ID: 1086421830

View in Genome Browser
Species Human (GRCh38)
Location 11:86644906-86644928
Sequence GAGGGTGAACAGAAGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2763
Summary {0: 7, 1: 160, 2: 436, 3: 780, 4: 1380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086421820_1086421830 24 Left 1086421820 11:86644859-86644881 CCTGGCTCATCTCACTGGGACTG 0: 72
1: 556
2: 975
3: 1210
4: 932
Right 1086421830 11:86644906-86644928 GAGGGTGAACAGAAGCAGGGTGG 0: 7
1: 160
2: 436
3: 780
4: 1380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086421830 Original CRISPR GAGGGTGAACAGAAGCAGGG TGG Intronic
Too many off-targets to display for this crispr