ID: 1086420574

View in Genome Browser
Species Human (GRCh38)
Location 11:86633676-86633698
Sequence ATGCTGTTCTATAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086420569_1086420574 2 Left 1086420569 11:86633651-86633673 CCAGGTTGCTCTCAAACCCAAAT 0: 1
1: 0
2: 3
3: 17
4: 279
Right 1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG 0: 1
1: 0
2: 0
3: 11
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086420574 Original CRISPR ATGCTGTTCTATAGGCCAGA GGG Intronic
903451502 1:23456649-23456671 ATGCTGAGCAAAAGGCCAGAGGG + Intronic
903915115 1:26758116-26758138 ATGCTGTTTTAGGGACCAGAAGG - Intronic
907217870 1:52881456-52881478 ATGTTGTTCTACAGGTCAGATGG - Exonic
908964444 1:69741070-69741092 ATGTTGTTCTACAGGCTAGTGGG + Intronic
909947598 1:81681058-81681080 GCTCTGTTCTATAGGCCAAAGGG - Intronic
911039428 1:93579985-93580007 CTGCTGTACTTTTGGCCAGATGG - Intronic
915685898 1:157633697-157633719 ATTCTGTTCTATTGGACAGGAGG + Intergenic
918184518 1:182115036-182115058 GTGCTGTCCTATAGACCATAAGG + Intergenic
921423551 1:214976513-214976535 ATGCTGTTCTAGAAGCAAGGAGG - Intergenic
923016172 1:230128177-230128199 AGGCTATGCTATAGGACAGATGG - Intronic
924070296 1:240270909-240270931 ATGCTGTGCAATAGACCAGCAGG - Intronic
924175529 1:241387697-241387719 ATCATGTTCTCTATGCCAGAGGG + Intergenic
1063765291 10:9133141-9133163 GTTCTGTTGCATAGGCCAGAAGG + Intergenic
1068027076 10:51659412-51659434 ATGCTGTTCTCCCAGCCAGATGG - Intronic
1068048591 10:51919178-51919200 ATGCAGTTCCTTAGGCCAGGGGG + Intronic
1074787584 10:116854616-116854638 ATGGTGTTCTAGAGACCAGTTGG + Intronic
1075672653 10:124273067-124273089 AGGCTGTTCCATGGCCCAGAGGG + Intergenic
1075725595 10:124609209-124609231 TTGCTATTGTGTAGGCCAGAGGG - Intronic
1075829091 10:125389518-125389540 ATGCTGTCCCATAGGCCACTGGG + Intergenic
1078276417 11:9852101-9852123 GTTCTGTTATATAGGCAAGAGGG + Intronic
1079747780 11:24155171-24155193 ATGTGGTTCTGTAGACCAGAGGG - Intergenic
1080679826 11:34464155-34464177 ATGCTGTGCTCCAGGGCAGAAGG - Exonic
1083395643 11:62389882-62389904 AAGCTGCTCTTTAGGGCAGATGG - Intronic
1084643189 11:70438010-70438032 AGGCTGTTCTTCAGGCCAGAGGG - Intergenic
1085878340 11:80435923-80435945 GTTTTGTTCTATAGCCCAGATGG + Intergenic
1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG + Intronic
1087721371 11:101669620-101669642 GTGGTGTTCTAGAGGCAAGAAGG - Intronic
1093651508 12:21651032-21651054 ATGTTCTTCTCTAGGCCACAGGG - Intronic
1096321799 12:50620714-50620736 TTTTTGTTCTATATGCCAGATGG + Intronic
1097888385 12:64753111-64753133 CTTCTGTTCTATAGGGCGGAAGG - Intronic
1099399866 12:82190339-82190361 ATGCTGTCCTTTAGACCAAATGG + Intergenic
1106284076 13:28303763-28303785 TTGCAGTTCTGGAGGCCAGAAGG - Intronic
1106803761 13:33285002-33285024 ATTCTGTTCTAAAGGCCACCAGG - Intronic
1107458623 13:40578959-40578981 ATGCTGATCTAATGGCAAGACGG + Intronic
1108863870 13:54898011-54898033 ATGCTATTTAACAGGCCAGATGG + Intergenic
1111865387 13:93761933-93761955 CTGGTGTTCTATTGGACAGATGG - Intronic
1113164462 13:107423016-107423038 TTACAGTTCTAGAGGCCAGAAGG - Intronic
1115051175 14:29065255-29065277 ATGATGTTTAATAGGCCAGCTGG - Intergenic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1116222910 14:42111642-42111664 AGACTGTTATATAGGCCAGCAGG + Intergenic
1120765733 14:88325171-88325193 ATTCTGTTCTCAAGTCCAGAGGG + Intronic
1120787172 14:88548507-88548529 AGGGTGTGCTATAGGCCAGAGGG - Intronic
1120950465 14:90036318-90036340 ATGCCTTTCTATAGTCCATATGG - Intronic
1125511648 15:40295366-40295388 AGGCATCTCTATAGGCCAGAGGG - Intronic
1126745353 15:51820415-51820437 AATCTGCTCTATAGGCCAAATGG + Intergenic
1132356510 15:101174806-101174828 GTGCTGTTCTTTTGCCCAGAGGG - Intergenic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1136650719 16:31667865-31667887 TTGGTGTTCCATAGGCCACAAGG - Intergenic
1137706622 16:50539892-50539914 ATGCTTTGCTGTAGGCCTGAAGG - Intergenic
1138005113 16:53327435-53327457 ATGATGTTCTATAGAGCAAATGG + Exonic
1139078563 16:63485263-63485285 ATGCTGACATATAGACCAGACGG + Intergenic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141677016 16:85523435-85523457 ACGCTGTTCCATCAGCCAGATGG - Intergenic
1144069769 17:11659391-11659413 TTGGTGTTCCATAGGCCACAAGG - Intronic
1152336097 17:79700994-79701016 ATCTTGTTCTATAGCCCAAAAGG + Intergenic
1157505339 18:48222227-48222249 ATGCTTTCCTAGAGGCAAGAGGG - Intronic
1162252725 19:9459876-9459898 TTGGTGTTCCATAGGCCACAAGG + Intergenic
1164044591 19:21525408-21525430 ATTCTGTTCTCTATGCCAGTGGG - Intronic
1168313879 19:55475429-55475451 ATGCTGTTTCTCAGGCCAGAAGG - Intergenic
1168625619 19:57915706-57915728 AGGCTGTTCTCCAGGCAAGAAGG - Intronic
925188442 2:1865015-1865037 ATGCTGCTCTATGGGCCCCAGGG + Intronic
925656978 2:6159537-6159559 ATGGAGATCTATAGCCCAGAGGG - Intergenic
925752252 2:7099240-7099262 AGGCTCTCCTGTAGGCCAGATGG + Intergenic
927004284 2:18831958-18831980 ATGCTGTGCTATAGCACAGAAGG - Intergenic
932293722 2:70607204-70607226 ATGCTCTTCTTTATGCCACATGG + Intergenic
933058987 2:77711654-77711676 ATGCAGGTCTATAGACAAGATGG - Intergenic
935688059 2:105702986-105703008 AATCTGTCCTATAGGCCAAATGG + Intergenic
938252868 2:129829078-129829100 GTGCTGCTCTGTAGGCGAGAGGG - Intergenic
938751610 2:134336597-134336619 ATGCTGTAATATAGGCCTGTGGG + Intronic
940886398 2:158993085-158993107 ACGCTGTTATAAAGCCCAGAAGG - Intronic
942998934 2:182300052-182300074 ATGCTGTCCTATATGCCCCAAGG + Intronic
943699104 2:190971053-190971075 ATGCTGAGCCATATGCCAGAGGG + Intronic
943728893 2:191281066-191281088 ATACTGTTCTCTAGTGCAGATGG + Intronic
945519348 2:210804386-210804408 ATGATGTTTTATAGGCAAAAGGG + Intergenic
945848916 2:214982117-214982139 TTGCTTTTGTATATGCCAGAGGG + Intronic
947932510 2:233975384-233975406 AGGGTGTTCTCTAGGGCAGAGGG + Intronic
948130970 2:235600399-235600421 ATGGGGGTCTATAGGGCAGAGGG - Intronic
948769143 2:240239205-240239227 TTGATGTTATATATGCCAGAAGG + Intergenic
1170889425 20:20365911-20365933 ATGCTATTCTACAATCCAGATGG + Intergenic
1170998189 20:21386338-21386360 ATTCTGTTCAATATGTCAGAAGG - Intronic
1171522756 20:25787919-25787941 GTGCTGTTCCAAAGACCAGATGG - Intronic
1171554071 20:26067964-26067986 GTGCTGTTCCAAAGACCAGATGG + Intergenic
1174729479 20:52901673-52901695 ATGATGTTCTATGGGTTAGATGG - Intergenic
1175334279 20:58185018-58185040 TTCCCGTTCTAGAGGCCAGAAGG - Intergenic
1175564640 20:59963449-59963471 ATCCTGTTCTATGGGCAATATGG - Intronic
1178283300 21:31303562-31303584 ATGCTGCCCTGTAAGCCAGAAGG - Intronic
1179052720 21:37902383-37902405 ATACTGTTATGTAGGTCAGAGGG - Intronic
1180242083 21:46515942-46515964 AGGAAGTTCTACAGGCCAGAAGG - Intronic
1180884919 22:19235462-19235484 CTGCTGTTCTATACGCAGGAAGG + Intronic
1180889796 22:19278672-19278694 ATGTTGTTGTATAAGCCAGCAGG - Intronic
1184913869 22:47553630-47553652 TCACTGTTCTAGAGGCCAGAAGG - Intergenic
956879169 3:73492702-73492724 CTGCTGTTCCATAGGCCTGTGGG + Intronic
957572068 3:81959691-81959713 ATTCTGCTCTGTAGACCAGAGGG + Intergenic
959605196 3:108234815-108234837 TTGATGTACTAGAGGCCAGATGG - Intergenic
960882472 3:122359007-122359029 TTACAGTTCTGTAGGCCAGATGG - Intergenic
961552390 3:127676801-127676823 AAGCTGTTCTACAGGCCCCAGGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964621047 3:158720469-158720491 ATACAGTTCTGGAGGCCAGAAGG + Intronic
967420553 3:189267805-189267827 ATGTTGTGCTATAGGCTATAAGG - Intronic
967766064 3:193280744-193280766 ATGCTGTTGTTTGGGCCTGAAGG - Intronic
972026237 4:34382031-34382053 ATGCTTTTCATTATGCCAGAAGG - Intergenic
973548644 4:52008136-52008158 AAGCTGTTTGATAGGCTAGATGG + Intronic
974585436 4:63869354-63869376 ATGCTGTTTTGTGGTCCAGATGG + Intergenic
975613821 4:76226575-76226597 TTGGTGTTCCATAGGCCACAAGG + Intronic
982431311 4:155324832-155324854 TTGCAGTTCTGTAGGTCAGAAGG - Intergenic
983273254 4:165588082-165588104 ATGCTGTGCTATTAGCCAAACGG + Intergenic
983960389 4:173746004-173746026 GTGCTGTTCTATATTCCACATGG + Intergenic
987927522 5:24362230-24362252 ATGCTTTTACATAGGCCAGTTGG + Intergenic
988200790 5:28066330-28066352 AAGCTGATGTATAGCCCAGAGGG + Intergenic
991570600 5:68049491-68049513 TTGCTGTTCTCTAATCCAGAGGG + Intergenic
993130547 5:83892639-83892661 ATTATGTGCTATAGACCAGAAGG + Intergenic
994752728 5:103758691-103758713 ATACTTTTCTGTAGGCAAGAGGG + Intergenic
995539328 5:113169155-113169177 TTGCTGTTTTATAGGTAAGATGG + Intronic
999988962 5:157032058-157032080 ATCCTGTTCTATAGTCCCCATGG + Intronic
1000366863 5:160499953-160499975 ATGCTGTCGTAGAGGCCAAAAGG + Intergenic
1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG + Intergenic
1005696752 6:28358937-28358959 TTCCAGTTCTATAGGTCAGAAGG + Intronic
1005915554 6:30347828-30347850 ATGCTTTTGTAGAAGCCAGAGGG - Intergenic
1007807034 6:44458129-44458151 TTGTTGTTCTAAAGGGCAGATGG + Intergenic
1009943343 6:70315492-70315514 ATTCTGTTCTATAGGCAGAAGGG + Intergenic
1013697285 6:112718712-112718734 CTGCTGTTCTATAGCACTGAAGG - Intergenic
1014210016 6:118698924-118698946 ACTCTATTCTATAGGTCAGAGGG + Intronic
1018545881 6:164934743-164934765 CTGCTTTTATAAAGGCCAGAGGG - Intergenic
1020452421 7:8335236-8335258 ATGTTGTCTTATAGGCCAGAGGG + Intergenic
1021536858 7:21715197-21715219 ATCCTGTTGTATAGGATAGAAGG - Intronic
1022306230 7:29149015-29149037 ATGCTGTGCTCTTGGACAGATGG + Intronic
1022377869 7:29831434-29831456 ATGATGTTCTACCAGCCAGATGG + Intronic
1022637457 7:32150395-32150417 ATGCTCCTTCATAGGCCAGAGGG - Intronic
1023086180 7:36571934-36571956 CTGGTGTTCTATAGACCAGTAGG + Intronic
1027692996 7:81371787-81371809 AGCCTGTTCTATATGCCAGAGGG - Intergenic
1028668529 7:93373818-93373840 CTGCTGTTCTATAGCACAGTAGG + Intergenic
1029028847 7:97447733-97447755 ATGAAGTTCTTTAGGGCAGATGG - Intergenic
1032407832 7:131669851-131669873 ATGCTGTTCTACCCACCAGAAGG - Intergenic
1033864003 7:145665506-145665528 ACTCTGTTCTATATCCCAGAAGG - Intergenic
1034180325 7:149132484-149132506 AAGCTGTTCTCTAGGCCGGGCGG - Intronic
1035621248 8:1037025-1037047 TTGCTGTTCTGCTGGCCAGATGG + Intergenic
1035741203 8:1929856-1929878 CTGCTGTTCTCTTGGCCACAGGG + Intronic
1036090635 8:5661320-5661342 CTGCTCTTCAATCGGCCAGACGG + Intergenic
1037494378 8:19424590-19424612 ATCCTGTTCTAGAGCCCACATGG - Intronic
1040695838 8:49997262-49997284 ATGCTCTTGAATAGGCCAGAGGG - Intronic
1041027554 8:53702775-53702797 ATTCTGCACTATAGACCAGATGG - Intergenic
1042869576 8:73386106-73386128 ACACTGTTCCATAGGTCAGAAGG - Intergenic
1043254599 8:78118422-78118444 ATGCTGCTCTACAGTCCAGATGG + Intergenic
1044994030 8:97821805-97821827 TTGGTGTTCCATAGGCCACAAGG + Intronic
1045025194 8:98080369-98080391 ATGCTCTGCTTTAGGCTAGAGGG + Intronic
1045181249 8:99785322-99785344 ATGCTGGTCTAGAGACCAGATGG - Intronic
1048029711 8:130620082-130620104 AGTCTGTGCTATAGGCCAGATGG - Intergenic
1049482114 8:142830766-142830788 ATGAAGTACTCTAGGCCAGATGG - Intergenic
1052067229 9:24036905-24036927 ATGCTGTTTTGTAGACCACAAGG - Intergenic
1052432326 9:28382640-28382662 ATTCAGTTCTATGGGCCACATGG + Intronic
1053417116 9:37953728-37953750 ATGCTGTTCTAGAGTTCAGGAGG - Intronic
1056480828 9:87004024-87004046 ATGTTCTTCTACAGGCCTGAGGG + Intergenic
1060219838 9:121758611-121758633 ATGCTTTCCTATTGGACAGAGGG + Intronic
1186505353 X:10087088-10087110 ATGCTGTGCTAGAGGACAGTTGG - Intronic
1187456212 X:19443431-19443453 CTGCTGTACTATAAGCCTGAGGG - Intronic
1193280100 X:79638317-79638339 ATGCTGCACTATAGACCAAATGG - Intergenic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic