ID: 1086436961

View in Genome Browser
Species Human (GRCh38)
Location 11:86791174-86791196
Sequence GACACAGATTTGCCTTCATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 170}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086436959_1086436961 -3 Left 1086436959 11:86791154-86791176 CCTGTGTGGCTTCCTTGTCTGAC 0: 1
1: 0
2: 0
3: 15
4: 159
Right 1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086436961 Original CRISPR GACACAGATTTGCCTTCATC TGG Intronic
907745031 1:57204554-57204576 GACTTAGATTTGGCATCATCTGG + Intronic
909002207 1:70232276-70232298 GACAAAGCTTTAGCTTCATCAGG - Exonic
909295839 1:73947648-73947670 CACACTGATTTTCCTTCTTCTGG - Intergenic
911435610 1:97853875-97853897 GAGACAGATTTGCCTCCACATGG - Intronic
912507667 1:110167220-110167242 GAGACAGCTCTGCCTGCATCAGG + Intronic
912586639 1:110772500-110772522 GAGACAGATTTGCATTCAGAAGG - Intergenic
913355304 1:117914607-117914629 TACAGGGATTTGCCTTCATATGG - Intronic
916066226 1:161137972-161137994 GGCTGAGATTTGCCTTCATTAGG + Intergenic
916811792 1:168312429-168312451 GACACAGAATTTCATTTATCTGG - Intronic
922355142 1:224768296-224768318 CACACACAGTTGCCTTCATTTGG + Intergenic
923667744 1:236013876-236013898 GACCCAACTTTCCCTTCATCTGG + Intronic
924933954 1:248752433-248752455 GAAACACAATCGCCTTCATCTGG + Intronic
1063779826 10:9308968-9308990 GCCATAGTTTTGCCTTAATCAGG - Intergenic
1063795954 10:9514668-9514690 GTCAGAGATTTGGCTTCATTAGG + Intergenic
1064603293 10:17014601-17014623 GACCCAGCTTTGCCTACAGCAGG - Intronic
1064927390 10:20584169-20584191 GACACAAATTTGAAATCATCAGG - Intergenic
1068878075 10:62018826-62018848 GACAAAGATCTGCTTTTATCAGG + Intronic
1071807933 10:89144602-89144624 TTCACAGCTTTGCCATCATCTGG - Intergenic
1071822457 10:89292311-89292333 GGCACTGATTTGTCTTCTTCTGG + Intronic
1073117867 10:101102285-101102307 GATGCAGATTTCTCTTCATCTGG - Intronic
1073594984 10:104790547-104790569 GAGAGAGATTTGTTTTCATCCGG - Intronic
1077765180 11:5151451-5151473 CACACAGATTCGCATTCATGTGG - Exonic
1084629515 11:70338147-70338169 GACACAGCTTTTCATTCATTAGG + Intronic
1086436961 11:86791174-86791196 GACACAGATTTGCCTTCATCTGG + Intronic
1087983767 11:104651288-104651310 GACACAGACTTCCCTTACTCTGG - Intergenic
1089745565 11:120614461-120614483 GAGACAGAGGTGCCTGCATCTGG + Intronic
1094328433 12:29266165-29266187 TACACTGATTTCCTTTCATCGGG - Intronic
1096980779 12:55727420-55727442 GACACAGACTTGACCCCATCCGG + Intronic
1098849371 12:75576918-75576940 GAATCAGATGAGCCTTCATCAGG + Intergenic
1105762765 13:23529071-23529093 GACCCAGCTTTGCCTACAGCAGG + Intergenic
1106093480 13:26620909-26620931 GACACAAAGTTGCCTTTTTCTGG + Intronic
1106636661 13:31535895-31535917 GACACAGGGGTGGCTTCATCAGG - Intergenic
1107458052 13:40573256-40573278 GACACAGATGTGCCCACATCTGG - Intronic
1108574787 13:51781834-51781856 GAAACAGATTTGCATGCATAAGG + Intronic
1110040984 13:70758264-70758286 TACATAGATTTTCCTCCATCAGG + Intergenic
1112895535 13:104295398-104295420 GACTCGGTTTTGCCTTCCTCTGG + Intergenic
1114711915 14:24787339-24787361 GACAGAGATTTGCTTACATGTGG - Intergenic
1115759168 14:36560589-36560611 CACAGAGACTTGTCTTCATCAGG - Intergenic
1116113251 14:40613725-40613747 GTCACACATTTGTCTTCAACTGG - Intergenic
1117025157 14:51611605-51611627 GACACAGATTTGAATTCAGTAGG + Intronic
1119809250 14:77502416-77502438 GAAACAAGTTTGCCTTCATTTGG + Intergenic
1120604328 14:86554411-86554433 GACACAATTCTGCCTTCATTGGG + Intergenic
1123915454 15:25020942-25020964 GAGAAAGACTTGCCATCATCTGG - Intergenic
1125172536 15:36782003-36782025 TACACAGTTTTTCCTTCAACAGG + Intronic
1126963608 15:54026715-54026737 GACACTGATTTGGAATCATCAGG - Intronic
1127491029 15:59463917-59463939 GACACAAAATTACCTTGATCTGG - Intronic
1131871835 15:96771796-96771818 GGCCCAGATTTTCCTTCAGCTGG - Intergenic
1132018570 15:98340280-98340302 GACAGAGATTTGCCTTCTGGTGG + Intergenic
1138392171 16:56677738-56677760 AACACAGCTTTCCCTACATCAGG - Exonic
1139091666 16:63655654-63655676 TACACAGACTTGCCTACATAGGG - Intergenic
1139225289 16:65228592-65228614 GAAACTGATTTTCCTCCATCAGG - Intergenic
1141548508 16:84788388-84788410 GAAACAGATTTGGCTTCAGGAGG - Intergenic
1145224706 17:21118305-21118327 GACACAGAGATGTCTTCAACAGG + Intergenic
1145986994 17:29053646-29053668 GACTCAAATTTGACTCCATCTGG - Intronic
1147027376 17:37599250-37599272 GGAATAGATCTGCCTTCATCTGG - Intronic
1148159400 17:45441510-45441532 GACACAGGTTGGCCTTCAGCTGG + Intronic
1148931082 17:51127874-51127896 CACATAGAGTTGCATTCATCTGG + Intergenic
1150390735 17:64788595-64788617 GACACAGGTTGGCCCTCAGCTGG + Intergenic
1151302288 17:73235939-73235961 GCCAAAGATTTGCCTAAATCAGG + Exonic
1152479288 17:80539168-80539190 GCCACAGCATTGCCTTCAGCTGG - Intergenic
1152828315 17:82481272-82481294 GACACAGATCTGCCTGGCTCTGG - Intronic
1153616521 18:6940142-6940164 GACATAGATTTGCTTTTATTTGG + Intergenic
1153889761 18:9502047-9502069 GTCACAGATTTGCTTTTATGGGG + Intronic
1155449460 18:25948506-25948528 GACACACATTAGCCTACAGCTGG - Intergenic
1156163803 18:34393646-34393668 GATACAGATTTGCTTTCCTGGGG - Intergenic
1157670172 18:49521543-49521565 GATACTGATTTCACTTCATCTGG - Intergenic
1157762772 18:50276396-50276418 CACAGAGAATTGCCTTCAACCGG - Exonic
1161020048 19:2005262-2005284 GACACAGATTCTCCTTCTCCTGG + Intronic
1161133912 19:2608519-2608541 GGCACAGGTGTGCCTGCATCTGG - Intronic
1161297445 19:3527007-3527029 GACACATCGTTGCCGTCATCGGG - Exonic
1162207604 19:9067425-9067447 GGCAGAGAATTGCCTGCATCAGG + Intergenic
1164094939 19:21999723-21999745 GACTCAGAATTGTCTTTATCTGG - Intronic
1164114460 19:22204822-22204844 GACTCAGAATTGTCTTTATCTGG - Intergenic
1164198605 19:22996667-22996689 GACTCAGAATTGTCTTTATCTGG - Intronic
1166052334 19:40267781-40267803 GACACAGCCCTGCCTTCATGAGG + Intronic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
927138191 2:20112635-20112657 GAGACAGATTTGAATTCATACGG - Intergenic
927665972 2:25033153-25033175 GAGACAGAGATGCCTTGATCAGG - Intergenic
929758728 2:44788811-44788833 GAATCAGATGTGCCTGCATCTGG - Intergenic
930377456 2:50585975-50585997 CACACAGATTTTCTTTCTTCTGG + Intronic
933172010 2:79135178-79135200 AGCACAGATGTGCCTTCCTCAGG + Intergenic
933470036 2:82710484-82710506 GAAACAGATTTGCCTTTCTCTGG - Intergenic
935505521 2:103897076-103897098 GGGACAAATTTACCTTCATCTGG - Intergenic
937900368 2:127015380-127015402 CACACAGATTGGCCCGCATCAGG - Intergenic
938225307 2:129610908-129610930 GACACACATATGCCCTCACCCGG + Intergenic
938977815 2:136495936-136495958 GACGCATATTTGACTTCCTCTGG + Intergenic
939507702 2:143069839-143069861 GTCACTGATTTGTCTTTATCAGG + Intergenic
939995795 2:148918322-148918344 GAAACAGGTTTGCCTACATGGGG + Intronic
941124518 2:161569719-161569741 AACAAAGATTTGCCTAAATCAGG - Intronic
941617038 2:167732501-167732523 GGCACAGATTTAACTTCACCTGG + Intergenic
942745108 2:179222780-179222802 GACACAGATTTGCCATCCTAAGG + Intronic
943208805 2:184935645-184935667 GTGACAGAATTGCCTTCATATGG - Intronic
944679063 2:202060102-202060124 TATACTGATTTGCTTTCATCTGG - Intergenic
945017121 2:205530569-205530591 GCCAGAGATTTGCCCTCTTCGGG + Intronic
945883778 2:215353579-215353601 GAGACAGATTTTCATTCATGTGG + Intergenic
946719802 2:222592490-222592512 GAGACAGATTTACTTTCCTCAGG - Intronic
946997150 2:225406510-225406532 GACACAATTCTGCCTTCATTAGG + Intronic
1172084514 20:32370016-32370038 GCCACAGATGTGCCTTAATTAGG + Intronic
1172274771 20:33673638-33673660 GAGACAGCTTTGCCTCCCTCTGG + Intronic
1172980613 20:38938780-38938802 GCTACTGATTTGTCTTCATCTGG + Intronic
1173601418 20:44298138-44298160 GACACAGACCTGCCCTCAGCAGG - Intergenic
1174465011 20:50710608-50710630 GACACAACTTTACCTTTATCTGG - Intergenic
1174776544 20:53347997-53348019 GACACAGATTAGCGGTTATCAGG - Intronic
1175058379 20:56218943-56218965 GACAAAGAGTTGCATTCTTCTGG + Intergenic
1176264191 20:64200158-64200180 GACACGGATGTGCCTACACCTGG + Intronic
1178454922 21:32740094-32740116 GAGGCAGATTTGCCCTCAGCGGG - Intronic
1178699266 21:34819632-34819654 GTCACAGGGATGCCTTCATCTGG + Intronic
1180258577 21:46650924-46650946 GACACACAGTTCCCTACATCTGG - Intronic
1182136312 22:27907156-27907178 GACACAAATTTAACTTCCTCAGG + Intronic
949779638 3:7671455-7671477 GAAACTGATTTGCATTCACCTGG + Intronic
952298219 3:32080421-32080443 GTCACAGATTTTCTGTCATCTGG + Intergenic
952716692 3:36487036-36487058 GACACAGATGAGCCTTCAAATGG + Intronic
955164448 3:56497037-56497059 TAAACAGATATGCCTTCATCCGG + Intergenic
956311648 3:67887520-67887542 GACCCACATTTACCTTTATCTGG - Intergenic
961656048 3:128442405-128442427 GACACTGCTCTGCATTCATCAGG - Intergenic
962915909 3:139903111-139903133 GACATAGATATGACTACATCAGG - Intergenic
963309861 3:143698191-143698213 GACTCAGGTTTGCCATCTTCAGG - Intronic
964461622 3:156937675-156937697 AACACAGATTTTCATTTATCTGG - Intronic
965670752 3:171145402-171145424 CACACAGACTTCCCTTCCTCTGG + Intronic
966094880 3:176188034-176188056 CACACAGATTTTCCTTTCTCAGG + Intergenic
967835707 3:193960686-193960708 GATACAGACTTGCCTTATTCCGG - Intergenic
972084141 4:35192507-35192529 CACACACATTTGTCTTCATGGGG - Intergenic
972292295 4:37700622-37700644 GACAGGGGTTTGCATTCATCAGG + Intergenic
978377598 4:108092165-108092187 AACACAGATTTGCTTTCCTGTGG + Intronic
978865650 4:113506963-113506985 CAGACAGAATGGCCTTCATCTGG - Intronic
982012857 4:151123638-151123660 GACACTGTTTTATCTTCATCAGG + Intronic
982120145 4:152135403-152135425 AACTCACATTAGCCTTCATCTGG - Intergenic
982485743 4:155963811-155963833 GAGACAGAGATGGCTTCATCAGG - Intergenic
982488092 4:155993302-155993324 TACACAGATGTGCTTTCATCCGG + Intergenic
984939779 4:184920912-184920934 GACACAGTTTTTCCTCCAACAGG - Intergenic
985003829 4:185512933-185512955 GACACAGAGCTGCCAGCATCGGG + Intronic
994552413 5:101254311-101254333 TACACAGATTTCCTTTCTTCAGG + Intergenic
995220642 5:109643747-109643769 GACACAGACTTTTCTTCACCTGG + Intergenic
995595380 5:113742464-113742486 GGCACATATGTGACTTCATCTGG - Intergenic
1002360917 5:178670120-178670142 AAGGCAGATTTGCCTTCAGCTGG + Intergenic
1009508297 6:64514625-64514647 GTCAAAGTTTTGCCTTTATCTGG + Intronic
1011192688 6:84749396-84749418 AACACAGATTGTCCTACATCTGG + Intronic
1013646296 6:112145081-112145103 TACACAGATGTGCTTTGATCAGG + Intronic
1020459734 7:8415352-8415374 TAAACAGATTTGCTGTCATCTGG - Intergenic
1022415158 7:30171223-30171245 AACAGAGCTTTGCCTTCATTAGG - Intergenic
1022515432 7:30972153-30972175 GACCCAGATGTGCCTGCGTCAGG + Intronic
1023318649 7:38969576-38969598 GAAAAAGATTGGCATTCATCTGG - Intergenic
1024224771 7:47317869-47317891 GCCTCAGATTTGGCTTCATGAGG - Intronic
1024253581 7:47523667-47523689 GGCAAAGGTTTTCCTTCATCTGG + Intronic
1026222072 7:68407570-68407592 GACACAGAATTACTTTCAGCTGG + Intergenic
1027788160 7:82606309-82606331 GACACAAAGTAGCCTCCATCTGG - Intergenic
1028700636 7:93775026-93775048 GAATCACATTTTCCTTCATCTGG + Intronic
1030832375 7:114241531-114241553 CATACAGATTGGCCTTCATATGG + Intronic
1034224056 7:149469174-149469196 GGTACAGTTTTGCCTTCATTTGG + Intergenic
1034715627 7:153238773-153238795 GACACAGCTGTGTCTTCATTTGG + Intergenic
1037159483 8:15750803-15750825 GAGATAGATTTGCCTTCAGCAGG + Intronic
1038978744 8:32732483-32732505 TGGACAGATGTGCCTTCATCTGG + Intronic
1039346627 8:36712230-36712252 GACAGAGATTTTCCTTCAGGAGG + Intergenic
1039390273 8:37174858-37174880 GACACATATTTGCCCTCAGGGGG + Intergenic
1041026485 8:53692013-53692035 CAGACAGGTTGGCCTTCATCAGG + Intergenic
1046835452 8:118795914-118795936 GAAACAAATTTGTCTTCATAAGG + Intergenic
1047851511 8:128862682-128862704 GACACAGATTTGTAATCTTCCGG - Intergenic
1047858650 8:128939991-128940013 GAAACAGATGTGCCTTCAAAGGG - Intergenic
1051666465 9:19471233-19471255 GACACAAATTTGGCTTGAACTGG - Intergenic
1051871255 9:21740190-21740212 GACACATCTTTGCCTTCTCCAGG + Intergenic
1055372804 9:75618596-75618618 GACACAGATATATATTCATCAGG - Intergenic
1058414626 9:104774755-104774777 GACAGAGATTTGCCTTCCAGGGG + Intronic
1058605812 9:106721682-106721704 CACACAAAATTGCTTTCATCAGG + Intergenic
1062315491 9:135965131-135965153 GACACAGATGTGTGTTTATCAGG + Intergenic
1185702955 X:2245118-2245140 GAGGCAGGTTTGCCTTCAGCAGG - Intronic
1186816120 X:13239653-13239675 GACACAGAAGTGACTTCAGCAGG + Intergenic
1189820449 X:44865684-44865706 TAAACAGATTTGCTTTCACCTGG - Intergenic
1190155637 X:47990023-47990045 GAGCCAGAGTAGCCTTCATCAGG + Intronic
1190952432 X:55160259-55160281 GCCACAGCTCTGCCTTCATTAGG + Intronic
1193508928 X:82375844-82375866 AACACAAATTTGCTTTTATCTGG - Intergenic
1194783350 X:98051753-98051775 CACACAGATTTCCCTTCTTTGGG + Intergenic
1198068716 X:133126678-133126700 GACACACATTTTCCCTCAGCAGG + Intergenic
1198603534 X:138311419-138311441 GACACACAATTGCCATCAGCTGG + Intergenic
1198672512 X:139096141-139096163 GACAAGGATTTGCCTTCAAGAGG + Intronic
1198731515 X:139735427-139735449 GACACACATTTGACCACATCGGG + Intronic
1200880598 Y:8208170-8208192 GGCACAGCTTTGCCTACAGCAGG - Intergenic
1200919549 Y:8601142-8601164 GAGACAGATCTGCCTTTTTCTGG - Intergenic
1201403991 Y:13632116-13632138 GACCAAGCTTTGCCTACATCAGG + Intergenic
1201920571 Y:19229395-19229417 GACTCAGATTTGTTTTCAACAGG - Intergenic