ID: 1086419562

View in Genome Browser
Species Human (GRCh38)
Location 11:86625251-86625273
Sequence TAACTATGGTCACCAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086419562 Original CRISPR TAACTATGGTCACCAAACTC AGG (reversed) Intronic
904805258 1:33126935-33126957 TAAATATGGTAACCCTACTCTGG + Intergenic
905422702 1:37859418-37859440 TCCCTATGGTGACCAAACTGAGG + Intronic
909125087 1:71657467-71657489 TAAATATAGTAACCAAACTTTGG - Intronic
910893684 1:92044865-92044887 TTACCATGGTTTCCAAACTCAGG + Intronic
912059439 1:105647650-105647672 GAAGTATGGTCACCAGAATCTGG + Intergenic
917407661 1:174725022-174725044 TCAATATGGCCACCAAGCTCTGG - Intronic
918218101 1:182410565-182410587 TAGCCATGCTCCCCAAACTCTGG - Intergenic
919581284 1:199377151-199377173 TAACTATTATCACCAAAAACTGG + Intergenic
920626320 1:207604934-207604956 TAACTATAGTCACCATGCTGTGG - Intronic
923194772 1:231654524-231654546 TAACTATAGTCACCATGCTGTGG + Intronic
1064951285 10:20853824-20853846 TAACTATGGTCACCCTATTGTGG - Intronic
1067375277 10:45722081-45722103 GCACTATGGTCTTCAAACTCTGG + Intergenic
1067378453 10:45750430-45750452 GCACTATGGTCTTCAAACTCTGG - Intronic
1067886150 10:50091110-50091132 GCACTATGGTCTTCAAACTCTGG - Intronic
1069419957 10:68238420-68238442 TAAGTAAAGTCACCAAAGTCTGG + Intergenic
1078285102 11:9945203-9945225 AAACTATGGTAACCAAAATCAGG + Intronic
1079655793 11:22985225-22985247 CAAATATTGTAACCAAACTCAGG + Intergenic
1079720962 11:23813892-23813914 GCACTAGAGTCACCAAACTCTGG - Intergenic
1079978556 11:27124154-27124176 AAACCAGGGTCACCAAACCCAGG + Intronic
1080706463 11:34699781-34699803 GAACGATGGTCACTAAAGTCTGG - Intergenic
1086029812 11:82340625-82340647 TAACTATCTTTACCAAATTCAGG - Intergenic
1086419562 11:86625251-86625273 TAACTATGGTCACCAAACTCAGG - Intronic
1088801624 11:113312438-113312460 TGCCTATGGTCCCCAACCTCAGG - Intergenic
1090685175 11:129108972-129108994 TAACTATAGTCATCCTACTCTGG + Intronic
1091904567 12:4173923-4173945 CACCTATGGGTACCAAACTCTGG + Intergenic
1092474203 12:8805568-8805590 TATCCATGGACACAAAACTCCGG + Intergenic
1094825499 12:34266340-34266362 TATCCATGGACCCCAAACTCCGG + Intergenic
1097091846 12:56511908-56511930 TTTCTATTGTCACCAAACCCTGG - Intergenic
1099864207 12:88258673-88258695 TAACTAAGGCCAGCAAAGTCTGG - Intergenic
1101438674 12:104686155-104686177 TCACTATAGCCTCCAAACTCGGG - Intronic
1101671266 12:106876155-106876177 TAGCTGTGGTTACCATACTCTGG - Intronic
1102199847 12:111049721-111049743 GAACCATGGTCACCAAACCCTGG + Intronic
1104896183 12:132166097-132166119 TAACAATGGTCACCAAGTCCTGG - Intergenic
1107806531 13:44158682-44158704 TAACAATGGTAACAATACTCAGG + Intronic
1111326557 13:86704894-86704916 TAAGGATGGCCACCAAACACAGG - Intergenic
1111374278 13:87356688-87356710 CAAATATTGTAACCAAACTCAGG + Intergenic
1111538760 13:89642235-89642257 TAACTATAGTCACCCTCCTCGGG + Intergenic
1111579609 13:90206304-90206326 AAACAATGGTCACCAAGTTCTGG - Intergenic
1111935619 13:94554243-94554265 TAACTATGGTTGCCAACTTCAGG - Intergenic
1121980777 14:98451896-98451918 TATCTATGGACCCAAAACTCCGG - Intergenic
1124577191 15:30920300-30920322 AAACCAAGGTCAGCAAACTCCGG - Intronic
1125045467 15:35239358-35239380 TATCTGTGGACCCCAAACTCCGG + Intronic
1125152859 15:36553120-36553142 TAAATATGGACAACCAACTCTGG - Intergenic
1129639627 15:77362104-77362126 TAACTATGGTCATCTTACTGTGG - Intronic
1133622610 16:7540939-7540961 TAACCAGGGTCATCAAACTAAGG - Intronic
1137739999 16:50759665-50759687 TTACAATGGGCACCAAACTGTGG - Intronic
1139197663 16:64939553-64939575 TAACTATGGTCACCCTACAGTGG - Intergenic
1140693662 16:77509989-77510011 TAACTAACGTCAACACACTCTGG - Intergenic
1141349228 16:83277320-83277342 TAACTATGTTCTCCAAAGTATGG + Intronic
1143102407 17:4511717-4511739 TAATTATGGTCAACCCACTCAGG + Intronic
1146199130 17:30840331-30840353 TAATTTTAGTCACCAAATTCAGG - Intronic
1152247433 17:79192422-79192444 TCTCTCAGGTCACCAAACTCGGG + Intronic
1152920634 17:83064819-83064841 TAAATCTGGTCATCAGACTCGGG + Intergenic
1156413188 18:36856576-36856598 GAACTATGGTCAAGAAACTAAGG - Intronic
1156776759 18:40798947-40798969 TAACTATAGTCACTAAGCTGTGG - Intergenic
1163782205 19:19256556-19256578 TTGCCATGGTGACCAAACTCTGG - Exonic
928260774 2:29764373-29764395 TAAGTGTGGTCACCAAACTTGGG - Intronic
928756328 2:34530121-34530143 TACCTATTGTCACCAAACTAAGG - Intergenic
933679053 2:85082586-85082608 TAACAATAAACACCAAACTCAGG - Intergenic
934059312 2:88279539-88279561 GAACTGCGGTCATCAAACTCGGG + Intergenic
943651245 2:190459707-190459729 TAACTATGGTCACCATCAGCAGG - Intronic
944241527 2:197490237-197490259 TTTCTATTGTCACCAAACCCTGG + Exonic
945024837 2:205610293-205610315 TAACTATGGTCATCACACCTGGG + Intronic
1171057538 20:21921768-21921790 GATCTGTGGTCACCAGACTCAGG + Intergenic
1175070213 20:56326661-56326683 GAACTGTGGTTACTAAACTCGGG + Intergenic
1178064393 21:28888067-28888089 TTTCTATTGTCACCAAACCCTGG + Intergenic
1178923044 21:36751892-36751914 AAAATGTGGTCACTAAACTCAGG - Exonic
1181184451 22:21092726-21092748 TAACTTCTGTCATCAAACTCTGG + Intergenic
1182866379 22:33607891-33607913 TATCTATGCTCACCATGCTCAGG + Intronic
1183257948 22:36775207-36775229 AAACTCTGGTCACTACACTCAGG + Intronic
1184280970 22:43437206-43437228 CAGCCATGATCACCAAACTCTGG - Intronic
950466301 3:13156911-13156933 TCACTGTGGTCATCACACTCTGG - Intergenic
951287571 3:20833581-20833603 TAACTATGGTCACTAATTCCTGG - Intergenic
951536167 3:23742847-23742869 TAACTGAAGTCACTAAACTCTGG - Intergenic
952286487 3:31974410-31974432 TACCTATGTTCTCCAAACACAGG + Intronic
952364400 3:32662156-32662178 TAACTATAGTCACCATGCTGTGG - Intergenic
954995104 3:54874096-54874118 TAACTGTGGTTACTAAATTCAGG - Intronic
959671565 3:108983726-108983748 TGACTCTCCTCACCAAACTCAGG - Intronic
962548465 3:136462601-136462623 TAACTATAGTCACCCTACTGTGG - Intronic
963198884 3:142566668-142566690 TAATTCTGGTCACCAAAGTCTGG - Intronic
963737633 3:149037538-149037560 TAACTAGGGTCATCATACTTAGG - Intronic
974998437 4:69192583-69192605 AAAATATGGTCACCATATTCAGG + Intronic
978041371 4:104067364-104067386 TAACTGTGATCACCAAGCTGTGG - Intergenic
978153895 4:105468026-105468048 CAGCAATGGTCAGCAAACTCTGG + Intronic
981326593 4:143455486-143455508 TAACTATGGTGAAAAAAATCAGG + Intronic
981360184 4:143837418-143837440 TAACTCTGGTCATCATACTGTGG + Intergenic
981370961 4:143958487-143958509 TAACTCTGGTCATCATACTGTGG + Intergenic
981446606 4:144846533-144846555 TTTCTATTGTCACCAAACCCTGG - Intergenic
983659320 4:170117135-170117157 TATCCATGGACACAAAACTCCGG + Intergenic
983881110 4:172934279-172934301 TAACAGTGGTTTCCAAACTCAGG + Intronic
987739177 5:21883497-21883519 TTTCTATTGTCACCAAACCCTGG - Intronic
990046365 5:51437228-51437250 TAAGTATAGTCACCCTACTCTGG + Intergenic
991302035 5:65138156-65138178 AAACTACTGTCACCAAACTTAGG - Intergenic
996973794 5:129406148-129406170 AAACCATGGTCGCCAAACTCTGG + Intergenic
999357342 5:150947488-150947510 AAATTATGGTCGCCAACCTCAGG - Intergenic
1001462751 5:171932591-171932613 TAACTATATTCACCCTACTCTGG + Intronic
1003458149 6:6303596-6303618 TAACTATAGTCACCATGCTGTGG + Intronic
1003464844 6:6369104-6369126 TAAGTATGTCCACCAAATTCTGG + Intergenic
1003815199 6:9832390-9832412 AAACTATGGTTTCCAAACTGTGG + Intronic
1004898200 6:20169421-20169443 GCACAATGGTCACCAAACTTTGG - Intronic
1005431296 6:25760095-25760117 AAACTATGATCACCAAGCTTAGG - Intronic
1007478890 6:42137179-42137201 TAATTATTGTCACCAGGCTCTGG - Intronic
1012360186 6:98368040-98368062 TCACTTTGGTCACCAAACGAAGG + Intergenic
1015654487 6:135501521-135501543 TCACTATAGTCATCAAAATCAGG - Intergenic
1020700582 7:11477432-11477454 TAACTTTGGTCACCAGATTAAGG + Intronic
1022303387 7:29122621-29122643 GGACTATTGTCACCAAATTCAGG + Intronic
1025096530 7:56099968-56099990 AATCCATGGACACCAAACTCAGG + Intergenic
1028506296 7:91574279-91574301 TAACTATGGTGACCAAAAGGGGG + Intergenic
1034333881 7:150307991-150308013 TATCTGTGGACTCCAAACTCTGG + Intronic
1036283300 8:7419752-7419774 TTTCTATTGTCACCAAACCCTGG - Intergenic
1036338170 8:7891769-7891791 TTTCTATTGTCACCAAACCCTGG + Intergenic
1037297500 8:17416419-17416441 TAACTATAGTCACCATACTATGG - Intergenic
1042530981 8:69815086-69815108 TAACTATATTCACCATACTGTGG - Intronic
1045807005 8:106174720-106174742 TAAATATCATCACCAAACCCTGG + Intergenic
1050511872 9:6404701-6404723 GAACTAGGGTCAGCAAACTGTGG + Intergenic
1050592530 9:7174865-7174887 TATTTTTGGTGACCAAACTCTGG - Intergenic
1052629663 9:31021009-31021031 AATTTATGGTCTCCAAACTCAGG - Intergenic
1055490018 9:76795315-76795337 TAACTATGGTCACCAAACTGCGG + Intronic
1056047682 9:82736058-82736080 TAACAAGGGTCAGCAAACTATGG - Intergenic
1057840652 9:98483298-98483320 GAATGATGGTAACCAAACTCAGG - Intronic
1059619656 9:115989228-115989250 TAACTATGCTCAGGAAAATCAGG - Intergenic
1187278125 X:17834405-17834427 TAATTATGATCACCATAGTCTGG + Intronic
1191630212 X:63314120-63314142 AAACAATGGTCACCAACTTCCGG - Intergenic
1193831996 X:86300092-86300114 TAACTATAGTCACCCTACCCTGG + Intronic
1194037528 X:88896081-88896103 TAACTATGGTAACAAAACTTTGG - Intergenic
1197475711 X:126922496-126922518 TAACTATGGTAACCAGTCTCTGG + Intergenic
1199546971 X:149016781-149016803 TGCCTATGTTCACCAGACTCTGG + Intergenic