ID: 1086433691

View in Genome Browser
Species Human (GRCh38)
Location 11:86760420-86760442
Sequence TCAAATCCAAACTTAGGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086433691_1086433695 -10 Left 1086433691 11:86760420-86760442 CCCGGCCCTAAGTTTGGATTTGA No data
Right 1086433695 11:86760433-86760455 TTGGATTTGAAGAAAAGATGAGG No data
1086433691_1086433696 21 Left 1086433691 11:86760420-86760442 CCCGGCCCTAAGTTTGGATTTGA No data
Right 1086433696 11:86760464-86760486 CAAATAACTATAATTTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086433691 Original CRISPR TCAAATCCAAACTTAGGGCC GGG (reversed) Intergenic
No off target data available for this crispr