ID: 1086436998

View in Genome Browser
Species Human (GRCh38)
Location 11:86791361-86791383
Sequence ATCTGTGTGCGGAGGGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086436998 Original CRISPR ATCTGTGTGCGGAGGGCAGA AGG Intronic
900689373 1:3970945-3970967 ATCTGTATCAGGAGAGCAGACGG + Intergenic
902117095 1:14130238-14130260 AAATGTGTGGGGAGGGCAGGTGG + Intergenic
903680720 1:25094978-25095000 GTCTGTGTGTTGAGGGCAGGTGG - Intergenic
904733067 1:32609428-32609450 ATCTATATGGGGAGGACAGAGGG - Intronic
905876262 1:41433694-41433716 ATGTTTGTGCGATGGGCAGACGG + Intergenic
906282376 1:44563172-44563194 ATTTGTGTGAGCTGGGCAGAGGG + Intronic
906726664 1:48049175-48049197 AGCTGTCTGAGGAGGGCAGGAGG + Intergenic
906886151 1:49650996-49651018 CTCTGTGTACGGAGGGCAGATGG - Intronic
907461513 1:54608283-54608305 CTCTGGGTGCTGAAGGCAGAAGG + Intronic
907479929 1:54738452-54738474 AGCTCTGTGCTCAGGGCAGAAGG - Intronic
907734479 1:57098475-57098497 TTGTGTGTCTGGAGGGCAGAAGG + Intronic
907830482 1:58060110-58060132 TTCTGTGTGGGGAGAGCAGCAGG + Intronic
908394606 1:63713961-63713983 ATCTGTGTGTTCAGGGCACATGG - Intergenic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
913320248 1:117582884-117582906 ATATGTGTGCGTTGGGCAGAGGG - Intergenic
920687544 1:208120810-208120832 GTCTGTGAGGGGAGGTCAGAGGG + Intronic
920793299 1:209113368-209113390 ATCTGGGGGCGGAGGTTAGAAGG - Intergenic
920871600 1:209799538-209799560 ATCTGTTTGCAGAGTGCAGGGGG - Intronic
920992093 1:210949231-210949253 ATGTGTTTGCAGAGGACAGAAGG - Intronic
921252623 1:213311804-213311826 AGCTGTGTGAGGTGGGGAGATGG + Intergenic
922063400 1:222113057-222113079 ATCTGTCTACGAAGAGCAGAGGG - Intergenic
922470885 1:225876399-225876421 ATCTGAGTGAAGGGGGCAGATGG - Intronic
923147758 1:231209892-231209914 ACCTCTGTTAGGAGGGCAGATGG + Intronic
1062904494 10:1170685-1170707 AGCTCTGTGTGGAGGGGAGAGGG - Intergenic
1064191059 10:13206300-13206322 ACCTGTGTGGGGAGGGTATAGGG - Intronic
1065752829 10:28903429-28903451 ACCTGTGTGGGGAGGAGAGAAGG + Intergenic
1066438510 10:35415512-35415534 AGCTGGGTCCTGAGGGCAGAAGG + Intronic
1066618108 10:37316295-37316317 ATCTTTGTTCTTAGGGCAGATGG + Intronic
1067517812 10:46968553-46968575 AACTGAGTGAGGAGGACAGAAGG - Intronic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067562110 10:47311407-47311429 AACTGTGTGCTGAGTGCCGAGGG - Intronic
1067644438 10:48083276-48083298 AACTGAGTGAGGAGGACAGAAGG + Intergenic
1070559681 10:77556758-77556780 TATTGTGTGCGGAGGGAAGATGG - Intronic
1070782672 10:79146669-79146691 CTCTGGGTGGGGAGGGCGGAAGG + Intronic
1071017477 10:81015054-81015076 ATGTGTGTGAGGGGGGCAGAGGG + Intergenic
1071293470 10:84203223-84203245 CTCTGTGTGAGGAGGGCAACCGG - Intronic
1072189570 10:93068919-93068941 CTCTGGGCGCGGAGCGCAGAAGG - Intergenic
1072519033 10:96214164-96214186 ATATGTGTGCCTAGGGGAGAGGG + Intronic
1072845418 10:98825184-98825206 ATGTGTGTGAGGTGGGGAGAGGG + Intronic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1074707452 10:116147617-116147639 CTCTGTGTGAGGATGGCAGGTGG - Intronic
1076131580 10:128017514-128017536 GCCTGTGTGGGGAGGGCATATGG - Intronic
1076919582 10:133444770-133444792 GTCTAGGTGAGGAGGGCAGAGGG - Intergenic
1077616365 11:3677033-3677055 AGCTGTGTGCAGGGGGCAGGAGG + Intronic
1078067999 11:8090364-8090386 AGCTGAGTAGGGAGGGCAGAGGG + Intronic
1078333377 11:10444384-10444406 ATGTGTGTGTGGTGGGCAGGTGG + Intronic
1078657954 11:13259965-13259987 CTGTGTGGGCGGGGGGCAGAGGG + Intergenic
1079128175 11:17733388-17733410 ATCTGTGTGTGGTGGGTAAAAGG - Intergenic
1080019594 11:27546108-27546130 GTCTGTGTGAGGAGAGGAGATGG + Intergenic
1080423487 11:32134989-32135011 ATCTGTGTGCACTGGGCTGAAGG + Intergenic
1084581881 11:70029268-70029290 GCCTGTGTGCAGAGGGAAGAGGG - Intergenic
1084891793 11:72240328-72240350 GGCTGCGTGCGGAGGGCCGAAGG - Intronic
1086436998 11:86791361-86791383 ATCTGTGTGCGGAGGGCAGAAGG + Intronic
1086806319 11:91247257-91247279 ATGTGTGTGTGGAGGGGAGAAGG + Intergenic
1087271260 11:96114415-96114437 TTCTGAGTGGGGAGGGAAGAGGG - Intronic
1087293532 11:96343667-96343689 ATGTGTGTGTTGAGGGCGGAAGG + Intergenic
1088361240 11:108992220-108992242 ATCTGTCTGAGGAGGGCACTGGG + Intergenic
1088893252 11:114060368-114060390 ATCTGGGGGCGGAGGGGAGCAGG + Intronic
1089137607 11:116262339-116262361 ATGTGTGTGCCAAGGGCTGAAGG + Intergenic
1089264245 11:117246927-117246949 AGCTTTGTGAGAAGGGCAGAAGG + Exonic
1089656206 11:119948683-119948705 GTCTGTGTGCTGATGGCTGATGG + Intergenic
1092484534 12:8891037-8891059 ATCTGGGAGGGGAGGGCAAAGGG + Intergenic
1093354636 12:18151747-18151769 ATCTGTGTTCTGAAGACAGAGGG + Intronic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1096480301 12:51935861-51935883 CTCTGTGTGCATAGGGAAGAAGG - Intergenic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1097839085 12:64303430-64303452 ATGTGTGTGTGGAGGGGAGATGG - Intronic
1097931247 12:65189369-65189391 CTCTGTGTCCGGAGGGCAGTTGG + Intronic
1098073762 12:66703841-66703863 ATGTGTGTGGGGTGGGGAGAGGG + Intronic
1101401984 12:104396414-104396436 ATTTGGGTGCAGAAGGCAGATGG - Intergenic
1101695972 12:107127171-107127193 ATCTGTGTGCTTATGGGAGATGG - Intergenic
1102760859 12:115383703-115383725 ATCTCTTTACTGAGGGCAGATGG + Intergenic
1102797349 12:115700344-115700366 ATCTGTGTGGGAAGGGCAGAAGG - Intergenic
1103727765 12:123007095-123007117 ATCTGTGTGCTGAGACCAGAAGG - Intronic
1104464702 12:128980740-128980762 AGCTTTGTGTGGAAGGCAGACGG + Intronic
1104488404 12:129172474-129172496 AGCTGAGTGAGGAAGGCAGATGG - Intronic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1104727419 12:131086497-131086519 TTCTGTGTGCAGAGGCCTGATGG + Intronic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1105213656 13:18272365-18272387 CTGTGTGTGGGGAGGGCACAGGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106183504 13:27387974-27387996 TTCTGTGTGAGGAGGGCTCAGGG - Intergenic
1106444174 13:29809757-29809779 ATCTGTGGGCGGGGGTCAGAAGG - Intronic
1107229965 13:38097060-38097082 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1110791745 13:79593325-79593347 ATCTGTCTGGTGATGGCAGATGG - Intergenic
1112329104 13:98463179-98463201 ATTTGTGTGGGGAGGGCTGGGGG - Intronic
1113882309 13:113634136-113634158 CTCTGTGTCCGGCTGGCAGACGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1119472235 14:74907307-74907329 ATGTGGGTGCAGAGGGCAGTAGG - Intronic
1119747509 14:77054660-77054682 ATTTGTGTGGGGGGGGCAGGGGG + Intergenic
1120232863 14:81858583-81858605 GTCTGTGTGCCGAGAGCAAAAGG - Intergenic
1122328060 14:100894575-100894597 TACTGTGTGCTGAGGGAAGATGG - Intergenic
1122857351 14:104566208-104566230 AAATGTGTGCGGAGGACAGGAGG - Intronic
1122951554 14:105047809-105047831 GGCTGTGGGCGGAGGGCAGCAGG - Intergenic
1202889612 14_KI270722v1_random:143671-143693 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889625 14_KI270722v1_random:143791-143813 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202889638 14_KI270722v1_random:143911-143933 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1124530434 15:30500750-30500772 ATTTGTGTCTGGAGGGCAGGGGG - Intergenic
1124768225 15:32506938-32506960 ATTTGTGTCTGGAGGGCAGGGGG + Intergenic
1124878665 15:33620832-33620854 ATCTGCCTGCTGAGGGCACAGGG + Intronic
1128361400 15:66964366-66964388 ACCTGTGTGAAGGGGGCAGAGGG - Intergenic
1128475369 15:67992794-67992816 ATTTGGGTGAGGAGGGCTGAAGG - Intergenic
1129233125 15:74207812-74207834 GTATGTGTGCGAAGGGCAGTTGG - Intronic
1129714567 15:77839690-77839712 ATCTGTGTGGAGATGGGAGAAGG - Intergenic
1130011224 15:80154230-80154252 AAGTGTTTGAGGAGGGCAGAGGG - Intronic
1130096592 15:80860808-80860830 AGCTGTGTGGTGAGGTCAGAGGG - Intronic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1134191562 16:12125299-12125321 AGCTGTGTGGGGAAGGCGGAAGG + Intronic
1135424323 16:22324789-22324811 ATCTGGGTGTGAAGGGCAGGTGG + Intronic
1136014141 16:27384048-27384070 GTGTGGGTGGGGAGGGCAGAGGG - Intergenic
1136127740 16:28196816-28196838 ATCTGTGTGCAGAGATCACAGGG - Intronic
1137660898 16:50205197-50205219 TTCTGTGTGGGGCGGGCAGAGGG + Intronic
1141036723 16:80633077-80633099 ATCGTTGTGCGGAAGGAAGAAGG - Exonic
1141439754 16:84022348-84022370 AACTGTGTGTGGGAGGCAGAGGG - Intronic
1142809577 17:2389046-2389068 CTGTGTGTGATGAGGGCAGACGG - Intronic
1144706622 17:17372681-17372703 ATTTGTCTCCGGTGGGCAGAAGG - Intergenic
1146008876 17:29179139-29179161 ATTTGTGTGGGGAGGGCTGGGGG - Intronic
1147746802 17:42699659-42699681 ATCTCTGAGCGGAGGAAAGAGGG - Exonic
1148865347 17:50625507-50625529 ACCTATGTGTGGAGGGCAGCAGG + Intronic
1149965228 17:61155875-61155897 ATCTGAGTGGAGAGGGAAGAAGG - Intronic
1151700580 17:75740613-75740635 ATCTGTTTCCAGAGGGCAGAAGG + Intronic
1152248834 17:79200906-79200928 CTCTGTGTGCGGCGGGCAGCTGG + Intronic
1153230256 18:2928197-2928219 ATCAGTGTGGTTAGGGCAGATGG - Intronic
1154378022 18:13824719-13824741 ATCTGAGTTTGGAGGGCAAAGGG + Intronic
1154437854 18:14360691-14360713 CTCTGGGGGCGGAGAGCAGAGGG - Intergenic
1156084270 18:33380063-33380085 ATCTGGGGGTGGAGTGCAGAGGG + Intronic
1157386731 18:47264039-47264061 ATCAGCGGGAGGAGGGCAGAGGG + Intergenic
1160178852 18:76617485-76617507 CACTGTGTCCTGAGGGCAGAGGG + Intergenic
1161267447 19:3370885-3370907 CGCTGTGTGCTCAGGGCAGATGG - Intronic
1163114376 19:15180305-15180327 ATCTGTGTGATGGAGGCAGAAGG - Intronic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163766232 19:19164984-19165006 ATCTGTCAGCGCTGGGCAGAAGG + Intronic
1164414697 19:28037278-28037300 TTCTGTGTCCTGAGGGGAGAGGG - Intergenic
1164699866 19:30277699-30277721 GCCTGTGTGCGGAGGCCTGATGG + Intronic
1165778960 19:38421054-38421076 AGCTATGGGTGGAGGGCAGAGGG - Intronic
1165899421 19:39161876-39161898 ACCTGCGTGAGGAGGGGAGAGGG - Intronic
1165980056 19:39714087-39714109 ATGGGTGTGGGGAGGGGAGAGGG - Intergenic
1166656498 19:44615789-44615811 CTCTCAGGGCGGAGGGCAGAGGG + Intronic
1166778058 19:45324183-45324205 ATCTGAGGGGGGAGGGGAGAGGG + Intergenic
1166991511 19:46695607-46695629 GCTTGTGTGCGGAGGGCAGATGG + Intronic
1167317818 19:48776280-48776302 AGCTGGGTGCAGAGGGCACAGGG - Intergenic
1167466840 19:49654631-49654653 ATCTGTGGGACGAGGACAGAGGG - Exonic
1168124603 19:54276500-54276522 AGCTGTGTGTGCAGGGCAGGGGG - Intronic
1168177384 19:54635038-54635060 AGCTGTGTGTGCAGGGCAGGGGG + Intronic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
1202665014 1_KI270708v1_random:110438-110460 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665026 1_KI270708v1_random:110558-110580 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1202665039 1_KI270708v1_random:110678-110700 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
926168393 2:10535769-10535791 GGCAGAGTGCGGAGGGCAGATGG + Intergenic
926499902 2:13641215-13641237 ATCTGCCAGGGGAGGGCAGAGGG + Intergenic
926698212 2:15785238-15785260 CCCTGTGTGCCGAGGGCAGCGGG + Intergenic
928234724 2:29529701-29529723 ATCTGTGTGGTGAGGGTAGAAGG - Intronic
933246734 2:79984646-79984668 GTCAGTGTGCTGAGGGCAGAGGG + Intronic
933939337 2:87232529-87232551 AGCTCTGAGGGGAGGGCAGAAGG - Intergenic
934300672 2:91774381-91774403 CTGTGTGTGGGGAGGGCACAGGG + Intergenic
934676236 2:96251743-96251765 ATCAGTGTCAGGATGGCAGAGGG + Exonic
936353796 2:111733249-111733271 AGCTCTGAGGGGAGGGCAGAAGG + Intergenic
936400926 2:112163940-112163962 AGATGTCTGGGGAGGGCAGAGGG - Intronic
936699405 2:114992587-114992609 AGCTGTGTGGGGAGTGGAGAGGG - Intronic
937015723 2:118603498-118603520 GTGTGTGTGTTGAGGGCAGAGGG + Intergenic
937387926 2:121453908-121453930 TTCTGAGGGCAGAGGGCAGAGGG + Intronic
938716619 2:134027691-134027713 AGCTGGGGGCGGAGGACAGAGGG + Intergenic
939129513 2:138217529-138217551 ATATGTGTGTGGAGGGCAGTGGG - Intergenic
939280031 2:140051846-140051868 ATGCGTGTGCGGAGGGGAGGTGG - Intergenic
941149236 2:161893248-161893270 ACATGTGTGCGGAGGGGAGGTGG + Intronic
942278261 2:174337728-174337750 ATCCGGGCGCGGAAGGCAGAGGG - Exonic
943753220 2:191531724-191531746 ACCTGTGGGAGGAAGGCAGATGG + Intergenic
944483580 2:200181004-200181026 GTCTGTGGGCTGAGGGCTGAAGG + Intergenic
944517983 2:200531503-200531525 ATCTGTGTCCTCAGGGGAGAGGG + Intronic
944783959 2:203048573-203048595 ATCTGTGTTCCGAGAGGAGATGG - Intronic
945090933 2:206174905-206174927 AGCTGTGTTGGGAGGGGAGAGGG + Intergenic
946051613 2:216867508-216867530 ATGTATGTGAGGAGGGGAGAGGG - Intergenic
948271446 2:236676932-236676954 GTGTGTGTGCGGAGGGGAGCAGG + Intergenic
948426074 2:237887157-237887179 TCCTGTGTGGGGAGGGCAGTGGG + Intronic
948524113 2:238559914-238559936 AGCTGTGGGCTGAGGGCTGAGGG - Intergenic
948665742 2:239533788-239533810 AGCTGTGTGCAGAGGCCAGGAGG - Intergenic
1168959824 20:1861339-1861361 ATATGTGTGGGGTGGGTAGAGGG - Intergenic
1171108915 20:22462600-22462622 ACCTGTATGGGGAGAGCAGAAGG - Intergenic
1171936917 20:31283523-31283545 ATCTGAGGGTGGAGGGCAGGAGG + Intergenic
1173134089 20:40423942-40423964 ATGTGTGTGCAGAGGGGAGGAGG - Intergenic
1174178228 20:48658227-48658249 ATCTGGGGGCCCAGGGCAGAAGG + Exonic
1175461790 20:59157344-59157366 ATCCGTGTGCTAAGGGAAGAGGG + Intergenic
1179343894 21:40538186-40538208 CTCTGAGTGGAGAGGGCAGAAGG - Intronic
1179996695 21:44977510-44977532 CTCTGGGGGCGGAGAGCAGAGGG + Intergenic
1180135830 21:45861200-45861222 TGCTGTGTGCGGTGGGGAGAAGG - Intronic
1180331739 22:11487358-11487380 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331752 22:11487478-11487500 ATGTGTGTCAGGTGGGCAGAGGG - Intergenic
1180331765 22:11487598-11487620 ATTTGTGTCAGGAGGGCAGAGGG - Intergenic
1180841429 22:18960635-18960657 CCCTGTGTGCAGATGGCAGATGG - Intergenic
1181060067 22:20278159-20278181 CCCTGTGTGCAGATGGCAGATGG + Intronic
1181699027 22:24609517-24609539 CTGTGTGTGGGGAGGGCACAGGG + Intronic
1182585180 22:31340919-31340941 ATCTGAGTGGGAAGGGCAGAGGG + Intronic
1183474658 22:38029483-38029505 ATCAGTGTGTGCAGGGCACAGGG + Intronic
1184718851 22:46297299-46297321 CTCTGTGAGCCGAGGGCTGAAGG + Intronic
1185229321 22:49671072-49671094 ATTTGCGTGGGGAGGGCAGGAGG - Intergenic
949587218 3:5453673-5453695 ATTTGTGTCAGGTGGGCAGAGGG + Intergenic
949614998 3:5743786-5743808 TTCTGTGTGCCGAAGGCAAAGGG + Intergenic
949663014 3:6303706-6303728 GTCTGTGTGTGGAGTGTAGAGGG - Intergenic
950112088 3:10425741-10425763 ACCAGTGTGCAGATGGCAGAGGG - Intronic
950406854 3:12810258-12810280 ATCAGGGTGCGGATGGCAGTCGG - Exonic
951104826 3:18730562-18730584 ATCTGTGTGAGGCGAGGAGAGGG - Intergenic
955550410 3:60078857-60078879 ATCTGAGGGAGGAGGGTAGAGGG + Intronic
956760465 3:72438909-72438931 CGCTGTGTATGGAGGGCAGACGG + Intronic
957090880 3:75728906-75728928 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090892 3:75729027-75729049 ATTTGTGTCAGGTGGGCAGAGGG + Intronic
957090917 3:75729267-75729289 ATTTGTGTCAGGTGGGCAGAAGG + Intronic
957771863 3:84704439-84704461 ATCAGAGGGCGGAGGGTAGAAGG + Intergenic
960594501 3:119395771-119395793 AGCTATGTGCGAAGGGCAGAAGG + Intronic
961205722 3:125079898-125079920 ATCTGTGTCCTGAGGGCTTAAGG - Intergenic
961445954 3:126981917-126981939 CTCTGTGTGGTGAGGGCACAGGG - Intergenic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
963933841 3:151032578-151032600 ATCGGAGGGTGGAGGGCAGAAGG + Intergenic
964307281 3:155355285-155355307 ATCTCTGAGGGTAGGGCAGATGG - Intergenic
966678391 3:182614005-182614027 ATCTGGGTTGGGAGGGCAGTGGG - Intergenic
968481605 4:835446-835468 AGCTGGGTGCGGAGGGCACAAGG + Intergenic
969437033 4:7194152-7194174 ATTTGTATGGGGAGGGGAGATGG + Intronic
969592788 4:8131511-8131533 TTCTGCATGCGGAGGGCAGATGG + Intronic
969699936 4:8762416-8762438 GTCTGTGGCTGGAGGGCAGAGGG - Intergenic
973266906 4:48220237-48220259 TTCTGTGGGCCTAGGGCAGAGGG - Intronic
974629086 4:64459577-64459599 AATTGTGTGTAGAGGGCAGAAGG + Intergenic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
980515026 4:133845452-133845474 ATCTGTGTTCTGATGACAGAAGG - Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
981686358 4:147459058-147459080 ATCTGTGTTGGGATGGCTGAAGG + Intergenic
983845646 4:172514581-172514603 ATCTGGGGGTGGAGGGCAAATGG - Intronic
984922579 4:184778573-184778595 AAGTGTGGGCGCAGGGCAGAAGG - Intronic
984943755 4:184955324-184955346 ATGTGTGTGTGGAGGGAGGAGGG + Intergenic
985198304 4:187456956-187456978 ATCTTTCGGCGGAGGGCAAAAGG + Intergenic
985880222 5:2633653-2633675 ATCTGTGTTCAGAGGGCAGAGGG + Intergenic
986136308 5:4982355-4982377 GTCTGTGTGCAGGGGGCAGGCGG + Intergenic
986468541 5:8050975-8050997 ATCTGTGTGCAGAGGCCTCAGGG + Intergenic
987080213 5:14419196-14419218 ATCTGAGGGCAGAGGGCAGAGGG + Intronic
988731950 5:33981187-33981209 CTCTGTGTAAGGAAGGCAGAGGG - Intronic
990149261 5:52798726-52798748 ATTTGTGTCAGGAGGGCAGAGGG + Intronic
992460244 5:76953745-76953767 GACTCTGTGCGGGGGGCAGAGGG + Intronic
992872761 5:81023068-81023090 TTGTGAGTGCGGAGGGTAGAGGG + Intronic
996700224 5:126443589-126443611 ATCTCTGTGGGGAGAGCAGAAGG - Intronic
997021309 5:130005734-130005756 ATCAGTGTGCTTAGGACAGAAGG - Intronic
998388540 5:141772459-141772481 ATGTGTGGGCCGAGGGCAGAAGG + Intergenic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
999302499 5:150499910-150499932 CTCTGTGTGCTGAGGCCAGCAGG + Intronic
999384093 5:151141992-151142014 ATCTCTGTGCAGTGGGCAGATGG - Intronic
1001104899 5:168844502-168844524 GTCTGTGTGGGGAGGAGAGAGGG - Intronic
1001888924 5:175322621-175322643 AACTGTGTGCAGAGGCCTGAGGG + Intergenic
1001996328 5:176162398-176162420 ATCTGTGTTTCTAGGGCAGATGG + Intergenic
1002793679 6:453230-453252 CTCTGTGTGCAAAGGGCAGCTGG - Intergenic
1003692121 6:8365148-8365170 ATCTCTGTGCAGAGGGAGGATGG - Intergenic
1003761429 6:9182732-9182754 ATATGTGTGAGGAGGGCAGGGGG + Intergenic
1004982229 6:21038269-21038291 TTCTGTGTGTGGAGGCCAGTAGG + Intronic
1005631049 6:27708395-27708417 AGATGTTTGGGGAGGGCAGATGG - Intergenic
1007065708 6:38988423-38988445 ATCTGTGTGCTGAGGACCCAGGG + Intronic
1008614644 6:53214714-53214736 AACAGTGGGAGGAGGGCAGAGGG - Intergenic
1010545705 6:77152529-77152551 ATCTGTGTGAGTGGGGCAGAAGG - Intergenic
1011203986 6:84871943-84871965 GTGTGTGTGCGGAGGGTGGAGGG + Intergenic
1011780816 6:90787377-90787399 AAATGTGTGCAGAGGGTAGAAGG + Intergenic
1012814006 6:103999094-103999116 ATCAGAGGGTGGAGGGCAGAAGG - Intergenic
1013731432 6:113172801-113172823 TTCTGTGTTGGGAGGGGAGAGGG + Intergenic
1015152714 6:130056541-130056563 AGCTGTGTGCCTAGGGCAGGTGG - Intronic
1017005752 6:150027216-150027238 ACCTGTGGGCAGAAGGCAGAGGG + Intergenic
1017012121 6:150069984-150070006 ATCTGTGGGCAGAAGCCAGAGGG + Intergenic
1017410416 6:154162094-154162116 ATCTCTGTGAACAGGGCAGAAGG - Intronic
1018137645 6:160793011-160793033 ATGTGTGTGGGGAGGACGGATGG - Intergenic
1020066710 7:5193941-5193963 ATATGTTTGAGGAGGGCAGGGGG + Intronic
1020244589 7:6420866-6420888 TTCTCTGTGCAGATGGCAGATGG - Intronic
1020749829 7:12126382-12126404 AGCTCTGTGAGCAGGGCAGATGG - Intergenic
1020901537 7:14009549-14009571 AGCTGTGTGCAGAGAGCACATGG + Intergenic
1022237791 7:28478502-28478524 TTCTGTGAGCGGAGGGCTAATGG + Intronic
1022259446 7:28690294-28690316 CTCTGTGTCTGGTGGGCAGAGGG - Intronic
1023385704 7:39655400-39655422 ATCAGTGTATGGAGGGGAGATGG + Intronic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1025224116 7:57141915-57141937 ATCTGTGTGTTGAGCCCAGAAGG + Intergenic
1025721947 7:64025156-64025178 ATCTGTGTGTTGAGCCCAGAAGG - Intergenic
1025745545 7:64239495-64239517 ATCTGTGTGTTGAGACCAGAAGG - Intronic
1027956357 7:84883562-84883584 ATCTGAGGGTGGAGGGTAGAAGG - Intergenic
1028324742 7:89508693-89508715 ATCGGTCTCCGTAGGGCAGAGGG - Intergenic
1029458607 7:100683158-100683180 AGCTGGGTGCGGGGGGCACAGGG + Exonic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1032153688 7:129451379-129451401 GGCTGTGTGTGGAGGACAGAGGG + Intronic
1032683634 7:134209715-134209737 TTTTGAGTGCGGAGGGCTGATGG - Intronic
1033320041 7:140331174-140331196 GTCTGTGTGGGGAGGGGAGAAGG + Intronic
1033492348 7:141855716-141855738 CTCTGTGTGGGGAAGGCATACGG - Intergenic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1035929140 8:3762210-3762232 ATCTGAGTCAGGAGGGCACATGG - Intronic
1037896253 8:22658285-22658307 CTGTGTGTACGGAGGGCAAAGGG + Intronic
1038035246 8:23681931-23681953 ATCTGTGTGCTGAGGAGAGGCGG + Intronic
1038412084 8:27366804-27366826 GGCTGTGTGTGGAGAGCAGAGGG + Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1040046286 8:42967258-42967280 AGGTGTGTGTGGAGGGCAGCCGG - Intronic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042730230 8:71925455-71925477 TGCTGAGTGTGGAGGGCAGATGG - Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043130594 8:76456080-76456102 GACTGTGTGCGGAGGGCAGGGGG - Intergenic
1043968507 8:86505451-86505473 ATATGAGTGTGGAAGGCAGACGG + Intronic
1046694255 8:117320877-117320899 ACCTGAGTGGGGAGGGTAGAAGG + Intergenic
1046968645 8:120195383-120195405 AAGTGTGTGTGGCGGGCAGAGGG - Intronic
1047230856 8:122996639-122996661 ATGTGTGTGTGGAGGGCTGTGGG - Intergenic
1047391545 8:124456037-124456059 ATATGTCTGAGGTGGGCAGAGGG + Intronic
1048330235 8:133466089-133466111 CTCTGTGGGCGGAGGACAGAAGG + Exonic
1049069164 8:140343890-140343912 AGCTGAGTGTGGAGGGCAGAGGG + Intronic
1051726550 9:20092721-20092743 ATTTGTGTGTGCAGGGCAGGGGG + Intergenic
1052033978 9:23659588-23659610 ATCTGTATGCGGTAGGCAGCTGG - Intergenic
1052532525 9:29706120-29706142 ATGTGTGTGCTCAGGGCAGGCGG + Intergenic
1053532080 9:38892440-38892462 ATCTGTGAGGGAAGGGCAAAGGG + Intergenic
1054204303 9:62116849-62116871 ATCTGTGAGAGAAGGGCAAAGGG + Intergenic
1054634058 9:67471515-67471537 ATCTGTGAGGGAAGGGCAAAGGG - Intergenic
1054681091 9:67919642-67919664 AGCGGTGTGTGGAAGGCAGAAGG + Intergenic
1056106458 9:83351866-83351888 ATTTGTGTGAGGATGGCAAAAGG - Intronic
1057553453 9:96068866-96068888 ATGTGAGTGGGGAGGGGAGAGGG - Intergenic
1060320266 9:122552593-122552615 ATATGTGAGCTGAGGGCAGTAGG - Intergenic
1061484107 9:130911729-130911751 AACTGTGTCCGGAAGGCAGGGGG + Intronic
1061856573 9:133444930-133444952 ACCTGTGTGCCAGGGGCAGATGG + Exonic
1203486735 Un_GL000224v1:63092-63114 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1203499357 Un_KI270741v1:4992-5014 ATTTGTGTCAGGTGGGCAGAGGG - Intergenic
1185644010 X:1604212-1604234 AGCTGTGTGCGCAAGACAGAAGG + Intergenic
1193239213 X:79146844-79146866 ATCTATGAGCGGAATGCAGAAGG - Intergenic
1194710662 X:97232641-97232663 ATCAGGGTGTGGACGGCAGAAGG - Intronic
1194956725 X:100189662-100189684 ATCAGAGTGTGGAGGGAAGAAGG + Intergenic
1198968233 X:142250425-142250447 GCCTGTGTGTGGAGTGCAGAGGG + Intergenic
1199442730 X:147886800-147886822 ATCTATGTGCTGAGGAAAGATGG + Intergenic
1200032865 X:153310565-153310587 TTCTCCTTGCGGAGGGCAGAAGG - Intergenic
1200114936 X:153765851-153765873 ATCTCTCTGTGGAGGGCAGGAGG + Intronic
1201672013 Y:16533466-16533488 ATCTGTGGGTGGAGTGTAGATGG + Intergenic