ID: 1086430929

View in Genome Browser
Species Human (GRCh38)
Location 11:86736265-86736287
Sequence GAGTCAGATTTGTAACTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086430929_1086430932 8 Left 1086430929 11:86736265-86736287 CCGAGAAGTTACAAATCTGACTC No data
Right 1086430932 11:86736296-86736318 CAACAAAAAGGTAATTATTATGG No data
1086430929_1086430931 -4 Left 1086430929 11:86736265-86736287 CCGAGAAGTTACAAATCTGACTC No data
Right 1086430931 11:86736284-86736306 ACTCTCTGGATTCAACAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086430929 Original CRISPR GAGTCAGATTTGTAACTTCT CGG (reversed) Intergenic
No off target data available for this crispr