenic
966362075 3:179140740-179140762 AGTTGCAAAAACAAGCAATGGGG + Intergenic
967368391 3:188714511-188714533 ACTTGAAAAAATAAGAACGGTGG - Intronic
969852375 4:9970138-9970160 ACCTGATAATATAGGCCATGGGG + Intronic
970012652 4:11476846-11476868 AGCTGACAAAACAAACAATGAGG + Intergenic
970210003 4:13699631-13699653 AGCTGACAAAATAAGCAATGGGG - Intergenic
970475823 4:16421869-16421891 ACCTGAGAAAACAAGCAATGGGG + Intergenic
971062456 4:22987821-22987843 ACCTGGAAAATTCAGTAATGTGG + Intergenic
971652440 4:29295643-29295665 TCCCTAAAAAATAAGTAATGTGG + Intergenic
971693936 4:29873474-29873496 ACCTGACAAAAGAAGAAATGGGG - Intergenic
971815243 4:31478422-31478444 GGCTGACAAAAAAAGCAATGGGG - Intergenic
971863884 4:32143716-32143738 ACCTGAAAAAACAAGCAATGAGG - Intergenic
972219751 4:36940465-36940487 ACCTGACAAAACAAGCAATGAGG + Intergenic
972220869 4:36952574-36952596 ACTGAAAAAAACAAGCAATGGGG - Intergenic
973098581 4:46232647-46232669 GCCTGCAAAAACAAGCAATGGGG - Intergenic
973114834 4:46442842-46442864 ACCTGATAAAATACTGAATGAGG - Intronic
973328429 4:48887602-48887624 ACCTGAAAAAACAAGAAATGGGG - Intronic
973683410 4:53344825-53344847 ACCTGAGAAAACAAGCAACGGGG + Intronic
973722505 4:53739512-53739534 ACCTGAGAAAACAAGCAATGGGG + Intronic
973935929 4:55846607-55846629 ACTGAGAAAAATAAGCAATGGGG + Intergenic
974110463 4:57519786-57519808 ACCTGGCAAAAAAAGAAATGGGG + Intergenic
974180043 4:58372617-58372639 ACTGAAAAAAATAAACAATGGGG - Intergenic
974410622 4:61537471-61537493 AGAAGAAAAAATAAGCAATTTGG - Intronic
974539414 4:63214767-63214789 ATATGACAAAACAAGCAATGGGG - Intergenic
974555218 4:63437615-63437637 GTCAGCAAAAATAAGCAATGGGG - Intergenic
974562879 4:63544392-63544414 AGTTGAAAAAATAAGCAATGAGG + Intergenic
974649841 4:64741135-64741157 ACCTGAGAAAAACAACAATGGGG + Intergenic
975483734 4:74911458-74911480 ACCTGACAAAAAAAACAATGGGG - Intergenic
975513181 4:75216271-75216293 ACCTGACAAAACAAGCAATAGGG - Intergenic
975739588 4:77416387-77416409 GCCAACAAAAATAAGCAATGGGG - Intronic
975739653 4:77417239-77417261 ACCTCAAAAAATAAGCCATTAGG - Intronic
976079772 4:81342922-81342944 AGATGAAAAAGTAAGAAATGTGG - Intergenic
976363593 4:84208471-84208493 CCCGGCAAAAACAAGCAATGGGG + Intergenic
976524486 4:86071657-86071679 ACCTGAGAAAAACAACAATGGGG - Intronic
977072449 4:92408208-92408230 ATCAATAAAAATAAGCAATGGGG - Intronic
977129650 4:93219387-93219409 ACCTGAAACAATAAAGTATGGGG + Intronic
977492496 4:97732297-97732319 ACCTGAAACTATAAGCATTCTGG - Intronic
977812953 4:101379351-101379373 GTCTACAAAAATAAGCAATGAGG - Intergenic
977863557 4:101996192-101996214 CCTCGAAAAAATAAGCAATGGGG - Intronic
978117087 4:105032529-105032551 ACCTGACAAAACAAGAAATGGGG + Intergenic
978300589 4:107265502-107265524 ATCTGAAAAAATAACCACAGGGG - Intronic
978319688 4:107479768-107479790 ACCTGAAAACATTAGCAATATGG + Intergenic
978544283 4:109853851-109853873 ACCTGACAAAACAAGCAATGGGG - Intronic
978657291 4:111079425-111079447 ACCTGACAAAACAAGCAATAGGG + Intergenic
978744632 4:112178470-112178492 AGCAGACAAAACAAGCAATGGGG - Intronic
978808737 4:112828092-112828114 GCCTACAAAAATAAGCATTGGGG + Intronic
979173559 4:117633355-117633377 AGCTGAAACAATAGGCATTGAGG + Intergenic
979185563 4:117787429-117787451 GCCGATAAAAATAAGCAATGAGG - Intergenic
979245429 4:118498566-118498588 ACATGAAAAAATGATCATTGTGG + Intergenic
979636943 4:122966546-122966568 ACCTGATAAAATAGGAATTGGGG - Intronic
979985822 4:127313130-127313152 ACCTGACACAGCAAGCAATGGGG + Intergenic
979996156 4:127433810-127433832 ATTGGAAAAAATAAGCAATAGGG + Intergenic
979998266 4:127459385-127459407 ACCTGACAAAAGAAGCAATGGGG - Intergenic
980198612 4:129624954-129624976 ACCTGACAAAACAAGAAATGGGG - Intergenic
980288716 4:130815650-130815672 GTCTACAAAAATAAGCAATGGGG - Intergenic
980336619 4:131482358-131482380 GTCTGAAAATATAAGCACTGGGG + Intergenic
980543452 4:134226106-134226128 GTCTACAAAAATAAGCAATGGGG + Intergenic
980688036 4:136255759-136255781 ACCTGACAAAACAAACAATGGGG + Intergenic
980867414 4:138569636-138569658 ACCTGAAAAACCAAGAAATGGGG + Intergenic
981102439 4:140844246-140844268 GCATAAAAAAATAAGAAATGAGG + Intergenic
981302280 4:143201256-143201278 AGCTGTCAAAACAAGCAATGGGG + Intronic
981349097 4:143708258-143708280 ATCAACAAAAATAAGCAATGAGG - Intergenic
981549027 4:145924186-145924208 ACAAGCAAAACTAAGCAATGTGG + Intronic
981835790 4:149051791-149051813 ATCTGAAAAAATAAACAGTGAGG - Intergenic
982336787 4:154248812-154248834 GCCAGCAAAAACAAGCAATGAGG + Intronic
982366102 4:154580704-154580726 CCCTGAAAAAATAACAAATTGGG + Intergenic
982620360 4:157696162-157696184 ACTGAGAAAAATAAGCAATGGGG + Intergenic
982686064 4:158490358-158490380 ACCTACAAAAACAAGCAATGGGG - Intronic
982792614 4:159610681-159610703 ACCTGAAAAAACAAGAAATGGGG - Intergenic
982810522 4:159820266-159820288 ACCTGCCAAAACAAGCAATGGGG + Intergenic
983018857 4:162649323-162649345 AGCTGACAAAACAAACAATGGGG - Intergenic
983030734 4:162798616-162798638 ACCTACAAAAACAAGCAATGGGG - Intergenic
983371595 4:166866157-166866179 CCCTACAAAAACAAGCAATGGGG + Intronic
983441557 4:167793061-167793083 AGTTGACAAAACAAGCAATGGGG - Intergenic
983829859 4:172313126-172313148 ACCTAAAAAAAAAAGAAGTGTGG - Intronic
983958454 4:173724068-173724090 ACCTGACAAAACAAGCAACGGGG - Intergenic
984226222 4:177038270-177038292 ACCTGAAAAAATATATTATGTGG + Intergenic
984447394 4:179854151-179854173 AACAGAAAAAAAATGCAATGAGG + Intergenic
984460439 4:180029691-180029713 AGCTCAAAATATAGGCAATGTGG + Intergenic
985158232 4:187015736-187015758 GCCAACAAAAATAAGCAATGGGG + Intergenic
985159750 4:187032245-187032267 ACCTGACAAAAACAGAAATGGGG - Intergenic
985170480 4:187143669-187143691 ACCTGAAAAAGTAAACATTTTGG - Intergenic
985233329 4:187845736-187845758 ACCTGACAAAAACAACAATGGGG + Intergenic
985319190 4:188689979-188690001 AACTGAATAAAGAAGTAATGTGG - Intergenic
985859961 5:2462923-2462945 AGGTGAAAAAATCAGCAATTTGG + Intergenic
985976588 5:3423447-3423469 ATCTCAAAAAATAACAAATGTGG + Intergenic
986172003 5:5322255-5322277 ACCTGAAAAAACAAGCAACGAGG - Intergenic
987019741 5:13857738-13857760 ACCTGACAAAACAAGCAATAGGG + Intronic
987229202 5:15875139-15875161 ACCTGATAAAACAAGCAGTGGGG + Intronic
987260848 5:16201295-16201317 ATTTGACAAAACAAGCAATGGGG + Intergenic
987464753 5:18258648-18258670 ATCTGAGAAAAAAAGCAGTGGGG + Intergenic
987608573 5:20171987-20172009 AGCTTACAAAATAAGCAATGAGG - Intronic
987975832 5:25013903-25013925 ATCTGACAAAAACAGCAATGGGG + Intergenic
988063926 5:26210176-26210198 AGTTGACAAAATAAGCAATGGGG + Intergenic
988352671 5:30131629-30131651 ACCTGACAAAAAAAGCAATGGGG - Intergenic
988675558 5:33429343-33429365 ACCTGAAAAAACAAGCAATGAGG - Intergenic
988946301 5:36204391-36204413 ACCATAAAAAATAGGCAAAGTGG - Intronic
989545891 5:42672494-42672516 AGATGACAAAATTAGCAATGGGG + Intronic
989656968 5:43754979-43755001 ACTTGACAAAATCAGCAATGGGG - Intergenic
989816532 5:45744336-45744358 ACCTGAGAAAAACAACAATGGGG - Intergenic
989848055 5:46171277-46171299 ACCTGACAAAACAAGAAATGGGG + Intergenic
989858988 5:46341629-46341651 ACCTGAGAAAACAAGCAATGGGG - Intergenic
990111917 5:52336883-52336905 ACCTGACCAAAAAAACAATGGGG - Intergenic
990138628 5:52677916-52677938 ACCTGACAAAAAAAGCAATGGGG - Intergenic
990175681 5:53105451-53105473 ACCTACAAAAACAAGCAATGGGG + Intronic
990234900 5:53756625-53756647 ACCCAAAAAAACAAGAAATGGGG + Intergenic
990775300 5:59299767-59299789 ACCTGAAATAAAACGCCATGGGG + Intronic
991161828 5:63512158-63512180 CCTTACAAAAATAAGCAATGGGG + Intergenic
991409125 5:66329562-66329584 GCCTGAAAAAGAAAACAATGGGG - Intergenic
991598819 5:68332320-68332342 ACCTGAACAAATACCCATTGTGG + Intergenic
992611113 5:78509525-78509547 CCCCGAGGAAATAAGCAATGAGG + Intronic
992853870 5:80840281-80840303 ACCTGACAAAACAAGCAATGGGG + Intronic
992854077 5:80842170-80842192 ACCTGACAAAACAAGCAATGGGG - Intronic
993023226 5:82617055-82617077 ACCTGACAAAACAAGAAATGGGG + Intergenic
993081080 5:83301840-83301862 ACCTGAAAAAACAAGCAATGGGG - Intronic
993532793 5:89044691-89044713 ACCTGAAGAAATATGAAGTGAGG + Intergenic
993665295 5:90688271-90688293 ACCTGAGAAAAACAGCAATGGGG + Intronic
993953744 5:94206936-94206958 ACCAGAAAAGAACAGCAATGTGG - Intronic
994259809 5:97643971-97643993 ACCAATAAAAACAAGCAATGGGG + Intergenic
994344252 5:98665584-98665606 ACCTGACAGAAACAGCAATGGGG + Intergenic
994479053 5:100310019-100310041 ACCTAACAAAACAATCAATGGGG + Intergenic
994585645 5:101705834-101705856 TCTTGCAAAAATAAGCAATGGGG - Intergenic
994672250 5:102776600-102776622 ACCTGACAAAAACAACAATGGGG - Intronic
995163886 5:109014347-109014369 ACCTGACAAAAACAACAATGGGG - Intronic
995586142 5:113650673-113650695 ACCTGACAAAAAAAGAAATGGGG + Intergenic
995631001 5:114132395-114132417 CCCAGCAAAAACAAGCAATGGGG - Intergenic
996124034 5:119705415-119705437 ACCTGAAAAAATAATTCAGGAGG - Intergenic
996136813 5:119853225-119853247 ACCTTTAAAAAGAAGGAATGTGG + Intergenic
996317692 5:122179000-122179022 CTGAGAAAAAATAAGCAATGGGG - Intronic
996356710 5:122603575-122603597 TCCTGAAAATATAAGCAACATGG + Intergenic
996426201 5:123315789-123315811 ACCTGACAAAATAAGTCATGGGG - Intergenic
996902513 5:128558797-128558819 ACCTGAAAAAACAAGCAATAAGG + Intronic
997850131 5:137324958-137324980 TCCTGAAAAAAAAAAAAATGAGG + Intronic
999446826 5:151646755-151646777 ATCTGAAAAAGTAAAGAATGGGG - Intergenic
999927802 5:156398086-156398108 AGCAGAAAGAATAACCAATGAGG - Intronic
1000521934 5:162306029-162306051 ACCTGGCAAAAACAGCAATGGGG + Intergenic
1000653227 5:163843679-163843701 ACATGAAAACATTAGAAATGAGG + Intergenic
1001462967 5:171934755-171934777 AGATGAAGAAATAAGCAATATGG + Intronic
1004079440 6:12376876-12376898 TCCTGAAACAAAAAGGAATGAGG + Intergenic
1004760542 6:18661252-18661274 ACCTACAAAAACAAGCAATGAGG + Intergenic
1005277547 6:24236308-24236330 ATCAGCAAAAATAAGCAATGGGG + Intronic
1005321605 6:24661160-24661182 ACCTGAAATAATTATCAATACGG + Intronic
1005419664 6:25635863-25635885 TCCTGAAAAAATCAGCCATAGGG + Intergenic
1006109839 6:31737797-31737819 ACCTAAATAAATAAGCAGGGAGG + Intronic
1006712620 6:36088003-36088025 ACCTGACAAAACGAGCAATGGGG + Intronic
1007514104 6:42397604-42397626 ACCTGAAAAGACAAACAACGAGG - Intronic
1008175731 6:48266031-48266053 ACCTGAAAAAGCAAGCAATGGGG - Intergenic
1008462751 6:51794785-51794807 ACCTCAAAAAACAAGCAGTGGGG - Intronic
1008576554 6:52865984-52866006 CCTGAAAAAAATAAGCAATGGGG + Intronic
1008701348 6:54104454-54104476 ACCTGAAAATATATTCAAAGAGG - Intronic
1008752685 6:54756522-54756544 ATCTGGAAAAATAACTAATGGGG - Intergenic
1009348414 6:62645984-62646006 AGCTGTAGAAATAAGTAATGAGG + Intergenic
1009986487 6:70787175-70787197 ACCTGACAAAAGGAGCAATGGGG + Intronic
1010291674 6:74144891-74144913 ATCAATAAAAATAAGCAATGTGG + Intergenic
1010315392 6:74442951-74442973 ACCTGACAGAAATAGCAATGGGG - Intergenic
1010321557 6:74515986-74516008 ATTTGACAAAACAAGCAATGGGG - Intergenic
1010556070 6:77281340-77281362 ACCTGACAAAACAAGCAATGGGG + Intergenic
1010590280 6:77704290-77704312 AGTTGAAAAAAGAAACAATGGGG - Intronic
1010881849 6:81185679-81185701 ATCTGAAAAAAACAGCAATAGGG - Intergenic
1010988720 6:82455182-82455204 ACCAATAAAAATAATCAATGGGG - Intergenic
1011174446 6:84544503-84544525 ACCTGACAAAAAAAGCAATGGGG + Intergenic
1011712784 6:90071566-90071588 AATTGAAAAGAGAAGCAATGGGG - Intronic
1011830834 6:91369468-91369490 ACCTGACAAAACAAGCAATGGGG - Intergenic
1012294600 6:97505408-97505430 TGCTGAATAAACAAGCAATGGGG + Intergenic
1012591859 6:100991739-100991761 ACCTGACAAAAACAGCAATGGGG - Intergenic
1012688216 6:102278813-102278835 ACCAACAAAAACAAGCAATGAGG - Intergenic
1012719980 6:102728712-102728734 ACCCGACAAAACAAGCAATGGGG - Intergenic
1012830990 6:104203212-104203234 ACCTGACAAAACAAACAATGGGG + Intergenic
1012958406 6:105595482-105595504 TCCTGCAAAACTAAGTAATGTGG - Intergenic
1013128114 6:107205323-107205345 ACCTGAAGAAATAAGAATTATGG - Intronic
1013301240 6:108806621-108806643 ACCTGAAATAATAATCCCTGTGG + Intergenic
1013335047 6:109149384-109149406 ACCTGAAAAAACAAGCAACGGGG - Intronic
1013390750 6:109684124-109684146 ACCTGACACAAAAAGCAATGGGG + Intronic
1013402091 6:109807872-109807894 ATCTGACAAAACAAGCAATGGGG - Intronic
1013643011 6:112106636-112106658 ACCTGGAAATGTAAGAAATGTGG - Intergenic
1013934219 6:115573360-115573382 ATCTGAAAAAATTAGCAATCCGG - Intergenic
1013971941 6:116030532-116030554 ACCAGAAAGAACAAGCCATGAGG + Intronic
1014091416 6:117407939-117407961 ACCTACAAAAACAAGAAATGGGG + Intronic
1014117158 6:117678589-117678611 ACTTGAAAATATAGGCCATGTGG + Intronic
1014229381 6:118886007-118886029 ACCTGAAAAATCAATCAATATGG + Intronic
1014522738 6:122465370-122465392 ACCTGAAAGAATAAAACATGAGG + Intronic
1014872175 6:126610265-126610287 ACCTACAAAAACAAGCAATGGGG - Intergenic
1015000128 6:128204150-128204172 ACCTGAAAAAACAAGCAATGGGG + Intronic
1015658153 6:135543211-135543233 ACTGATAAAAATAAGCAATGGGG + Intergenic
1016226176 6:141741224-141741246 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1016412109 6:143794491-143794513 GCTTTAAAAAATAAACAATGAGG + Intronic
1016571024 6:145512792-145512814 ACCAACAAAAATAAACAATGGGG + Intronic
1016612834 6:146011818-146011840 AGCTGACAAAAGAAGCAATGGGG - Intergenic
1016991275 6:149930574-149930596 ATCAACAAAAATAAGCAATGGGG + Intergenic
1016998802 6:149980773-149980795 ATCAACAAAAATAAGCAATGGGG + Intergenic
1017211970 6:151866991-151867013 ACCTGACAAAACAAGCAATGGGG + Intronic
1017662642 6:156688642-156688664 ATATAATAAAATAAGCAATGTGG + Intergenic
1017945712 6:159094812-159094834 ACCTAAAAAAATAATCACGGTGG + Intergenic
1018360397 6:163061965-163061987 TCCTGAATCAATGAGCAATGAGG - Intronic
1018574031 6:165239581-165239603 GTCAGCAAAAATAAGCAATGTGG - Intergenic
1019098298 6:169605833-169605855 AGCTGACAAAATCAACAATGGGG + Intronic
1019169606 6:170125404-170125426 ACCTGTGCAAATAAGAAATGAGG + Intergenic
1020614940 7:10447481-10447503 ACCTGACAAAACAAGCAGTGGGG + Intergenic
1020690503 7:11348978-11349000 ACCTGACAAAAACAGCAATAGGG - Intergenic
1021072566 7:16259421-16259443 ACCTGAAATAACTAGAAATGGGG + Intronic
1021092536 7:16500633-16500655 AACTAAAAAAAGAAACAATGTGG - Intronic
1021589586 7:22246454-22246476 ATCAACAAAAATAAGCAATGGGG + Intronic
1021870125 7:24997531-24997553 ACCTGACAAAACAAGCAATGGGG - Intergenic
1021943444 7:25702516-25702538 ACCTGACAAAAACAGAAATGGGG + Intergenic
1022481682 7:30747640-30747662 ACCTGAAGAAATAAAAAATAAGG - Intronic
1022495027 7:30847514-30847536 ACTGGAAAAAATAAACACTGAGG - Intronic
1022611720 7:31882101-31882123 ACCTTAAAAAGTAAGCAAGAGGG + Intronic
1022676128 7:32500871-32500893 ACCTGACAAAATAAGCAATGGGG - Intronic
1022885334 7:34637729-34637751 ACCTGACAAAACAAGCAATGAGG + Intergenic
1022999518 7:35793608-35793630 AACAGAAAAAAAAAGCTATGAGG + Intergenic
1023286479 7:38626421-38626443 TCTGGCAAAAATAAGCAATGGGG + Intronic
1023421341 7:39983284-39983306 TACTGAAAAAACAAGCAATGGGG - Intronic
1023697262 7:42860401-42860423 ACCTGACAAAAACAGCAATGGGG - Intergenic
1024353012 7:48386611-48386633 AACCTAAAAAACAAGCAATGGGG + Intronic
1024372480 7:48602488-48602510 ACTGGCAAAAACAAGCAATGGGG - Intronic
1024397902 7:48890072-48890094 ACCAGAAAAAATTAGGCATGTGG - Intergenic
1024664425 7:51531816-51531838 ACCTGACAAAAACAACAATGGGG - Intergenic
1024912773 7:54465113-54465135 ATCTTAAACAGTAAGCAATGGGG - Intergenic
1025784186 7:64629185-64629207 ACCTAAAAAAACAAGCAATGGGG + Intergenic
1026388490 7:69876064-69876086 ACTTTAAAAAATATGCAGTGTGG + Intronic
1027389947 7:77694892-77694914 AGCTTAAAAGATAAGGAATGTGG - Intergenic
1027869160 7:83684871-83684893 AACTGAAATAATAAGAAATGGGG + Intergenic
1027949473 7:84796016-84796038 AATTGACAAAACAAGCAATGGGG - Intergenic
1028080732 7:86572054-86572076 ACCTGAAAAAATAAGCAATAGGG + Intergenic
1028767200 7:94572994-94573016 AGCTGACAAAACATGCAATGGGG - Intergenic
1028942697 7:96541845-96541867 ATTGGCAAAAATAAGCAATGGGG - Intronic
1029422798 7:100479705-100479727 ACTTTTAAAAATAAGGAATGGGG - Intergenic
1029554726 7:101260771-101260793 ACCTCAAAAACAAAACAATGTGG - Intergenic
1030390820 7:108926295-108926317 ATCTGACAAAACAAGCAATGGGG - Intergenic
1030528446 7:110681581-110681603 CCCTGAAAAATAAAGAAATGTGG + Intronic
1030531195 7:110713173-110713195 CCCAACAAAAATAAGCAATGGGG - Intronic
1030761382 7:113356720-113356742 ACCTGCAAAAATGATCAAGGAGG - Intergenic
1030924467 7:115434771-115434793 GCCAACAAAAATAAGCAATGAGG + Intergenic
1030984494 7:116225144-116225166 ACTTTAAAAAATGAGCACTGAGG - Intronic
1031179132 7:118392850-118392872 ACCTGACAAAACAAGCAATGGGG + Intergenic
1031270684 7:119645351-119645373 ACGTGACAAAATAAGAAATGGGG - Intergenic
1031386259 7:121155082-121155104 ACCTGAAAAAGAAATCAAGGAGG + Intronic
1031388105 7:121177988-121178010 AACAGAAAGAAAAAGCAATGGGG + Intronic
1031523582 7:122796590-122796612 ACCTGACAAAACAAGCTAGGAGG + Intronic
1031902209 7:127423725-127423747 CCCAACAAAAATAAGCAATGGGG - Intronic
1032609501 7:133396778-133396800 ACTGGAAAAAATAAGCATAGTGG + Intronic
1032835056 7:135664729-135664751 ATTTAAAAAAAAAAGCAATGAGG - Intronic
1033326879 7:140387085-140387107 ACCATAAAAAATAAGTAGTGAGG - Intronic
1033363623 7:140655286-140655308 ACCTACAAAAGTCAGCAATGGGG + Intronic
1033565351 7:142573248-142573270 ACCTGACAAAACAAGCAATGGGG + Intergenic
1033873068 7:145781181-145781203 ACCTGAGAAAATAAGCAACGGGG - Intergenic
1033906124 7:146205482-146205504 AAATGAAAAAAGAAGTAATGGGG - Intronic
1033957408 7:146868282-146868304 AGATGACAAAACAAGCAATGAGG - Intronic
1034206124 7:149317359-149317381 AGAAGAAAAAGTAAGCAATGTGG - Intergenic
1034778726 7:153856818-153856840 ATCCAAAATAATAAGCAATGTGG + Intergenic
1035113130 7:156501136-156501158 ACCTGACAAAATAAGCAATGGGG - Intergenic
1035558368 8:585041-585063 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1036109593 8:5883235-5883257 ACCTGACAAAACAAGCACTGGGG - Intergenic
1036113957 8:5937501-5937523 ACCTGACAAAACAAGCAATGGGG + Intergenic
1037129244 8:15387887-15387909 ACCTGAAAATATCAGGAGTGTGG - Intergenic
1037166374 8:15834104-15834126 ACGTGAAAAAGAAAGTAATGAGG - Intergenic
1037198296 8:16219184-16219206 CCCGGCAAAAATTAGCAATGGGG - Intronic
1037242607 8:16794382-16794404 GCCTGACAAAATACGCAATTAGG + Intergenic
1038095704 8:24307421-24307443 AGCTGAAATATTAAGCAATGTGG - Intronic
1038516029 8:28188417-28188439 ACCAGAAAAATGAAGCCATGAGG + Intronic
1038562554 8:28593011-28593033 ATCAACAAAAATAAGCAATGGGG - Intergenic
1038591206 8:28839667-28839689 CCTGAAAAAAATAAGCAATGGGG + Intronic
1038855494 8:31327382-31327404 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1038863007 8:31408314-31408336 ACCCGAATAACTAAGCAAAGAGG - Intergenic
1039134300 8:34302443-34302465 ACAAAAAAAAAAAAGCAATGGGG + Intergenic
1039459642 8:37732938-37732960 AACTGAAAAAAAAAGAAAAGAGG + Intergenic
1040055276 8:43052212-43052234 ACCAGTAAACATAAGTAATGTGG + Intronic
1040071319 8:43191031-43191053 ACCTCAAAAAATATGCTAAGTGG - Intronic
1040539546 8:48340012-48340034 ACCAGGAAAAATAACTAATGAGG - Intergenic
1040608115 8:48955166-48955188 ACCTGACAAAACAAGAAATGGGG - Intergenic
1040631365 8:49216651-49216673 ACCTAAAAAAATAGGCAAATGGG - Intergenic
1040753324 8:50738789-50738811 ACAAAAAAAAAAAAGCAATGGGG + Intronic
1040860343 8:51992438-51992460 ACCTGAAAAAACGAACAATGGGG + Intergenic
1040911013 8:52519140-52519162 AGCTGAAGAAATAAGCAAACTGG - Intergenic
1040967432 8:53098460-53098482 GCCTTAAAAAATATGCAAAGAGG + Intergenic
1041396572 8:57397662-57397684 ACCTTAACAAAAAAGCACTGTGG - Intergenic
1041412214 8:57569181-57569203 ACCTGACAAAAAAAGAAATCGGG + Intergenic
1041837999 8:62238779-62238801 ACCTGACAAAACAAGCAACGGGG - Intergenic
1043038123 8:75224496-75224518 ACCTGAAGAAATAAGCAGTGGGG + Intergenic
1043272809 8:78355375-78355397 ACCTGAGAAAACAAGCAATGGGG + Intergenic
1043307504 8:78814794-78814816 ACTAGAAAAAATAAACAAAGAGG - Intergenic
1043433210 8:80214228-80214250 ACTTAAAAAAATTAACAATGTGG - Intronic
1043452832 8:80385250-80385272 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1043564777 8:81535681-81535703 ACTTGAGAAAATATGCAATGAGG - Intergenic
1043730810 8:83678070-83678092 ATATGACAAAACAAGCAATGGGG + Intergenic
1043867202 8:85388939-85388961 ACTGGAAAAAAAAAGCTATGAGG + Intronic
1043951561 8:86315144-86315166 AGCTGAAAAAACAAACAACGGGG - Intronic
1044272271 8:90260210-90260232 AAATGACAAAACAAGCAATGGGG + Intergenic
1044312984 8:90716668-90716690 ATCAACAAAAATAAGCAATGGGG - Intronic
1044349965 8:91152393-91152415 ACCTGACAAAACAAGCAATGGGG - Intronic
1044700002 8:94957167-94957189 ATCTCAAAAAATAAAAAATGGGG + Intronic
1044825428 8:96191775-96191797 ACCTGACAAAATAAGCAATGGGG - Intergenic
1044835489 8:96291666-96291688 ACCCTATAGAATAAGCAATGTGG - Intronic
1045389186 8:101698657-101698679 ACCTCACAAAACAAGTAATGGGG + Intronic
1045593932 8:103631395-103631417 ACGTACAAAAATAAGCAATGTGG - Intronic
1045698895 8:104842969-104842991 ATTGGTAAAAATAAGCAATGGGG - Intronic
1046285370 8:112086678-112086700 ACCTGACAAAAAAAGCAATGCGG + Intergenic
1046451483 8:114397256-114397278 AAAAAAAAAAATAAGCAATGAGG - Intergenic
1047093838 8:121602418-121602440 ATCTGATAAAATAAGCACTTTGG - Intergenic
1047837358 8:128708708-128708730 AAATGGAAAAACAAGCAATGGGG - Intergenic
1048341743 8:133545310-133545332 ACCTGAACAAATGAGCATGGTGG + Intronic
1048723255 8:137352351-137352373 AACTGAAAAAATATGAAAAGAGG - Intergenic
1048786214 8:138053198-138053220 ACCGGAAAAAACAAGCAATGGGG - Intergenic
1049165791 8:141125089-141125111 ACAACAAAAAATAAGAAATGTGG - Intronic
1050371142 9:4922589-4922611 AACTAAAAAGATAAGCTATGTGG + Intergenic
1050526016 9:6547181-6547203 ATATGAACAAATAAGCAATTAGG + Intronic
1050838338 9:10112921-10112943 AGCTTTAAAAATAAGCCATGTGG - Intronic
1050881528 9:10705911-10705933 ACATATAAAAATAAGCCATGAGG - Intergenic
1050923707 9:11236876-11236898 ACCAACAAAAACAAGCAATGGGG - Intergenic
1051274211 9:15383471-15383493 ACTTGAGGAAATAAGCAAGGAGG + Intergenic
1051537094 9:18171944-18171966 ACGTGAAAAAACAAGAAATGGGG - Intergenic
1051962171 9:22780068-22780090 TGCTGACAAAACAAGCAATGGGG - Intergenic
1052094215 9:24364834-24364856 GCTGGCAAAAATAAGCAATGGGG - Intergenic
1052193075 9:25680038-25680060 ATCTCAAAAAATAAGGAAGGGGG + Intergenic
1052262307 9:26531364-26531386 ACTAGAAAAAATAAGCAACAGGG + Intergenic
1052701981 9:31949013-31949035 ACCAACAAAAACAAGCAATGGGG + Intergenic
1052749308 9:32473191-32473213 ACCTGAGAAAAAAAGCATTTTGG + Intronic
1052875623 9:33560164-33560186 ACCAGGAAAAATTAGCCATGTGG + Intronic
1053500388 9:38584180-38584202 ACCAGGAAAAATTAGCCATGTGG - Intergenic
1053834656 9:42121593-42121615 CCCAGAAAAAAGAAGAAATGAGG + Intronic
1055540438 9:77299024-77299046 ACCTGAAAAAACAAGCAATGGGG - Intronic
1055810653 9:80143992-80144014 ACCTTAAAAAAAAAGAAAAGAGG + Intergenic
1056158356 9:83862440-83862462 ACCTGACAAAACAAGAAATGGGG - Intronic
1056246820 9:84704173-84704195 ACATGAAAAAATATACAAAGTGG - Intronic
1056863484 9:90208955-90208977 ACCGACAAAAACAAGCAATGGGG - Intergenic
1057078299 9:92152716-92152738 ATCTGAAACAATAAGAAAAGTGG - Intergenic
1057679785 9:97168606-97168628 ACCAGGAAAAATTAGCCATGTGG - Intergenic
1058193537 9:101947031-101947053 AACTGAAAAAATAAGTAAAGCGG - Intergenic
1058496358 9:105563151-105563173 AGCTGAAAGAATATGCAGTGGGG + Intronic
1058549289 9:106096611-106096633 ACCTGACAAAACAAGCAATGGGG + Intergenic
1058926661 9:109671368-109671390 ACCTGACAAAACAAGCAATAAGG - Intronic
1059078689 9:111223648-111223670 ACCTGACAAAACAAGCAATGGGG - Intergenic
1059262274 9:112989387-112989409 ACCTGAAAAAACAAGCAATTGGG - Intergenic
1059543152 9:115150492-115150514 AACTGAAAAAATAGCCAATGTGG + Intronic
1059584895 9:115595633-115595655 ATGTGAAAAAGTAAGCAATCAGG + Intergenic
1059686326 9:116640422-116640444 AAGTGAAAAAATAAACAAGGAGG + Intronic
1059745763 9:117199387-117199409 AACTGACAAAAAAAGGAATGGGG - Intronic
1059808234 9:117827714-117827736 ATCTTAACAAATAAGCAACGGGG + Intergenic
1059847043 9:118291801-118291823 ACCCTCAAAAATAAGCAATATGG + Intergenic
1060732589 9:126047928-126047950 ACCTGGAAACCTAAGAAATGGGG - Intergenic
1061585356 9:131563838-131563860 AACTGTGAAAATAAGCAATGAGG - Intergenic
1203524553 Un_GL000213v1:73779-73801 ACCTGAAAAATAAAGTAATAAGG + Intergenic
1185812433 X:3123157-3123179 ACCTGAAAAAACAAGCAATGGGG - Intergenic
1186738376 X:12490891-12490913 AGCTGTAAAAAGAAGGAATGAGG - Intronic
1186981685 X:14963954-14963976 ACATGAATAAACAAGCACTGTGG + Intergenic
1187622174 X:21068882-21068904 CCTGAAAAAAATAAGCAATGGGG - Intergenic
1188350198 X:29120404-29120426 ATCAGCAAAAATAAGCAATGGGG - Intronic
1188645088 X:32555704-32555726 ACCTGAAAAAACAAGCAATGGGG + Intronic
1188710207 X:33387466-33387488 ACATAAAACTATAAGCAATGGGG + Intergenic
1188796787 X:34476801-34476823 AGCAGACAAAACAAGCAATGAGG - Intergenic
1188868731 X:35347667-35347689 AATTGATAAAATAAGCAATAGGG - Intergenic
1188930959 X:36110377-36110399 AATTGACAAAAAAAGCAATGGGG - Intronic
1190478586 X:50852049-50852071 GCCTCAAAAAAAATGCAATGAGG - Intergenic
1191073298 X:56425322-56425344 ACCTGACAAAAAAAGAAGTGGGG - Intergenic
1191099191 X:56706689-56706711 ACCTGACAAAACAAGCAATAGGG - Intergenic
1191159757 X:57316600-57316622 GCCAACAAAAATAAGCAATGGGG + Intronic
1191573151 X:62658776-62658798 ACCTGAGAAAACAAGCAATGGGG - Intergenic
1191701729 X:64049142-64049164 ACCTGACAAAACAAGCAATGGGG + Intergenic
1191710512 X:64145515-64145537 CCCTGTAAATATAAGGAATGTGG - Intergenic
1191766160 X:64700517-64700539 CCCCCAAAAAACAAGCAATGGGG - Intergenic
1191798158 X:65045618-65045640 ACCTGTCAAAATAATCCATGGGG + Intergenic
1191831939 X:65424731-65424753 ACCTGACAAAAAAAGCAATGGGG - Intronic
1192307216 X:69974278-69974300 AAATACAAAAATAAGCAATGGGG + Intronic
1192505893 X:71683000-71683022 ACCAGAAACAATGAGCAAAGAGG - Intergenic
1192714112 X:73620964-73620986 ACCTGAAAAAATAAGCAATGGGG - Intronic
1192951353 X:76020577-76020599 ACCTGAAAAAACAAGAAATGGGG + Intergenic
1192957666 X:76090507-76090529 ACCTGACAAAACAAGCAATGGGG - Intergenic
1192964628 X:76164186-76164208 ATCTGACAAAACAAGCAACGGGG + Intergenic
1193035322 X:76944252-76944274 ACAAAAAAAAATAAGCAATGGGG - Intergenic
1193160815 X:78227196-78227218 ACCTGCACAAACAAGCAATGGGG - Intergenic
1193199370 X:78670024-78670046 GCCTGACAAAACAAGCAATGGGG + Intergenic
1193318809 X:80096350-80096372 CCCTGACAAAAAAAGCAATGGGG + Intergenic
1193367775 X:80655443-80655465 ACCTGACAAAACAAGCAATGGGG + Intergenic
1193439781 X:81525397-81525419 ACCAACAAAAACAAGCAATGGGG - Intergenic
1193566920 X:83087994-83088016 GTCAGAAAAAATAAGCAATGGGG - Intergenic
1193634164 X:83927626-83927648 ACCTGACAAAAAAAGCAATGGGG - Intergenic
1193748896 X:85318634-85318656 ATCTACAAAAATAAGCAATGGGG - Intronic
1193812491 X:86068134-86068156 ACATGATAAAACAAGCAATGGGG + Intergenic
1194027872 X:88776448-88776470 ACCTGACAAAATAAGCAATGGGG - Intergenic
1194029497 X:88794554-88794576 ATCAACAAAAATAAGCAATGGGG + Intergenic
1194262932 X:91719600-91719622 ATCTGAAAAGATAAACAAAGTGG + Intergenic
1194485137 X:94477261-94477283 GACTTGAAAAATAAGCAATGGGG + Intergenic
1194551064 X:95300122-95300144 ACCTGACAAAACAAGCAATGGGG + Intergenic
1194805399 X:98320798-98320820 CCTGGCAAAAATAAGCAATGGGG - Intergenic
1194900264 X:99500771-99500793 GTCTACAAAAATAAGCAATGGGG + Intergenic
1194918218 X:99730674-99730696 ACCTGACAAAAACAACAATGGGG + Intergenic
1195098458 X:101529209-101529231 ACCTGACAAAACAAGCAATGGGG + Intronic
1195140553 X:101955053-101955075 ACCTGACGAAAACAGCAATGGGG + Intergenic
1195669675 X:107459119-107459141 ACCTGAAAGAGTGAGCAATGAGG + Intergenic
1195789999 X:108573792-108573814 ACCTGAAAATAAAAGCAATCTGG + Intronic
1196002593 X:110802769-110802791 AACTAAAAGAATAGGCAATGTGG - Intergenic
1196367320 X:114938227-114938249 ACCTGACAAAACAAGCAATGGGG - Intergenic
1196473355 X:116053741-116053763 ATTGAAAAAAATAAGCAATGGGG - Intergenic
1196584477 X:117413893-117413915 AACTAACAAAAAAAGCAATGGGG + Intergenic
1196855415 X:119978308-119978330 ACCTGACAAAAAAAGAAACGGGG - Intergenic
1196870999 X:120113613-120113635 AACTTAAAAAATTAGCCATGTGG - Intronic
1196873900 X:120139333-120139355 ACATGAAAAATTATACAATGAGG + Intergenic
1197088215 X:122504784-122504806 TTCTACAAAAATAAGCAATGGGG - Intergenic
1197114773 X:122818787-122818809 ACCTGTACAAAGAAGCAATCTGG - Intergenic
1197329558 X:125137036-125137058 GCTTGAACAAATGAGCAATGTGG + Intergenic
1197480341 X:126976090-126976112 GCTTGTACAAATAAGCAATGTGG - Intergenic
1197532977 X:127653503-127653525 ATCTGACAAAAAAAGCAATGGGG + Intergenic
1197680583 X:129379951-129379973 AGTTGACAAAATAAGCAATGGGG + Intergenic
1199058472 X:143326008-143326030 ACCTGAAAATACAGGCAAAGAGG + Intergenic
1199213085 X:145236566-145236588 ACCACAAAAGATAAGTAATGAGG - Intergenic
1199254613 X:145704935-145704957 ACCTGACAAAACAAGAAATGGGG + Intergenic
1199387917 X:147244832-147244854 ACCTGACAAAAACAGCAATGGGG + Intergenic
1199469398 X:148177406-148177428 ACCTGAAAAAACAAGAAATGGGG - Intergenic
1199565315 X:149209486-149209508 ACCTGAAAAAGGAAGCCATGAGG + Intergenic
1199866591 X:151855624-151855646 ACCAAAATAAATAATCAATGGGG + Intergenic
1200370368 X:155718872-155718894 AAGTTATAAAATAAGCAATGAGG + Intergenic
1200618701 Y:5413773-5413795 CCCTGAACAAATAAAAAATGAGG - Intronic
1200885865 Y:8268960-8268982 ACCTGACAAAACAAGCAATGGGG + Intergenic
1201186065 Y:11404048-11404070 CCTTGTAAAAACAAGCAATGGGG - Intergenic
1201375157 Y:13311293-13311315 ACCGATAAAAATGAGCAATGCGG + Intronic
1201596328 Y:15673653-15673675 ACCTGAGAAAAACAGAAATGGGG - Intergenic
1201647462 Y:16251350-16251372 ACCCGCAGAAACAAGCAATGGGG + Intergenic
1201655349 Y:16333951-16333973 ACCCGCAGAAACAAGCAATGGGG - Intergenic
1201664900 Y:16439844-16439866 ACCAGAGAAAATTAGCAGTGAGG - Intergenic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1201983538 Y:19934784-19934806 ATCAAGAAAAATAAGCAATGAGG + Intergenic
1202079338 Y:21068476-21068498 ACCTGAGAAAAACAGCAATGGGG + Intergenic
1202084783 Y:21124790-21124812 ACCTGACAAAATAAGAAATGGGG - Intergenic