ID: 1086426427

View in Genome Browser
Species Human (GRCh38)
Location 11:86688399-86688421
Sequence TGTGAAGCAAAAGCTCATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086426425_1086426427 8 Left 1086426425 11:86688368-86688390 CCGAACTCTTATTTTTATCTTCA No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426418_1086426427 28 Left 1086426418 11:86688348-86688370 CCCCTCCTCCTCAGAGGGCCCCG No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426420_1086426427 26 Left 1086426420 11:86688350-86688372 CCTCCTCCTCAGAGGGCCCCGAA No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426423_1086426427 10 Left 1086426423 11:86688366-86688388 CCCCGAACTCTTATTTTTATCTT No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426419_1086426427 27 Left 1086426419 11:86688349-86688371 CCCTCCTCCTCAGAGGGCCCCGA No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426422_1086426427 20 Left 1086426422 11:86688356-86688378 CCTCAGAGGGCCCCGAACTCTTA No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426421_1086426427 23 Left 1086426421 11:86688353-86688375 CCTCCTCAGAGGGCCCCGAACTC No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data
1086426424_1086426427 9 Left 1086426424 11:86688367-86688389 CCCGAACTCTTATTTTTATCTTC No data
Right 1086426427 11:86688399-86688421 TGTGAAGCAAAAGCTCATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086426427 Original CRISPR TGTGAAGCAAAAGCTCATCT AGG Intergenic
No off target data available for this crispr