ID: 1086426420

View in Genome Browser
Species Human (GRCh38)
Location 11:86688350-86688372
Sequence TTCGGGGCCCTCTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086426420_1086426427 26 Left 1086426420 11:86688350-86688372 CCTCCTCCTCAGAGGGCCCCGAA No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426420_1086426426 3 Left 1086426420 11:86688350-86688372 CCTCCTCCTCAGAGGGCCCCGAA No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086426420 Original CRISPR TTCGGGGCCCTCTGAGGAGG AGG (reversed) Intergenic
No off target data available for this crispr