ID: 1086426426

View in Genome Browser
Species Human (GRCh38)
Location 11:86688376-86688398
Sequence TTATTTTTATCTTCAAAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086426419_1086426426 4 Left 1086426419 11:86688349-86688371 CCCTCCTCCTCAGAGGGCCCCGA No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data
1086426418_1086426426 5 Left 1086426418 11:86688348-86688370 CCCCTCCTCCTCAGAGGGCCCCG No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data
1086426422_1086426426 -3 Left 1086426422 11:86688356-86688378 CCTCAGAGGGCCCCGAACTCTTA No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data
1086426420_1086426426 3 Left 1086426420 11:86688350-86688372 CCTCCTCCTCAGAGGGCCCCGAA No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data
1086426421_1086426426 0 Left 1086426421 11:86688353-86688375 CCTCCTCAGAGGGCCCCGAACTC No data
Right 1086426426 11:86688376-86688398 TTATTTTTATCTTCAAAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086426426 Original CRISPR TTATTTTTATCTTCAAAAAG TGG Intergenic
No off target data available for this crispr