ID: 1086420355

View in Genome Browser
Species Human (GRCh38)
Location 11:86632227-86632249
Sequence CAGCCTGAGCAGAGGGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 476
Summary {0: 1, 1: 0, 2: 5, 3: 47, 4: 423}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086420350_1086420355 19 Left 1086420350 11:86632185-86632207 CCAAAAGTGATGTGTTCAAGGGC 0: 1
1: 0
2: 0
3: 13
4: 482
Right 1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG 0: 1
1: 0
2: 5
3: 47
4: 423

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086420355 Original CRISPR CAGCCTGAGCAGAGGGCCTC TGG Intronic
900257966 1:1706957-1706979 CTGCCTGAGCAAAAGGCTTCTGG + Intronic
900371509 1:2334208-2334230 CAGCCACAGTTGAGGGCCTCTGG + Intronic
900563321 1:3319494-3319516 CAGCCTGGTCTGATGGCCTCAGG - Intronic
900854074 1:5166726-5166748 CAGCCTGGGCACAGGTCGTCAGG - Intergenic
900869497 1:5291919-5291941 CAGCCAGAGAAGAGGGCCGTGGG - Intergenic
901177684 1:7316736-7316758 CAGCCTGTGCTGAGATCCTCAGG + Intronic
901297567 1:8172269-8172291 CAGCTTGTGCAAAGGGCCTGAGG + Intergenic
901336889 1:8457248-8457270 CCACCTGAGCATGGGGCCTCAGG - Intronic
901420092 1:9145005-9145027 CAGCCTGTACAGGGGGCCTGGGG + Intergenic
901925968 1:12566297-12566319 CAGGCTGACCAGGGGGCCTCAGG - Intergenic
902697317 1:18149156-18149178 CAGGCTGGACAGAGGGGCTCAGG - Intronic
902821677 1:18947279-18947301 CACCAGCAGCAGAGGGCCTCGGG - Intronic
902837645 1:19057540-19057562 CAGCCTGAGCAGAGGCCCTGGGG + Intergenic
902861790 1:19251916-19251938 CAGCCTGCGGTGAGGGCTTCGGG + Intronic
902933565 1:19747891-19747913 CAGCCGCAGCAAAGGGGCTCAGG - Intronic
902957212 1:19933916-19933938 CAGCCTGTGCAAAGGCCCTGTGG + Intergenic
903238042 1:21963540-21963562 CAACCAGAGCAGAGGGTCCCTGG + Intergenic
903849505 1:26297497-26297519 CAGGGTGAGCACAGGGCCTGTGG + Intronic
904423384 1:30408319-30408341 CAGCCTGGCCAGATGGCCTTTGG - Intergenic
904556235 1:31366615-31366637 CTGCCTAACCACAGGGCCTCAGG - Intronic
905222982 1:36461662-36461684 GGAGCTGAGCAGAGGGCCTCTGG + Intronic
905273672 1:36803258-36803280 CAGCATGTGCAAAGGGCCTAAGG + Intronic
905328795 1:37177382-37177404 CAGCCTGAGCAAAGGCCCAGAGG + Intergenic
906524929 1:46488414-46488436 CAGCCTGGGTTGAGGGCGTCAGG - Intergenic
906562611 1:46770259-46770281 CATCCTGGGCAGAGGGGCTGGGG + Intronic
906818009 1:48899066-48899088 GAGGCTGAGCCGAGCGCCTCAGG - Intronic
907510636 1:54955766-54955788 GGGCCTGAGCATAGGGGCTCAGG - Intergenic
907805723 1:57817514-57817536 CAGCCTGAGCTGAGAGCCCCAGG - Intronic
910116273 1:83735806-83735828 CAGCCTAAGGAGAGGCCCACAGG - Intergenic
911275382 1:95853093-95853115 CAGCCTGAGGAGGGGGCTCCAGG - Intergenic
911618334 1:100038543-100038565 CGGCCAGAGCAGAGGGCGGCAGG - Intronic
914048202 1:144107813-144107835 CCGCCTGAGCACAGAGCCACAGG + Intergenic
914130982 1:144857635-144857657 CCGCCTGAGCACAGAGCCACAGG - Intergenic
915163932 1:153937974-153937996 CAGCCTGGGAAGATGGCGTCAGG + Intronic
915268616 1:154735811-154735833 CTGCCTCAGCACAGGGCCTGAGG - Intronic
915492812 1:156260805-156260827 CAGGCAGAGCAGAGGGGCTCAGG + Intronic
915580110 1:156808498-156808520 CAGGCTGAGCAGGGAGCCTGGGG + Intronic
915902006 1:159854416-159854438 CAGCCTAAGCAGAGGGCCCCGGG - Exonic
919675354 1:200376826-200376848 CAGCATGAGCAAAGGCCCTGAGG - Intergenic
919859787 1:201731919-201731941 CAGCATGAGCACAGGGCAGCTGG - Intronic
919925001 1:202187580-202187602 CAGCATGGGCTGGGGGCCTCTGG + Intergenic
921508657 1:216005545-216005567 CAGCCTGGGTAGAGGGCATGGGG - Intronic
922217987 1:223536248-223536270 CAGCCTGAGGAGAATGCCTTTGG + Intergenic
922507478 1:226134903-226134925 CAGCCAGTGCAGAGGCCCTGAGG - Intergenic
922571096 1:226635058-226635080 ATGCCTGGGCAGAGGGCATCGGG + Intronic
922588477 1:226753873-226753895 CAGCCAGAGTAGAGGCCCTGAGG + Intergenic
922773822 1:228205975-228205997 CACCCTGGGCACAGTGCCTCCGG + Intronic
923304338 1:232674399-232674421 CTGCCTGAGAAGAGGGACTGAGG - Intergenic
1064261031 10:13786628-13786650 CATCCTTTGCAAAGGGCCTCTGG + Intronic
1066696725 10:38085522-38085544 CAGGCTGAGAAGAATGCCTCTGG + Intergenic
1066995837 10:42562210-42562232 CAGGCTGAGAAGAATGCCTCTGG - Intergenic
1067347224 10:45445344-45445366 CTGCCTGACAAGAGGGCCTCGGG - Intronic
1067794818 10:49313309-49313331 CACCATGAGCAGAGGCCCTGAGG + Intronic
1069194238 10:65528513-65528535 CTGTCTGAGCAGTGGTCCTCTGG + Intergenic
1069717638 10:70531198-70531220 CAGCTTGGGCAGAGGCCCTGAGG + Intronic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1071191322 10:83104789-83104811 CAGTATGAGCAGAGTGCCTTGGG - Intergenic
1071493967 10:86155155-86155177 TGGCCTGGGCAGAGGGCATCTGG - Intronic
1071600209 10:86955315-86955337 CAGCCTGAGCATTAGGACTCCGG - Intronic
1072570629 10:96654793-96654815 CAGCCTGACCAGAGGGGCATGGG + Intronic
1072615416 10:97046365-97046387 CAGCCTGACCAGAGGGCAATGGG + Intronic
1072618468 10:97064717-97064739 CAGCCTAGGCAGCGGGCATCAGG - Intronic
1072620228 10:97074777-97074799 CAGCCAGAGCAGGGTGCCTGGGG - Intronic
1072664757 10:97384975-97384997 CAGCCTGGACAGAGGCCCTGAGG + Intronic
1072727107 10:97821622-97821644 GAGCCTGAGCTGAGGGCATATGG - Intergenic
1074766133 10:116701237-116701259 CAGCTGAAGCAGAGTGCCTCTGG - Intronic
1075472665 10:122704612-122704634 CAGCCTGTGCAGAGCACCTGTGG + Intergenic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1076272122 10:129162933-129162955 CAGCAGGAACAGAAGGCCTCCGG + Intergenic
1076739932 10:132478089-132478111 CAGGCTGAGGAGAGGGGCCCTGG + Intergenic
1076991524 11:278579-278601 CACCTGGAGCAGGGGGCCTCTGG - Exonic
1077169827 11:1161131-1161153 CAGCCAGGGCAGGGGGCTTCAGG + Intronic
1077283397 11:1755457-1755479 CAGCCAGTGCAGAGGCCCTGCGG - Intronic
1077481454 11:2816711-2816733 CAGCCAGGGCAGTGGGCCTGAGG - Intronic
1077514785 11:2994965-2994987 CAGCCAGAGCTGAGGGCCACTGG + Intergenic
1078184039 11:9036515-9036537 ATGGCTGAGCAGAGGGGCTCTGG - Intronic
1078610733 11:12816926-12816948 CAGCATGTGCAGAGGCCCGCTGG + Intronic
1078895592 11:15594461-15594483 CAGCCTCAGCAGAGGTCATGGGG + Intergenic
1078907849 11:15704175-15704197 CAGCCTGAGCCATGGGCCTAAGG + Intergenic
1079387487 11:19993669-19993691 CAGTCTGATCACATGGCCTCTGG + Intronic
1079615120 11:22482555-22482577 CAGCTTCTGGAGAGGGCCTCAGG - Intergenic
1081654983 11:44851194-44851216 CAGCCTGAGCAGTGGGCCAGCGG + Intronic
1081677589 11:44979961-44979983 CAGCCTGAGCACAGGGCCCTGGG + Intergenic
1081807496 11:45898539-45898561 CAGCCCTGGCAGAGGGCCTGAGG + Intronic
1083647960 11:64184071-64184093 CAGCCAGTGCAAAGGGCCTGGGG - Intergenic
1084001025 11:66295506-66295528 CAGCCTGAGCGGGGGGCCGCTGG + Exonic
1084273814 11:68042021-68042043 TGGGCTGAGCAGAGGGCCTAGGG + Intronic
1084279694 11:68079885-68079907 CAACATGAGAAGAGGGCCTATGG + Intronic
1084438065 11:69155606-69155628 TGGCCTGAGCTGAGCGCCTCTGG + Intergenic
1085337122 11:75704825-75704847 CAGCATGAGCAAAGGCCCTCAGG + Intergenic
1086420355 11:86632227-86632249 CAGCCTGAGCAGAGGGCCTCTGG + Intronic
1086558042 11:88134999-88135021 TAGCATGAGCAGAGGCACTCTGG - Intronic
1087091410 11:94277234-94277256 CATCCCAAGCAGAGGGCCTCCGG - Intergenic
1088199888 11:107320931-107320953 GAGCATGAGCAGAGGGACTATGG + Intergenic
1088720672 11:112589409-112589431 CTGTCTGAGCAGAGGGGCCCTGG + Intergenic
1088852966 11:113720467-113720489 CAGCATGAGCAAAGGGGCTGTGG - Intergenic
1089703284 11:120258761-120258783 CACCCTGAGCAGACGGCACCAGG - Intronic
1090040768 11:123289451-123289473 CTGCATGAGGTGAGGGCCTCAGG + Intergenic
1090206039 11:124884988-124885010 CATCTTGACCAGAGGGCCTCTGG - Intronic
1090650546 11:128802332-128802354 CAGCCTGAGCACATTGGCTCTGG - Intronic
1090681856 11:129068124-129068146 CAGCCTGAATTGAGGGCCACTGG + Intronic
1090993208 11:131839467-131839489 CAGCCAGGGCAGAAGCCCTCAGG + Intronic
1091803867 12:3342410-3342432 CAGCCTGAACAAAGGGCCAAAGG - Intergenic
1092486590 12:8907577-8907599 GGGCCTGAGCAGAGGGACTCAGG + Intergenic
1092562975 12:9636133-9636155 CAGCAGGAGCAAAGGGCCTAAGG - Intergenic
1094639074 12:32255677-32255699 CAGCCAGAGCAAAGGCCCTAAGG - Intronic
1100790526 12:98125218-98125240 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1102100332 12:110273431-110273453 CAGCCTGAGGAGAGGTCCCAAGG + Intergenic
1103274579 12:119700954-119700976 CTGGCTCAGCAGAGGGCCTCTGG - Exonic
1103573612 12:121860566-121860588 CAGCCTGAACAGAGAGCATCAGG - Intronic
1103994307 12:124819269-124819291 CAGCCTGTGCAAAGGCCCTGTGG + Intronic
1104020254 12:124987484-124987506 CCACCTGAGCAGAGGGGCTGAGG - Intronic
1104144471 12:126019238-126019260 CAGCATGAGCAAAAGGCCTGGGG + Intergenic
1104758237 12:131282081-131282103 CAGCCTGACTGCAGGGCCTCTGG + Intergenic
1105502024 13:20981134-20981156 CAGACTGAGCAGAGGTCCTGTGG + Intronic
1106313997 13:28577800-28577822 CAGGCAGAGCAGAGGGCTTTGGG - Intergenic
1108343012 13:49516020-49516042 CATTCTAAGCAGAGGGCCTTGGG - Intronic
1108637637 13:52351545-52351567 CAGCATGTGCAGAGGCCCTGAGG + Intergenic
1112106707 13:96248264-96248286 CAACCTGAGCCGAGGGCTTAAGG - Intronic
1112506497 13:99979501-99979523 CAGCCTGAGGCCAGCGCCTCGGG - Intergenic
1117201038 14:53390380-53390402 CAGCAAGTGCAGAGGCCCTCGGG - Intergenic
1117457271 14:55911034-55911056 GAGCCTCAGCAAAGGCCCTCCGG - Intergenic
1119322201 14:73738891-73738913 CAGCCTGGGCAGGAGGCCACTGG - Exonic
1119479553 14:74951043-74951065 CAGTCCTAGCAGAGGCCCTCGGG + Intronic
1120915436 14:89706208-89706230 CAGGCTGTACAGAAGGCCTCAGG + Intergenic
1121008778 14:90507670-90507692 TAGCCTGAGCAGAGGCACTGAGG - Intergenic
1121630986 14:95421823-95421845 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
1121733281 14:96201333-96201355 CAGGCTGTGCAGGAGGCCTCTGG + Intergenic
1122201896 14:100127896-100127918 CACCCTGAGCAGAGAGCTTGTGG + Intronic
1122203042 14:100134031-100134053 GTGCCTGTGCAGAGGGCCTCGGG - Intronic
1122543886 14:102511750-102511772 CAGGCTGTGCACTGGGCCTCAGG + Intergenic
1122594109 14:102877329-102877351 CAAACTGAGCAGAAGGCCTGTGG - Intronic
1122695587 14:103550644-103550666 CAGGCTGAGAACTGGGCCTCTGG - Intergenic
1122745524 14:103895114-103895136 CAGCCAGAGCAGGGGGCCTGGGG - Intergenic
1122814597 14:104306316-104306338 GAGCCTGTGCAGATGGCCTGGGG + Intergenic
1123008269 14:105334843-105334865 CTGCCAGACCAGAGGGGCTCTGG - Intronic
1124177225 15:27437808-27437830 CTGCCTCTGCTGAGGGCCTCAGG + Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124630148 15:31331553-31331575 CTGGCAGAGCAGAGGGCATCTGG + Intronic
1125430796 15:39591359-39591381 CTGCCTGATCAGAGGGCCCGCGG + Intronic
1126142616 15:45450372-45450394 CAGGCGTAGCAGAGGGGCTCCGG + Intergenic
1126605311 15:50470448-50470470 AAGCCAGAGCAGAGGCCCTTAGG + Intronic
1128798780 15:70483678-70483700 CTGCTTGAGCAGATGGCCTAGGG + Intergenic
1129360435 15:75020813-75020835 CATCCTGAGCCAGGGGCCTCTGG + Exonic
1130149111 15:81297968-81297990 CACCCAGAGCAGAGGCCCTGTGG + Intronic
1131069725 15:89458591-89458613 CAGCCTGTGCAAAGGTCCTGAGG + Intergenic
1131153081 15:90059216-90059238 CAGCCTGTGCAGAGGCCCCAAGG + Intronic
1132293001 15:100716123-100716145 CAGCCTGAGCAGAAGGCCAGCGG - Intergenic
1132372859 15:101310087-101310109 CAGCCTGAGCTGAGAACCACAGG - Intronic
1132611622 16:819617-819639 CAGCCTGAGCTGGGGGCTGCTGG + Intergenic
1133083856 16:3346113-3346135 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1133319567 16:4904591-4904613 CAGCCTGTGCAAAGGTCCTGAGG + Intronic
1133707201 16:8366178-8366200 CAGCCTCAGGAGTGGGCTTCTGG - Intergenic
1133770057 16:8862677-8862699 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1134112622 16:11524665-11524687 CAGCCTGAGCTGGGGGCCGAGGG - Intergenic
1134606522 16:15575670-15575692 GTGCCTGAGCATAGGGGCTCAGG + Intronic
1134830969 16:17322574-17322596 CAGCATGTGCAGAGGTCCTGAGG - Intronic
1135188567 16:20335815-20335837 CAGCTTGGGCAAAGGGCCTGTGG - Intronic
1136373536 16:29850806-29850828 CAGCATGAGAAGTGGGCCTTAGG - Intergenic
1137462917 16:48681856-48681878 AAGCCTGAGGAGAGGGGCTGTGG + Intergenic
1137706853 16:50541380-50541402 CAGCATGTGCAAAGGGCCTGAGG - Intergenic
1137753065 16:50880741-50880763 CAGCCTGAGCAAGGGCCCTGGGG + Intergenic
1138073208 16:54014474-54014496 CAGCTTCTGCTGAGGGCCTCAGG - Intronic
1138239349 16:55414410-55414432 CAGCCAGTGCAGATGGCCTGAGG + Intronic
1138573697 16:57892744-57892766 CAGCATGTGCAGAGGCCCTGGGG - Intronic
1138604947 16:58082617-58082639 CAGCCTGAGCAAAGGGCCTGAGG - Intergenic
1138605556 16:58086187-58086209 CAGGCTGCTCAGAGGGACTCAGG - Intergenic
1138606663 16:58094230-58094252 CAGCATGTGCAGAGGCCCTGGGG - Intergenic
1138747565 16:59381197-59381219 ATGCCTGAGCAGAAGGTCTCTGG - Intergenic
1140097110 16:71884284-71884306 GGGCCTGAGGAGAGGGGCTCTGG + Intronic
1140625157 16:76784699-76784721 CAGCTTGTGCTGAGGGCCTCTGG + Intergenic
1140663362 16:77208593-77208615 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1140891657 16:79290136-79290158 CAGGCTGAGCACAGTGGCTCAGG - Intergenic
1141376439 16:83535183-83535205 CAGCATGTGCAGAGGCCCTGGGG + Intronic
1141447530 16:84071306-84071328 AAGCGTGAGCAGAGGCCATCTGG + Intronic
1141473680 16:84257419-84257441 CAGCATGAGCAGAGATCCACGGG - Intergenic
1142353720 16:89591354-89591376 CAGCCAGCGCAGAGGCCCCCAGG + Intronic
1142884250 17:2903069-2903091 TGGGCTTAGCAGAGGGCCTCTGG - Intronic
1143094000 17:4467050-4467072 CAGCCTGTGCGGAGGCCCTGAGG + Intronic
1143777710 17:9210192-9210214 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1144583395 17:16473267-16473289 AAGCCTGAGCAGTGTGCCTCGGG - Intronic
1144807802 17:17979169-17979191 CAGCCAGTGCAAAGGGCCTGGGG + Intronic
1145993100 17:29090940-29090962 AAGACAGATCAGAGGGCCTCAGG + Intronic
1146173803 17:30652005-30652027 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146282674 17:31555174-31555196 CAGCCTGGGTAGGGAGCCTCAGG + Intergenic
1146347259 17:32068026-32068048 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1146442336 17:32908014-32908036 AAGCCTGAGCAAAGGCCCTGAGG + Intergenic
1146690910 17:34875466-34875488 CAGCCAGAGCAGAGCCCCACAGG - Intergenic
1147876931 17:43628414-43628436 AAGTCTGAGCAGAGAGTCTCTGG - Intergenic
1149995377 17:61403567-61403589 GAGCCTGGGCAGATTGCCTCGGG - Intronic
1150429257 17:65102192-65102214 CCCCCTGAGCAGAGAGGCTCGGG - Intergenic
1151552034 17:74827865-74827887 CAGCCTGAGCAGAGAACCACTGG - Intronic
1151846503 17:76659617-76659639 CTGTCTGAGAAGAGGGCCTCAGG - Intergenic
1151893143 17:76963033-76963055 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1152698452 17:81807531-81807553 CAGCTGGAGCAGAGGGTTTCCGG - Intronic
1153280787 18:3412100-3412122 CAGCCTTCGCCGAGGGCCGCAGG + Intronic
1155232047 18:23783490-23783512 TGGCCTGAGCAGAGGTCCTGAGG + Intronic
1155334068 18:24747142-24747164 CAGCCTGTGCAGAGGTTCTGAGG - Intergenic
1156450872 18:37265967-37265989 CTGAGTGAGCAGAGGGCCTGGGG - Intronic
1157937624 18:51890891-51890913 CAGCCTGGGAAGAGGGCCAGAGG - Intergenic
1158648726 18:59268799-59268821 AGGCCTGAGGAGAGGCCCTCTGG - Exonic
1160190015 18:76708163-76708185 CTTCCTGAGCAGAGCGCGTCAGG - Intergenic
1160654963 19:261215-261237 CGGGCTGAGCATAGGGCCTAAGG - Intergenic
1160752038 19:738913-738935 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1161041552 19:2113232-2113254 CCGCGAGAGCACAGGGCCTCAGG + Intronic
1161258915 19:3324807-3324829 CAGCCTGTGCAAAGGCCCTGGGG - Intergenic
1161330144 19:3683014-3683036 CAGCCTGTGCGGAGGCCCTAGGG - Intronic
1161397640 19:4052851-4052873 CAGCCAGTGCAGAGGCCCTGAGG - Intronic
1161482744 19:4518943-4518965 CAGCCCGTGCAGAGGCCCTAAGG - Intergenic
1161506350 19:4645931-4645953 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1161522252 19:4731111-4731133 CAGCCTGTGCAAAGGCCCTGCGG - Intergenic
1161533840 19:4806583-4806605 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161567650 19:5012523-5012545 GAGCCTGAGGAGAGGGCCATGGG - Intronic
1161571484 19:5033067-5033089 CAGCCTGCGCCGCGGGCCTGCGG + Intronic
1161605655 19:5213378-5213400 CAGCCTGGGCAGAGGCCCTGGGG - Intronic
1161635308 19:5384970-5384992 CAGCCAGAGCAAAGGCCCTGCGG - Intergenic
1161650343 19:5480478-5480500 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161658828 19:5533442-5533464 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1161664236 19:5565220-5565242 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1162050027 19:8027504-8027526 CAGGGTGCGCAGAGGACCTCAGG + Intronic
1162101883 19:8343638-8343660 CAGCATGTGCAGAGGCCCTGCGG - Intronic
1162156367 19:8680856-8680878 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1162400655 19:10444631-10444653 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162449805 19:10747949-10747971 CAGCCTGGGCAAAGGCCCTGGGG + Intronic
1162490519 19:10988585-10988607 CAGCCTGTGCAAAGGTCCTGGGG - Intronic
1162787253 19:13043509-13043531 CAGACTGCGCAGCTGGCCTCAGG - Intronic
1162829986 19:13278359-13278381 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1162850981 19:13430950-13430972 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1162988613 19:14288035-14288057 CAGCCTGTGCAAAGGCCCTGAGG + Intergenic
1163174069 19:15551984-15552006 CCGTATGAGCTGAGGGCCTCAGG - Exonic
1163633282 19:18427618-18427640 CAGGGTGGGCAGAGGGCCCCAGG - Intronic
1163770179 19:19186274-19186296 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1164580538 19:29432525-29432547 CCACCTTAGCAGAGGCCCTCAGG - Intergenic
1165323891 19:35102872-35102894 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1165723052 19:38093288-38093310 CAGCCAGTGCAGAGGTCCTGAGG + Intronic
1166333235 19:42090694-42090716 CAGCCTGGGCAGATGGGCTGGGG - Exonic
1167004461 19:46766649-46766671 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167562226 19:50232784-50232806 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
1167631182 19:50627189-50627211 CAGCCTGGGCAGATGCCCTGAGG - Intronic
1167762656 19:51459065-51459087 AGGCCTGAGCAGAGGGACACGGG + Intergenic
1168014271 19:53558700-53558722 CAGCCTCAGAAGCAGGCCTCGGG - Intronic
1168598290 19:57696556-57696578 CAGAGGGAGCAGAGGGCCTGGGG + Intronic
1202687654 1_KI270712v1_random:60708-60730 CCGCCTGAGCACAGAGCCACAGG + Intergenic
925923228 2:8652146-8652168 CTGCATATGCAGAGGGCCTCAGG + Intergenic
927672567 2:25081596-25081618 GAGCCTGAGCAGTGGCCCGCAGG + Intronic
928063265 2:28136403-28136425 CAGCCTGGCCAGAGGGGCTGTGG - Intronic
928167029 2:28979156-28979178 CAACCTGAGCCCCGGGCCTCTGG - Intronic
929005925 2:37392651-37392673 CAGCCTGTGCAAAGGTCCTGAGG - Intergenic
929485564 2:42350910-42350932 CAGTCTGTGCTGAGGACCTCAGG - Exonic
929821114 2:45274487-45274509 CAGCCTCAGCAGAGAGCCTCCGG - Intergenic
933386954 2:81622872-81622894 CAGCCTGGGCACAGAGGCTCCGG + Intergenic
933732577 2:85468692-85468714 GAGCCAGAGGAGAGGGCCTGAGG - Intergenic
933846977 2:86334716-86334738 CAGCCTGAGCAGATGGGCTCTGG - Intronic
933943669 2:87266236-87266258 CAGCCAGGGCAGAGGCCCTGAGG + Intergenic
934156137 2:89202940-89202962 GGGCCTGAGAAGAGGGACTCAGG + Intergenic
934211180 2:89979823-89979845 GGGCCTGAGAAGAGGGACTCAGG - Intergenic
934857169 2:97736729-97736751 CCGCCTGTGCAGAGGCCCTGAGG + Intronic
936174207 2:110204870-110204892 CAGGCTGTGCAGAGGGCCCTGGG - Intronic
936336551 2:111595343-111595365 CAGCCAGGGCAGAGGCCCTGAGG - Intergenic
936525706 2:113240222-113240244 CAGCATGGGGAGAGGGCCTGGGG - Intronic
937271596 2:120656446-120656468 CTCCCTGAGCAGAGGGCCCTGGG - Intergenic
937328260 2:121005207-121005229 CAGCCAGTGCAGAGGCCCTGGGG - Intergenic
937340743 2:121088970-121088992 CAGCCTGCACCGGGGGCCTCTGG - Intergenic
937866621 2:126756407-126756429 CTGCCTGAGCTGAGCTCCTCTGG + Intergenic
942248319 2:174026774-174026796 CAGCCAGAGCAGAGTGACTAAGG - Intergenic
942512416 2:176716723-176716745 CACCCTGAGCACATGTCCTCAGG + Intergenic
944599390 2:201288027-201288049 CAGCCTCAGTAGAGGGGCTTGGG - Intergenic
946010160 2:216558069-216558091 TTGCCCCAGCAGAGGGCCTCTGG - Intronic
947361277 2:229347867-229347889 CAGACACAGCAGAGGGCCTAAGG - Intergenic
947581720 2:231323973-231323995 CAGTGTGAGCAGGGGGCCTGGGG - Intronic
948234918 2:236380205-236380227 CGGCCTCAGCAGAGGCGCTCGGG + Intronic
948790956 2:240376587-240376609 CAGCCTGCTCAGAGAGCTTCAGG + Intergenic
1168966805 20:1903677-1903699 CAGCCAGTGCAAAGGCCCTCGGG - Intronic
1169136795 20:3202696-3202718 GAGCCTGAGGAGGGGGCGTCTGG - Intronic
1172006221 20:31820407-31820429 AAGGCTGAGCAGGGAGCCTCAGG + Exonic
1172095667 20:32458905-32458927 CACCCTGAGCAGCGTGTCTCTGG - Intronic
1172110811 20:32543953-32543975 CAGCCTGTGCAAAGGTCTTCAGG + Intronic
1172167975 20:32910460-32910482 GGGAGTGAGCAGAGGGCCTCAGG - Intronic
1172390982 20:34565085-34565107 CAGACTGGGCAAAGGGGCTCTGG - Intronic
1172807416 20:37622453-37622475 CAGCATGAGCAAAGGTCCTGAGG + Intergenic
1173441206 20:43077842-43077864 CAGCATGAGCAAAGGTCCTGAGG - Intronic
1173664831 20:44756188-44756210 CTGCCGGAGCAGGGGGCCTGTGG + Exonic
1173861607 20:46287518-46287540 CAGCCTGGGTAGAGGCCCTGAGG + Intronic
1174528580 20:51193032-51193054 CAGCCAGTGCAGAGGTCCTGAGG - Intergenic
1174592752 20:51659056-51659078 CAGCAAGTGCAGAGGCCCTCAGG - Intronic
1174824712 20:53758838-53758860 CTGCCTGAGCAGAGACCCTAAGG + Intergenic
1175146569 20:56900981-56901003 CAGCATGTGCAAAGGGCCTAGGG + Intergenic
1175390576 20:58624867-58624889 CAGCCCGAGCCGAGGCCCTGGGG + Intergenic
1175892169 20:62320763-62320785 CAGCCTGTGCAGACGGGCCCAGG + Exonic
1176305307 21:5120127-5120149 CTGCCTGCGCAGAGGGCGGCAGG - Intronic
1176448245 21:6840398-6840420 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1176826415 21:13705420-13705442 CAGCCTGAGCAGCGGGCACTTGG - Intergenic
1178351537 21:31875175-31875197 CAGGCTGGGCAGAGGCCCCCAGG - Intronic
1178914075 21:36697416-36697438 CGGCTTGAGCAGAGGGCCATGGG - Intergenic
1179157266 21:38861522-38861544 CAGCCGGAGAAGACGGCCCCAGG - Intergenic
1179272926 21:39865662-39865684 CAGGCTGTGCAGAGGGCATGTGG - Intergenic
1179553242 21:42156595-42156617 CAGCCAGAGCTGGGGGTCTCAGG - Intergenic
1179610075 21:42544660-42544682 CAGCCTGAGCAGGGGCCTCCTGG + Intronic
1179851748 21:44141904-44141926 CTGCCTGCGCAGAGGGCGGCAGG + Intronic
1179935754 21:44602503-44602525 CAGCCCGGCCAGCGGGCCTCAGG - Intronic
1179961216 21:44767877-44767899 CAGCCCGGCCAGCGGGCCTCAGG - Intergenic
1180094985 21:45552292-45552314 CAGCCTGAGCAGCAGGGGTCAGG + Intergenic
1180133916 21:45848184-45848206 CAGCCTGACCATCGGGACTCAGG + Intronic
1180151054 21:45948116-45948138 CAGCCTCAGGAGAGGGGCTAGGG - Intergenic
1181086441 22:20441725-20441747 CAGCCTGGGCAGGGGGGCTGAGG - Exonic
1181134118 22:20752203-20752225 CTTCCTGAGCAGTGGGCCACTGG - Intronic
1181350246 22:22250126-22250148 CCGCCTGAGCACAGAGCCACAGG + Intergenic
1182275979 22:29188942-29188964 CTGTCTGAGCAGAGGCCCTGAGG + Intergenic
1183243207 22:36673676-36673698 GAGCCAGAGCAGAGGACCGCAGG + Intronic
1183334868 22:37240843-37240865 CAGCTTGAGCAAAGGCCCTGGGG + Intronic
1183423023 22:37723342-37723364 CAGCCTGAGCAGTGTCCCTTTGG - Exonic
1183668058 22:39256463-39256485 CAGCCTCAGCAGAGGCCCCGGGG + Intergenic
1184416013 22:44352251-44352273 CTCCCTGACCAGAGAGCCTCTGG - Intergenic
1184550841 22:45203401-45203423 CAGGCTGAGGACAGGGCCCCAGG + Intronic
1184828027 22:46966209-46966231 AAGCATGAGCACAGGGCCACTGG - Intronic
1185208069 22:49551569-49551591 CAGCTTCAGCACAGGCCCTCGGG + Intronic
1185298778 22:50068245-50068267 CAGCCTGGCCCCAGGGCCTCGGG - Intronic
950147973 3:10665262-10665284 CAGCCTGTGCAAAGGGCCTGTGG - Intronic
950263862 3:11560861-11560883 CTGCCTGTGGACAGGGCCTCGGG + Intronic
950533872 3:13568509-13568531 CAGCCTGCTGTGAGGGCCTCTGG - Intronic
950659840 3:14460507-14460529 CAGCCTGTGCAAAGGCCCTGAGG + Intronic
950764313 3:15262010-15262032 GAGCCTGAGCAGGGGGGCTCTGG + Intronic
952861944 3:37820229-37820251 CAGCCTGATCAGGGGAACTCCGG + Exonic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
953492017 3:43360633-43360655 CAGCCTGAGGAGTGGGCTCCAGG - Intronic
953976353 3:47384507-47384529 CAGCCTGAGGAGGGGCCATCAGG + Intronic
954008645 3:47614996-47615018 CAGCCAGTGCAGAGGCCCTGAGG - Intronic
954682954 3:52355732-52355754 CAGCGTGAGCAGAGGGGGACTGG - Intronic
954696204 3:52428342-52428364 CAGCCAGAGAAGAAGGCCTGTGG - Intergenic
955133245 3:56191093-56191115 CAACCTGAGCAGAAGGGCACAGG + Intronic
955540741 3:59973419-59973441 CAGCATGTGCAGAGGGCCTGTGG - Intronic
956878586 3:73488439-73488461 CAGCCTGTGCAGAGACCCTGTGG - Intronic
957785323 3:84875039-84875061 CAGCGTGAACAGAGGGCCTATGG - Intergenic
958892509 3:99796049-99796071 CAGCCTGTTCTGAGGGCATCTGG - Exonic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
961107532 3:124254902-124254924 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
961450772 3:127001392-127001414 CAGCCTGAGCTGATGGACCCTGG - Intronic
961490495 3:127253920-127253942 CAGCCTGTGCAGAGACCCTGAGG - Intergenic
961819953 3:129570976-129570998 CAGCCTCAGCTGTGGGCCTCGGG - Intronic
962317288 3:134366873-134366895 CAGTTTTAGCAGATGGCCTCAGG - Intronic
964679203 3:159318631-159318653 CAGCCTGCACTGATGGCCTCAGG - Intronic
965226726 3:166000477-166000499 CAGCCTGCACCGATGGCCTCAGG - Intergenic
966720291 3:183055613-183055635 CAGGCTGAGCACAGTGGCTCGGG + Intronic
967037201 3:185656792-185656814 CAGCCTGAGCATAGCAACTCAGG - Intronic
967254179 3:187572968-187572990 CAGCCTCAGCTGAGAACCTCCGG + Intergenic
967732597 3:192919562-192919584 CAGCTTGAGGGGAGGGTCTCCGG - Intergenic
967825015 3:193870612-193870634 CAGCCTGGGCCCCGGGCCTCAGG + Intergenic
968140343 3:196250977-196250999 CAGCCTCAGCATAGGGTATCTGG - Intronic
968451048 4:676188-676210 CCGCCAGGGCAGACGGCCTCAGG + Intronic
968506881 4:974811-974833 AAGCCGGAGCAGAGGCCCTGTGG + Intronic
968577839 4:1376217-1376239 CAGCCTGAGGAGGGGGCTGCCGG + Intronic
969457736 4:7309780-7309802 CAGGCTGGGGAGAGGGCCTGAGG + Intronic
969462547 4:7336386-7336408 CAGCCGGGGCCAAGGGCCTCCGG - Intronic
969480485 4:7444488-7444510 CAGCCTGTGCAAAGGTCCTGTGG + Intronic
969841555 4:9886771-9886793 CAGACTGAGAAGGGGGGCTCAGG - Intronic
970163137 4:13209383-13209405 CTGCCTGCCCAGTGGGCCTCAGG - Intergenic
970249888 4:14102999-14103021 CAGGCTGAGCAGAGTCCCTGAGG + Intergenic
972201271 4:36716902-36716924 CAGCCTGCACCGATGGCCTCAGG - Intergenic
973855397 4:55006067-55006089 CAGCCTGAGCAAAGGCCCTGAGG + Intergenic
974644579 4:64674482-64674504 CAGCCTGAACTGACGGCTTCGGG - Intergenic
975209298 4:71680243-71680265 CAGCATGAGGAGAGGGCATCAGG + Intergenic
979316635 4:119272681-119272703 CAGCCTGGGCATAGTGGCTCAGG - Intronic
980988632 4:139719024-139719046 CATGCTGGGCAGAGGGGCTCTGG + Exonic
982167546 4:152628486-152628508 CAGCCTCAGCAGACTCCCTCAGG + Exonic
985164024 4:187073962-187073984 CAGCCTGCACAGAGGCCATCTGG - Intergenic
985661581 5:1159904-1159926 CAGCCAGGTCAGAGGGACTCAGG + Intergenic
986771887 5:10981629-10981651 AGGCGTGAGGAGAGGGCCTCAGG + Intronic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
991929466 5:71738207-71738229 CAGCCTGAGCAGTGGGGTTTGGG - Intergenic
995198672 5:109401311-109401333 CAGCCTGGGCACAGTGGCTCAGG + Intronic
995460587 5:112399214-112399236 CAACCTGAGCAAAGGTCCTGAGG - Intronic
997215930 5:132110687-132110709 AAGTCTGGGCAGAGAGCCTCAGG - Intergenic
997463262 5:134070093-134070115 CAGACAGAGCAGAGGGCTGCTGG - Intergenic
997696801 5:135867475-135867497 GAGCCTCAGCAGATAGCCTCAGG - Intronic
998522739 5:142815661-142815683 CAGCCTGTGCAAAGGCCCTGTGG - Intronic
998952240 5:147404015-147404037 CAGCCTCAGCAGAGGGCATGAGG + Intronic
999053535 5:148549463-148549485 CAGCCTGGGATGAGAGCCTCTGG - Intronic
999230356 5:150058112-150058134 CAGCCTAAGCTGAGGCCCACTGG + Intronic
999291299 5:150428181-150428203 CAGCCAGAGCAGAGGTCCCATGG + Intergenic
999323911 5:150631428-150631450 CAGCCAGTGCAGAGGCCCTGAGG + Intronic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1001282065 5:170393228-170393250 CAGACTGAGCTGAGGGTGTCTGG - Intronic
1001315325 5:170637590-170637612 CAGCCTGAGCAAAGGCCTTGAGG - Intronic
1001596005 5:172899144-172899166 CAGCAGGTGCAAAGGGCCTCAGG + Intronic
1001596548 5:172902375-172902397 CAGGCTGGGTAGAGGGCCCCAGG + Intronic
1001597001 5:172904904-172904926 CAGCCTGGCCAGAGCGCCTCAGG + Intronic
1001654982 5:173342393-173342415 CAGGCTGAGCAGTGGGCTTGAGG + Intergenic
1001946491 5:175782825-175782847 CAGCCTGTGGAGAGGTCCACAGG + Intergenic
1002096645 5:176835160-176835182 CAGCCTGGGAATGGGGCCTCCGG + Intronic
1002183267 5:177442279-177442301 CAGCCTGAGCCCAGGGCAGCAGG - Exonic
1003460619 6:6324657-6324679 CACCCTGAGCACTGAGCCTCTGG - Intergenic
1006000752 6:30963215-30963237 CAGCTTGAGCAGAGACACTCTGG - Intergenic
1006427796 6:33976968-33976990 CAGCCAGTGCAGAGGCCCTGAGG - Intergenic
1006913303 6:37578304-37578326 CAGCCGGAGCAAAGGCCCTGGGG + Intergenic
1007193446 6:40039266-40039288 CAGCCTGATCAGAAGGACTCAGG + Intergenic
1007293911 6:40806694-40806716 CAGGCTGCACAGAGGGCCTGGGG + Intergenic
1007513336 6:42391527-42391549 CAGTCTCAGCAGATGGCCTCAGG + Intronic
1007736114 6:43983307-43983329 CACTGTGAGCAGAGGGACTCAGG - Intergenic
1011154952 6:84320475-84320497 CAGCCAGTGCAAAGGCCCTCAGG + Intergenic
1011554918 6:88564147-88564169 CAGCCGGAGCAAAGGCCCTGAGG - Intergenic
1012205184 6:96452540-96452562 CAGGCTGGGAAGTGGGCCTCTGG - Intergenic
1012528545 6:100206416-100206438 CCTCCAGAGCAGAGGGGCTCTGG - Intergenic
1013343206 6:109235788-109235810 CAGCCTGTGCAAAGGACCTGTGG + Intergenic
1014099016 6:117489165-117489187 CAGCCTCTGGTGAGGGCCTCAGG + Intronic
1016097914 6:140060798-140060820 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1017697274 6:157029675-157029697 CAGCCAGTGCAAAGGCCCTCAGG + Intronic
1018057757 6:160067209-160067231 CAGCATGAGCAAAGGGCCCGAGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018582535 6:165319498-165319520 GGGCCTGAGCACAGGGGCTCAGG - Intergenic
1018773985 6:166998079-166998101 GCGCCTGAGCCGAGGGCTTCAGG + Intergenic
1019022314 6:168929647-168929669 CTGCCTGAGCTGAGGGTCTGTGG + Intergenic
1019023306 6:168937322-168937344 CCACCTGAGCAGCTGGCCTCCGG + Intergenic
1019556774 7:1635662-1635684 CAGCCTATGGAGAGGGCCACAGG - Intergenic
1020087508 7:5319214-5319236 CAGCCTGAGTAGAGGATCTCAGG - Intronic
1020697811 7:11437127-11437149 CAGCCTGGCCTGAGGGGCTCTGG + Intronic
1021825283 7:24544774-24544796 CAGCCGCAGCAGAGGGGCTGAGG + Intergenic
1022652143 7:32287331-32287353 CAGCCTGTGCAGAGGCCCTGTGG - Intronic
1022895312 7:34744652-34744674 CATCATGAGCAGAAGGCCTTGGG - Intronic
1023052750 7:36267438-36267460 CAGCATGTGCAAAGGGCCTGTGG - Intronic
1023362468 7:39430806-39430828 CAGCCTGAGCTGAAAGCCTGTGG - Intronic
1025206803 7:56997951-56997973 CAGCCTGAGTAGAGGATCTCAGG + Intergenic
1025255140 7:57379573-57379595 CAGCCTGTGCAAAGGGCCTGTGG + Intergenic
1025665137 7:63578976-63578998 CAGCCTGAGTAGAGGATCTCAGG - Intergenic
1026633383 7:72058662-72058684 CACCCTGGGCAGAGGGCCAAGGG + Intronic
1029359181 7:100075824-100075846 CTGCCTGAGCAGATGGCCACAGG + Intronic
1031977383 7:128102667-128102689 CTGCCTGAGGAGAGGGGCTGGGG + Intergenic
1032708343 7:134441458-134441480 CAGCCTGTGCAGTGGGGCTCTGG + Intergenic
1033366078 7:140673305-140673327 CCGCCTGGGCCGCGGGCCTCGGG + Exonic
1034168443 7:149043635-149043657 CAGCCTGAGCTGAGGACTACAGG - Intergenic
1034454548 7:151160050-151160072 CATCCTGAGCGAAGGGCCTGGGG - Intronic
1035661701 8:1352887-1352909 GAGCCTGAGAATGGGGCCTCCGG + Intergenic
1036552335 8:9826559-9826581 CAGCCTGAGCGGAGAACCACTGG + Intergenic
1036936182 8:13004507-13004529 GGGCCTGAACAGACGGCCTCAGG - Intronic
1039483443 8:37892852-37892874 CAGCCTGTGCAAAGGCCCTGAGG - Intronic
1039870885 8:41544158-41544180 CAGCCTGTGCAAAGGCCCTGAGG + Exonic
1039890295 8:41681432-41681454 TGGCCAGAGCAGAGGGGCTCAGG - Intronic
1040558938 8:48506513-48506535 CGCCCTGAGCTGAGGGCCCCGGG + Intergenic
1040745262 8:50634356-50634378 AAGTCTCAGCAGAGGGCATCCGG - Intronic
1041642591 8:60219057-60219079 CAGCCTCAGGAAAGTGCCTCAGG + Intronic
1041731802 8:61070156-61070178 AACCCTGAGGACAGGGCCTCAGG - Intronic
1041794759 8:61735725-61735747 CAGGCTGAGAAGTGTGCCTCAGG + Intergenic
1045060871 8:98409821-98409843 CAGCCTGGCCAGAAGGCATCTGG - Intronic
1045546849 8:103137300-103137322 CAGCCAGAGCTGGGGGCCTGTGG - Intronic
1046805956 8:118479235-118479257 CAGCCAGTGCAGAGGTCCTGAGG - Intronic
1048304512 8:133274192-133274214 CTGCCAGAGCAGATGGCATCAGG - Intronic
1048793727 8:138129240-138129262 CAGAATGAGCAGAGGGCTTCAGG - Intergenic
1049425090 8:142534380-142534402 CAGAGTGAACAGAGGGGCTCTGG + Intronic
1049558806 8:143297164-143297186 CTGCATGAGATGAGGGCCTCGGG + Exonic
1049709533 8:144057374-144057396 CAGCCTGAGCAGGAGGCCTGGGG + Intronic
1050173896 9:2850523-2850545 CCTCCTGAGCAGAGGGCCATAGG - Intergenic
1051442230 9:17097830-17097852 CAGCCTCTCAAGAGGGCCTCAGG + Intergenic
1052569114 9:30198614-30198636 CATGCTGAGCGGATGGCCTCTGG + Intergenic
1053005819 9:34603780-34603802 GGGTCTGTGCAGAGGGCCTCAGG - Intergenic
1056847440 9:90053175-90053197 CAGCCTAAGCTGAGGACCACAGG - Intergenic
1057184295 9:93048212-93048234 CTGCATGAGCAGAGGGGCTTTGG + Intergenic
1057222360 9:93264084-93264106 GGGCCTGAGCAGAGCGCCACAGG + Intronic
1057277433 9:93683552-93683574 CAGCCTGTGCCAAGGCCCTCAGG + Intergenic
1057585507 9:96324973-96324995 TAGCCAGAGCAGAGGACCTCTGG + Intronic
1057995834 9:99821355-99821377 CAGCCGGTGCAGAAGGCGTCTGG - Intergenic
1058802403 9:108557554-108557576 CAGCCTTAGCAGAGGTGCCCTGG - Intergenic
1059749445 9:117234226-117234248 CAGCCTGAAAAGGGAGCCTCAGG + Intronic
1060145248 9:121247231-121247253 CAGCCAGACCAGAGGTGCTCAGG + Intronic
1060765436 9:126292178-126292200 CAGCCTGTGCAAAGGCCCTGAGG - Intergenic
1060936172 9:127517435-127517457 CAGCCTGTGCAAAGGCCCTGGGG - Intronic
1061750066 9:132770971-132770993 CTGGCTGAGCAGGGGGCCTCAGG + Intronic
1061791859 9:133063277-133063299 GAGACTGGCCAGAGGGCCTCAGG - Intronic
1062393827 9:136344718-136344740 CAGCCTGTGCAAAGGGCCTGAGG + Intronic
1203520946 Un_GL000213v1:44120-44142 CAGCCTGAGCAGCGGGCACTTGG + Intergenic
1189494591 X:41497780-41497802 CAGGCTGTGCAGGAGGCCTCAGG + Intergenic
1190262570 X:48806634-48806656 CAGCCTGAGGACAGAGCCTGAGG - Exonic
1190301841 X:49061646-49061668 CAGCCTGGGCAAAGGCCCTGAGG + Intronic
1192264636 X:69530125-69530147 CAGAATGGCCAGAGGGCCTCAGG + Exonic
1195343838 X:103928845-103928867 CATCCTGGGCAGAGGCCCACAGG - Intronic
1195363148 X:104104486-104104508 CATCCTGGGCAGAGGCCCACAGG + Exonic
1197980860 X:132217499-132217521 CAGCCCGAGCAGGGGGCGTGGGG + Exonic
1198226844 X:134653166-134653188 AGGCCTGAGGAGAGGGCCTGGGG - Intronic