ID: 1086437978

View in Genome Browser
Species Human (GRCh38)
Location 11:86800457-86800479
Sequence CCCGCCCCGCCTCCGGCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 0, 2: 10, 3: 81, 4: 606}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086437978_1086437988 -3 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437988 11:86800477-86800499 GGGCGGGCCTCGGGTGGCGCGGG 0: 1
1: 0
2: 2
3: 38
4: 395
1086437978_1086437991 0 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437991 11:86800480-86800502 CGGGCCTCGGGTGGCGCGGGGGG 0: 1
1: 0
2: 1
3: 29
4: 296
1086437978_1086437990 -1 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437990 11:86800479-86800501 GCGGGCCTCGGGTGGCGCGGGGG 0: 1
1: 0
2: 0
3: 34
4: 264
1086437978_1086437989 -2 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437989 11:86800478-86800500 GGCGGGCCTCGGGTGGCGCGGGG 0: 1
1: 1
2: 5
3: 29
4: 341
1086437978_1086437992 3 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437992 11:86800483-86800505 GCCTCGGGTGGCGCGGGGGGCGG 0: 1
1: 0
2: 1
3: 59
4: 576
1086437978_1086437986 -9 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437986 11:86800471-86800493 CGGGGCGGGCGGGCCTCGGGTGG 0: 1
1: 0
2: 1
3: 70
4: 574
1086437978_1086437987 -4 Left 1086437978 11:86800457-86800479 CCCGAGGCCGGAGGCGGGGCGGG 0: 1
1: 0
2: 10
3: 81
4: 606
Right 1086437987 11:86800476-86800498 CGGGCGGGCCTCGGGTGGCGCGG 0: 1
1: 1
2: 3
3: 30
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086437978 Original CRISPR CCCGCCCCGCCTCCGGCCTC GGG (reversed) Exonic
900244391 1:1630745-1630767 CCCGCCCGGACTGCGGCCTTCGG + Intergenic
900414664 1:2529481-2529503 ACCAGCCCGCCTGCGGCCTCTGG - Exonic
900537601 1:3186560-3186582 CTGGCCGCGCCTCCCGCCTCGGG - Intronic
900610733 1:3543566-3543588 CTCGCCCCGCCTCCCGCCCGGGG - Intronic
900647268 1:3714604-3714626 CTGGCCTCTCCTCCGGCCTCTGG - Intronic
900832111 1:4972929-4972951 CCCGCCTCGCCTGGAGCCTCTGG + Intergenic
901006061 1:6171992-6172014 CCCACCCCGCCTCCACCCCCAGG - Intronic
901433920 1:9234809-9234831 GCCACCCCGCCCCAGGCCTCAGG - Exonic
901434467 1:9238219-9238241 GCCGCCCAGCCTCCTGCCTCAGG - Intronic
901441388 1:9280441-9280463 CCCGCCCCGCCGCTGGCAGCGGG + Intergenic
901443361 1:9292787-9292809 CCCGCCCCGCCCCCGACCTCGGG - Intergenic
901489266 1:9588596-9588618 CCCGCGCCGCCTTCCACCTCCGG + Intergenic
901489320 1:9588786-9588808 GCCGCCCCGCGTCCCGCCTGCGG + Intergenic
901673099 1:10867296-10867318 CCCGCGCCGCCCGCGGCCGCCGG - Intergenic
902215547 1:14932250-14932272 CCCGCCCCGTCCCCTGCCCCGGG + Intronic
902286122 1:15409813-15409835 CGCGCCCCGCCCCCGCCCCCGGG - Intergenic
902704647 1:18196197-18196219 GCCTCCCTGCCTCCAGCCTCTGG - Intronic
902919623 1:19658063-19658085 CCCATCCCGCCTAGGGCCTCTGG - Intronic
903376598 1:22870316-22870338 CCAGCCCAGCCTCCTTCCTCGGG - Intronic
903846004 1:26280285-26280307 CCCACCCCGCCCCCGTCCTGGGG - Intronic
904011432 1:27392599-27392621 CCCGCCCCGCCCCCGGCCACCGG - Intergenic
904039262 1:27575019-27575041 CCCGCCCCGCCTCCCAACTGCGG - Intronic
904237062 1:29122874-29122896 CGCGCCCTGCCTGCGGCCTGTGG + Intronic
904237373 1:29123949-29123971 CCGGCCCCGCCTCCAGCCCCCGG + Intergenic
904339465 1:29824761-29824783 CCTGCCCTGCCTCTGGCCTGGGG - Intergenic
904770292 1:32877444-32877466 CTGGCCCAGCCTCTGGCCTCAGG + Intergenic
905639214 1:39576893-39576915 GCCGCCCCGCCTCGGGCCCCCGG - Intergenic
905793412 1:40802279-40802301 CCCTCTCCGCCCCTGGCCTCGGG + Intronic
906262813 1:44406643-44406665 CCAGCCCCGCCACCGCACTCCGG + Intronic
906614512 1:47225405-47225427 CCCGCCCAGCCCCTGGCCCCTGG + Intronic
906961907 1:50423876-50423898 CCTGCCCCCCATCCCGCCTCAGG - Intergenic
907491854 1:54813668-54813690 CTGGCCCGGCCTCCGGCCTCCGG + Intronic
908261737 1:62344351-62344373 CCCTGCCCTCCTCCGGCCTGGGG - Intergenic
908401324 1:63774701-63774723 CCCGGCCCGCCGCGGGGCTCCGG - Intronic
911208573 1:95117375-95117397 CCCGCCCGGACTGCGGGCTCGGG - Exonic
912401646 1:109398065-109398087 CTCGCGTCGCCTCCGGCTTCGGG + Intergenic
914428639 1:147600314-147600336 CCCTCCCCCACTCCTGCCTCCGG + Intronic
914919532 1:151838176-151838198 GCGGCCCCGCGTCCGGCCGCGGG - Exonic
915312297 1:155010791-155010813 CCCACCCCAACTCCAGCCTCAGG - Intronic
915326856 1:155085191-155085213 TCTGCCCCGCCTCCGGGCCCCGG - Exonic
916069035 1:161159491-161159513 CCCGCCCGGCCACCGGCCACCGG - Exonic
916091925 1:161314338-161314360 GCCGGCGCGCCTCCGCCCTCGGG + Exonic
916171132 1:162002428-162002450 CCTGCCCTGCCTCCGGGCACTGG - Intronic
916773413 1:167936061-167936083 CCCGGTCCGCCTCCGGCCCCCGG + Intronic
916783015 1:168056464-168056486 CCCGCCCCGCCTCCCGGCGCGGG - Intronic
917869547 1:179229444-179229466 TCCTCCTCGGCTCCGGCCTCGGG + Exonic
917974335 1:180229720-180229742 GCAGCCCCGTCCCCGGCCTCCGG + Intergenic
918048338 1:180954359-180954381 CCCGCCCTCCCTCCACCCTCAGG - Intergenic
919486818 1:198156960-198156982 CCCGCCCCGCCCCTCTCCTCGGG + Exonic
919912879 1:202122808-202122830 CCCTCCCAGCCTCCGGCCACAGG - Intergenic
920181033 1:204131804-204131826 CCCTCCCCGCCTCCTTCCCCAGG + Exonic
920279693 1:204833457-204833479 CCCTCCCCGCCTCCAACCCCAGG + Intronic
920409586 1:205749397-205749419 CCGGCCCCGCCTCTGTCCTTCGG - Intronic
920587243 1:207178401-207178423 CCCCTCCCTCCTCCAGCCTCTGG + Intergenic
921179984 1:212624686-212624708 CCCACCCCCACCCCGGCCTCTGG + Exonic
922958665 1:229626177-229626199 CCCGCTGCGCCGCCGGCGTCCGG + Intergenic
923002297 1:230017313-230017335 CCCTCCCGCCCTCCAGCCTCAGG + Intergenic
923191737 1:231626793-231626815 TTCCCCCCGCCTCTGGCCTCGGG + Exonic
923329037 1:232905733-232905755 CCTGCTCAGCCTCCTGCCTCAGG + Intergenic
923632320 1:235659448-235659470 CCCACCCAGCCTCTAGCCTCGGG + Intergenic
924362381 1:243255061-243255083 CGCGCCCCGCCTCCCCCGTCCGG - Intronic
1062840464 10:666482-666504 CCGGCCCCGACTCAGGCCACAGG - Intronic
1063130402 10:3172815-3172837 CCCGCCCCGCGCCCTGCGTCGGG - Exonic
1063671528 10:8103383-8103405 CCCCCCCCGCCTCCAGCCTCGGG - Intergenic
1063840432 10:10065534-10065556 CGAGCCCCACCTCCGGCCTTGGG + Intergenic
1065619401 10:27565026-27565048 CCCTCCCCGCCGCCAGCCTCTGG + Intergenic
1067060633 10:43076485-43076507 TCTTCCCCGCCTCCTGCCTCCGG + Intergenic
1069106546 10:64390132-64390154 TCCTCCCAGCCTCCAGCCTCTGG - Intergenic
1069651646 10:70053558-70053580 CGCGGCCCGCCCCCGGACTCGGG - Intronic
1069900449 10:71703803-71703825 CCCGCCTCCCCTCCGGTCTGGGG - Intronic
1070152266 10:73811956-73811978 CCCGCCCCTGGTCCCGCCTCCGG - Intergenic
1070609992 10:77926567-77926589 CCTGCCCGCCCGCCGGCCTCGGG - Intergenic
1071573808 10:86711746-86711768 CCCGCCCCCTCCCGGGCCTCAGG - Intronic
1072332010 10:94363118-94363140 CCCGCCCGGCTTCCCGCCTTTGG - Intergenic
1072356246 10:94614533-94614555 CCTGCCCCACCTCCAGCTTCAGG + Intergenic
1073010942 10:100359131-100359153 CCTTCCCCACCTCCAGCCTCTGG + Intronic
1073088706 10:100913386-100913408 CCCGCCCCGCCTCCGCGCAGGGG + Intronic
1073150850 10:101310540-101310562 CCCGACCCGCGTCAGGCCTCGGG + Intergenic
1073306048 10:102504186-102504208 CCCACCGCGCCCCCGGCCCCTGG + Exonic
1074831588 10:117253541-117253563 CCCGCCCCCCCGCCGTCCTTAGG - Intronic
1075077159 10:119359184-119359206 CCAGCCCCACCCCTGGCCTCTGG - Intronic
1075119343 10:119652248-119652270 CCCGCTCGGCCTCCGGGCCCGGG + Intronic
1075504413 10:123009228-123009250 CCCGACCCCCTTCAGGCCTCTGG + Intronic
1075632524 10:124009796-124009818 CCCTGCCCGCCTCCGCCTTCTGG - Exonic
1075644698 10:124090006-124090028 CCCGCCTCACCTCCAGCCTAGGG + Intronic
1075802105 10:125160256-125160278 CCCGCCTCACCTGCGGCCGCGGG - Intronic
1075865970 10:125719614-125719636 CCGGCCCCGCCTCCCGCTGCGGG - Exonic
1075871318 10:125774124-125774146 TCCGCCCCGCCTTCGCCCCCGGG - Exonic
1076035638 10:127196597-127196619 CCCGCCCCACCTCCGCCCCGCGG - Intronic
1076480559 10:130782608-130782630 CCAGTCCCACCTCCGGCTTCAGG - Intergenic
1076521254 10:131082684-131082706 CCTGCCGCCCCTCCGGCCTTGGG - Intergenic
1076554105 10:131311208-131311230 CCCGGCCCGGCTCTGGCCTCCGG - Intronic
1076806655 10:132862321-132862343 CCCGCCCTGTCGCCGGCCTCCGG - Intronic
1076885905 10:133262147-133262169 CCCGCCCCGTCTCCGGGCAATGG - Intergenic
1076919993 10:133446351-133446373 CCCACCGCGCCCCCCGCCTCGGG + Intergenic
1077086683 11:755981-756003 CCCGCCCAGCTTCCGGCCATAGG - Exonic
1077093630 11:790279-790301 CGGGACCCGCCTCCTGCCTCTGG - Intergenic
1077182969 11:1224604-1224626 CACGCCCCGGCTCCCGCCGCAGG - Intronic
1077204937 11:1337495-1337517 CCGCCCCCGCCTCGGGCCCCCGG - Intergenic
1077229020 11:1450455-1450477 CCAGCCCGGCCTCCCGCCACTGG + Intronic
1077319954 11:1936664-1936686 CCCGCCCCACATCCTGCCGCAGG + Intronic
1077505775 11:2929476-2929498 CCCGCCCCGCCCCGGCCCTCGGG + Intergenic
1077869562 11:6250502-6250524 CCCACCCTGCCTCCTGCTTCTGG - Intergenic
1077898804 11:6473943-6473965 CCCGCCCCGGCCCCTCCCTCCGG - Intronic
1078190896 11:9091740-9091762 CCCGTCCCCTCCCCGGCCTCGGG + Intronic
1078470325 11:11581165-11581187 CCTGCCCCACCTCAGGCCTCAGG - Intronic
1078514147 11:12008679-12008701 TCCGCCCCGCCGCCCGCCCCTGG + Intronic
1078594384 11:12674319-12674341 CAGGCCCCGCCTCCAGCCCCGGG + Intergenic
1079049675 11:17142937-17142959 CCCACCCCGCCCCCTGCCGCAGG - Intronic
1080779679 11:35419084-35419106 CCCGCCCTTCCACCCGCCTCCGG + Exonic
1081578976 11:44339069-44339091 CACCCCCCACCCCCGGCCTCTGG - Intergenic
1083616399 11:64028644-64028666 CGCGCCCCGCCCCCTGCCGCTGG + Intronic
1083648134 11:64185090-64185112 CCTGCCCTGCCTCCGACTTCTGG + Intergenic
1083684716 11:64369359-64369381 CAGGCCCCGCCCCCGGCCTTCGG - Intronic
1083711943 11:64554969-64554991 CCAGCCCCGCTTCCAGGCTCCGG - Intergenic
1083876082 11:65525085-65525107 CCCGCCCCGGCTCGGGCGGCCGG + Exonic
1083967584 11:66052093-66052115 TCCGGCCCGCCGCCGGCCTTCGG + Intronic
1084066818 11:66709019-66709041 CCAACCCGGCCTCCTGCCTCAGG - Exonic
1084086306 11:66856905-66856927 CCCGCGCCGGCCCGGGCCTCGGG + Intronic
1084180600 11:67443676-67443698 CCCGCCCCGCCCCCTTCTTCCGG - Intronic
1084688566 11:70711586-70711608 CCCGCCCGGCCTCCAGGCTCAGG + Intronic
1084730594 11:71070853-71070875 CTCTCCCCACCTCGGGCCTCAGG - Intronic
1084892679 11:72244216-72244238 CCCGCCCCGCCCCCCTCCGCGGG - Intronic
1086437978 11:86800457-86800479 CCCGCCCCGCCTCCGGCCTCGGG - Exonic
1086697987 11:89865599-89865621 CCGCCCACGCCTCCGGCCGCCGG - Intergenic
1086708175 11:89978889-89978911 CCGCCCACGCCTCCGGCCGCCGG + Intergenic
1088259128 11:107928358-107928380 CCCGCCCCGCCCCCGTCCAGAGG + Intergenic
1088764380 11:112962001-112962023 CCCGCCCCGCCGCCCGCCTTTGG - Intronic
1089533856 11:119149219-119149241 CCCGCCCCGGCCCGGGCCGCCGG + Exonic
1089617954 11:119705818-119705840 CCTGCCCCGCCTCTGGCCTTGGG - Intronic
1090370336 11:126246572-126246594 CCCCCACCGCCTCCCGCCCCAGG - Intronic
1091206433 11:133824458-133824480 CCCGCCCCCCCCCCGGGCACAGG + Intergenic
1091445362 12:541854-541876 CCCCCCCACCCCCCGGCCTCTGG + Intronic
1091558598 12:1594202-1594224 CCCTCCCCGCCTTCCGGCTCCGG + Intronic
1091973932 12:4810126-4810148 CCCCCGCCCCCGCCGGCCTCCGG - Exonic
1092256373 12:6928429-6928451 CCCGCCCGGGCTCCGGCCTGCGG + Intronic
1096149167 12:49297863-49297885 CCCGCCCCTCCCCTGCCCTCAGG + Intronic
1096474378 12:51899180-51899202 CCCGCCCACCCCCCGCCCTCAGG - Intergenic
1096796742 12:54082573-54082595 CCGGCCCCGGCCCCGGCCCCCGG - Intergenic
1097014256 12:55974203-55974225 CCAGACCCGCCTCCGCTCTCAGG - Intronic
1097191160 12:57220275-57220297 CCCCCTCCGGCTCCGGCTTCGGG + Intronic
1097264487 12:57737768-57737790 CCCGCCCGGCCTTCGGGCTCCGG + Exonic
1100404710 12:94263200-94263222 GCCTCCCCGCCCCCGGCCCCGGG + Intronic
1100632305 12:96400621-96400643 CAGGCCCCGCCCCCGGCCGCCGG - Intergenic
1102029040 12:109729470-109729492 CAGGCCCTGCCTCCTGCCTCTGG - Intronic
1102496261 12:113321210-113321232 CCCTCCCAGCCTCCTCCCTCTGG - Exonic
1103074275 12:117969339-117969361 CTCGCCCAGCCTCCAGGCTCGGG - Intergenic
1103433010 12:120904059-120904081 CCCGCCCCGCCCCGGGGCCCAGG - Exonic
1103447760 12:121005379-121005401 GCTGCCCCGCCTCTGCCCTCAGG + Intronic
1103595458 12:122022286-122022308 CCAGCCCCGCCGCGGGCCCCGGG + Intronic
1103604858 12:122078965-122078987 CCGTCCCCGCCGCCCGCCTCCGG + Exonic
1103626721 12:122225787-122225809 ACAGCCCCGCCTCCGCCCCCTGG - Intronic
1104118433 12:125773292-125773314 CCCGCCCCGCAGCCGGGCTGAGG + Intergenic
1104357201 12:128097714-128097736 CCTGCCCTGCCCCCAGCCTCCGG - Intergenic
1104735024 12:131131268-131131290 CCCGCCCCGGCCCAGGCCTGCGG - Intronic
1104801031 12:131555469-131555491 CCCACCGCGCCTTCGGCCTCAGG + Intergenic
1104901099 12:132189889-132189911 CCGGCGCCTCCCCCGGCCTCGGG + Intergenic
1104910845 12:132240304-132240326 CCCGGCCCGGCTCTGGCCTCTGG + Intronic
1104985291 12:132593226-132593248 CCCGGGCCTCCTCCCGCCTCCGG + Intergenic
1104998899 12:132675932-132675954 CCCGCCCCTCCGCCCGTCTCTGG + Intronic
1105011828 12:132761551-132761573 CCCGCCCCGACGCCCTCCTCGGG - Intronic
1105472051 13:20703713-20703735 CCCGCCCCCCGTGCGGCCCCCGG + Intronic
1106568333 13:30906036-30906058 CTCTCCCCACCTCCAGCCTCCGG + Intergenic
1107037637 13:35917803-35917825 CCCGCCCTGCCCCCCGCCACAGG - Intronic
1107467913 13:40666220-40666242 CCCGCCCCTCCCCCAGCCGCAGG + Exonic
1110318545 13:74135428-74135450 CCCTCCCCGCCTCCGCGCCCCGG + Intergenic
1112290894 13:98143362-98143384 CCCGCGCCGCCGCCGCCCGCGGG + Intronic
1112291071 13:98143894-98143916 CCCGGCCCGCAACCGGCCTCAGG - Intronic
1112494546 13:99894729-99894751 CCCCCCCCCCCCCCCGCCTCAGG - Exonic
1113492900 13:110706178-110706200 CCCGCCCCGCCCACGCCCTTGGG + Intronic
1113753704 13:112793824-112793846 CCTGGCCTGCCTCTGGCCTCTGG - Intronic
1113768301 13:112894247-112894269 CCCGCCCCGCCCCCGCCCCCGGG + Intergenic
1113771465 13:112911674-112911696 CCCGCCGCGCCCTCGGCCTCGGG - Intronic
1113773356 13:112926790-112926812 CCCACCCCGCCCCCTGCCCCAGG - Intronic
1113924148 13:113930907-113930929 CCCACCCCGCCTCTTGCCTGAGG - Intergenic
1113932155 13:113974214-113974236 CCCGCCCCAGCCCCGGCCTGCGG - Intergenic
1113932169 13:113974261-113974283 CCCGCCCCAACCCCGGCCTGCGG - Intergenic
1113932183 13:113974308-113974330 CCCGCCCCAGCCCCGGCCTGCGG - Intergenic
1113932197 13:113974355-113974377 CCCGCCCCAACCCCGGCCTGCGG - Intergenic
1113932211 13:113974402-113974424 CCCGCCCCAGCCCCGGCCTGCGG - Intergenic
1113932225 13:113974449-113974471 CCCGCCCCAGCCCCGGCCTGCGG - Intergenic
1114269022 14:21090391-21090413 CCCGCCGCGCCTTCCACCTCTGG + Exonic
1115566629 14:34630173-34630195 CCCGCCCCGCTCCTGGCCGCCGG - Exonic
1115851235 14:37591948-37591970 CCGCCCCCGCCGCCGGCCCCCGG + Exonic
1116018222 14:39431989-39432011 CCGGCCCCGCCGCCGGCTGCCGG + Exonic
1117895840 14:60485780-60485802 CCCGCCGCGCCCTCAGCCTCGGG + Intronic
1118220714 14:63852927-63852949 CCCCGCCCGCCGCCCGCCTCCGG - Intergenic
1118285261 14:64465373-64465395 CCCGCGCCGCCCCGCGCCTCCGG + Intronic
1118721647 14:68598727-68598749 TCCTCCCCGCCTCCGTCTTCTGG - Intronic
1119504648 14:75162013-75162035 CCCACCCCGCCCCGGACCTCTGG - Intronic
1119522355 14:75295263-75295285 CCTGCCCCACCCCCGCCCTCTGG - Intergenic
1121080264 14:91102475-91102497 CCCCCTCCTCCTCCGGCCCCGGG + Intronic
1121144773 14:91574245-91574267 TCCGCCCCGCGCCCTGCCTCGGG + Intergenic
1121330495 14:93046580-93046602 CCCCCCCCGCCCCCGGCTGCTGG - Intronic
1121645794 14:95516531-95516553 CCCGCCCGGCCCCCGGCCCCCGG + Intronic
1122483088 14:102060359-102060381 CAGGCCCCGCTTCCGGCTTCCGG - Intergenic
1122922305 14:104885105-104885127 CCAGCCCTGGCTCCTGCCTCTGG + Intronic
1122968869 14:105144356-105144378 CCCACCCCCTCTGCGGCCTCAGG + Intronic
1123964341 15:25439471-25439493 CCTGCCCCGCCTCGGGGCTGGGG - Intergenic
1124696878 15:31870751-31870773 CCGGCTCCGCCTGCTGCCTCCGG + Intronic
1125300740 15:38252163-38252185 CCCGCGCCCGCTCTGGCCTCCGG + Intergenic
1125833180 15:42730349-42730371 CCAGCCCCGCCTCCTGCATGGGG + Intronic
1126800774 15:52295289-52295311 CCCTCCGCCGCTCCGGCCTCGGG - Intronic
1128067884 15:64775653-64775675 CCGGCCCCGCCCCCCGCCGCCGG - Intergenic
1128067927 15:64775770-64775792 CTCGCCCCGGCCCCGGCCGCGGG + Intergenic
1128544035 15:68555473-68555495 CCTGCCCAGCCCCCAGCCTCGGG - Intergenic
1128769949 15:70274475-70274497 CTGGCCCAGCCTCTGGCCTCTGG + Intergenic
1129162252 15:73753242-73753264 CCCGCCCCGCCGCCCCCCGCCGG + Intergenic
1129288002 15:74541220-74541242 CCCGCCCCGGCTGTGGCCCCCGG + Exonic
1129752804 15:78077627-78077649 TCCGCCCGGGCTCCGGCCCCCGG + Exonic
1130531245 15:84748860-84748882 CCCACCCCGCCCCCGGCCGTCGG + Intronic
1130754880 15:86752611-86752633 CCTGCCCAGCCTCTGGCCCCTGG - Intronic
1131263743 15:90903443-90903465 CCCCCGCCGCCACCGCCCTCGGG - Intronic
1131832215 15:96361216-96361238 GCCTCCCCGCCCCCGGCCCCGGG + Intergenic
1131870969 15:96764592-96764614 CCCCGCCCCCCTCCGGCCTCAGG + Intergenic
1132365199 15:101251819-101251841 CCCGCCCTGCCCGCGTCCTCCGG + Exonic
1132424904 15:101707681-101707703 CCCGCCCTGCCCCCAGCCCCTGG - Intronic
1132517035 16:370601-370623 CCCGCCCCGCTTCCGTCTTTAGG + Intergenic
1132527847 16:426268-426290 TCCGCCCCGCCGCCGCGCTCCGG + Exonic
1132551881 16:556939-556961 CCCCACCCGCCTCCCGGCTCTGG - Intergenic
1132568416 16:633657-633679 CCTGCCGCGCCTGCCGCCTCCGG + Exonic
1132570487 16:641958-641980 CCCACACCGCCGCCGGCCCCCGG - Exonic
1132612592 16:824688-824710 CCCACCCCGCCCCCGTCCCCAGG - Intergenic
1132687602 16:1168804-1168826 CTCACCCCTCCTCGGGCCTCAGG - Intronic
1132779351 16:1614311-1614333 CCGGCCCCGGCCCCGGCCCCGGG - Intronic
1132803739 16:1766372-1766394 CCAGCCCCGACCCCGTCCTCTGG + Exonic
1132827933 16:1914216-1914238 CCCGCCCCACCTCCTGCAGCTGG + Intronic
1132843685 16:1990388-1990410 CCGGCCCCTCCTCCGCCCGCAGG - Intronic
1133061189 16:3175416-3175438 CCCGCCCCGACTCAGGGCTGTGG - Intergenic
1133227873 16:4351163-4351185 GCCGCCCGGCCCCCGGCCCCCGG + Intronic
1133997998 16:10762416-10762438 CCCGTCCCTCCTTCAGCCTCAGG - Intronic
1134031409 16:10995384-10995406 CCTTCCCCATCTCCGGCCTCAGG - Intronic
1134656207 16:15949894-15949916 CCCGCTCTGCTGCCGGCCTCGGG + Intronic
1136110529 16:28061847-28061869 CCCGCCCCACCTCCTTCTTCAGG - Intronic
1136110971 16:28063512-28063534 CCCGCCGCGCCCCGGGGCTCGGG + Intergenic
1136536464 16:30902554-30902576 CTCGCCCCGCCTCCTCCCGCTGG + Exonic
1136556509 16:31010520-31010542 CCGGCCCCGCCCCCGCCCGCAGG - Exonic
1136724813 16:32349010-32349032 CGCGCCCCGCCTCGCCCCTCTGG + Intergenic
1136858639 16:33681135-33681157 CCCCCCCCACCCCCGGCCCCGGG - Intergenic
1136922830 16:34346007-34346029 CCTGCCCCTCCTCCTTCCTCTGG + Intergenic
1136981743 16:35065799-35065821 CCTGCCCCTCCTCCTTCCTCTGG - Intergenic
1137384853 16:48031879-48031901 CCAGCCCCGCCTGCTGCCCCTGG + Intergenic
1137559238 16:49492462-49492484 CCGGCCCCGGCCTCGGCCTCCGG - Intronic
1137683269 16:50368965-50368987 CCCCCCCCGCCGCCGCTCTCGGG - Intergenic
1138179771 16:54933313-54933335 CCCGGCCCGCATCCAGCCGCGGG + Exonic
1138425513 16:56929504-56929526 CCCACCCCACCTCTGGCCTGTGG - Intergenic
1138530489 16:57631799-57631821 CCTGCCCCTCCTCCTGTCTCTGG + Intronic
1139390528 16:66604572-66604594 CCCGCCCCCTCCCCGGCCTGGGG - Intronic
1139433924 16:66925572-66925594 CCCGCCCCCGCTCCCGCCCCCGG + Exonic
1139511616 16:67431220-67431242 CCCGCCCCGCCCCAGCCCGCTGG + Exonic
1139796479 16:69486858-69486880 CCTGGCCCTCCTCCTGCCTCCGG - Intergenic
1139896236 16:70289759-70289781 CCCCCCCCGCCCCCGGCTCCCGG + Intronic
1140478587 16:75251003-75251025 CCCGCCCGGCCTCGGTCCCCCGG + Intronic
1141086057 16:81096320-81096342 CCCGCCCCGCCTCCCGGCGCGGG - Exonic
1141116685 16:81315320-81315342 GCCGCCCCGCCTCCGGCTCCGGG - Intronic
1141771028 16:86089727-86089749 CCAGCTCCCCCTCGGGCCTCTGG - Intergenic
1141841964 16:86579231-86579253 CCTGCCCCGCTCCCCGCCTCCGG - Exonic
1141989645 16:87602675-87602697 CGGGCCCCGCCGCCGCCCTCGGG + Intronic
1142178918 16:88657807-88657829 GCCACCCCGCCTGCTGCCTCAGG + Intronic
1142188426 16:88705993-88706015 GCCGCGCCGCCTCTGCCCTCTGG - Intronic
1142203694 16:88772885-88772907 CCACCCCAGCCTGCGGCCTCAGG - Intronic
1142262938 16:89051058-89051080 CCCGCCGCACCTCCGCCCCCGGG + Intergenic
1203001617 16_KI270728v1_random:168745-168767 CGCGCCCCGCCTCGCCCCTCTGG - Intergenic
1203133220 16_KI270728v1_random:1705151-1705173 CGCGCCCCGCCTCGCCCCTCTGG - Intergenic
1142631613 17:1229543-1229565 CCCGCACCGACTCCAGCCTCGGG + Intergenic
1142719447 17:1766676-1766698 CCCGCCCCTCCCCCTGCCTCAGG - Intronic
1143014591 17:3884930-3884952 GCCGGCCTGCCTCCAGCCTCTGG - Intronic
1143419295 17:6776368-6776390 GCCTCCCCGCCGCGGGCCTCGGG - Intronic
1143513497 17:7408145-7408167 CCCGCCCCTCCTCCCTCCTGGGG + Intronic
1143532734 17:7514454-7514476 CCCGCCCCGCATCAAGCCACAGG - Exonic
1143958855 17:10697679-10697701 CCAGACCCGCCTCCAGCCGCAGG - Intronic
1144087776 17:11826343-11826365 CCCCCCCAGCTTCCGGCCTGGGG - Intronic
1144125244 17:12196987-12197009 CAAGCCCCACCTCCGGCGTCAGG - Intergenic
1144500520 17:15782903-15782925 CCCGCCCCGCCGCGGGACTTGGG + Intergenic
1145077456 17:19867645-19867667 CCCGGCCTGCCGCCGGCCGCTGG + Exonic
1145391030 17:22455448-22455470 CCTGCCCTTCCCCCGGCCTCAGG - Intergenic
1145905394 17:28513644-28513666 ACAGCCCCGCCTCAGCCCTCGGG + Intronic
1146404945 17:32528798-32528820 TCCTCCACCCCTCCGGCCTCTGG - Intronic
1146906611 17:36622140-36622162 CCAGCCCAGCCTCTGGCCCCTGG - Intergenic
1147250784 17:39151526-39151548 CCCGCCCCTCCGCCAGCCCCGGG - Exonic
1147325634 17:39668175-39668197 CCCGCCCCGAGTCCCGCCTCTGG - Exonic
1148663992 17:49361599-49361621 CCAGCCTCCCCTCAGGCCTCAGG + Intronic
1148684739 17:49495187-49495209 CCCGCCCGCCCTGCCGCCTCGGG - Intergenic
1148783583 17:50134724-50134746 CAGGCCCAGCCTCCGGGCTCTGG + Exonic
1148848437 17:50542203-50542225 GCGGCCCCGCCTCCGGACCCGGG + Exonic
1148909143 17:50931211-50931233 CCCGCCCTCCCTCCGCCGTCCGG + Intergenic
1149006849 17:51815103-51815125 CCACCCCCGCCTCCTGCCTGGGG + Intronic
1149491021 17:57085337-57085359 CGCGCGCCGCCGCCGGCCCCCGG - Intronic
1149491257 17:57086205-57086227 CCGGCCCCGCCTGCGGCCCAGGG + Intronic
1149660664 17:58332601-58332623 CGCGCCCCGCCCCCGCCCGCAGG + Intergenic
1149994632 17:61400133-61400155 CCGGCCCCGGCCCCGGCCCCCGG + Exonic
1150002668 17:61451670-61451692 GCCGCCCCGCACCCGGCCACCGG + Intergenic
1150108372 17:62478473-62478495 TCCTCCGGGCCTCCGGCCTCGGG + Intronic
1150108750 17:62479516-62479538 CCCGTCTCTCCTCCGGCCGCCGG - Intronic
1150221233 17:63496995-63497017 CCCACCCCACCTCCAGCCTTGGG + Intronic
1151417130 17:73973860-73973882 CCCGCCCCCCCCCAGGCCTCTGG + Intergenic
1151536584 17:74742302-74742324 CCCTCCCCAACTCCAGCCTCTGG - Intronic
1151674153 17:75589281-75589303 CCCGCCCCTCGTCCGGTTTCCGG - Intergenic
1151780294 17:76240724-76240746 CCCGCCCCGCCGCGGGCACCCGG - Intergenic
1151797034 17:76353430-76353452 CCCGCCCCACCTCCTGCACCTGG - Intronic
1151854491 17:76711064-76711086 CCCCCGCCCCCTCCGGCCCCGGG + Intergenic
1151954392 17:77373271-77373293 CCCGCCCCGCCCCCGCCTCCCGG - Intronic
1151980023 17:77503165-77503187 CCCGCCGCTTCTCCTGCCTCTGG + Intergenic
1152236575 17:79142229-79142251 CCCTCCCGGTCCCCGGCCTCTGG + Intronic
1152362750 17:79839978-79840000 CCCGCCTCGCCTCCAGGCTCCGG + Intergenic
1152586889 17:81193216-81193238 CCTCCCCTGCCTCCGGCCTGAGG + Intronic
1152628096 17:81397490-81397512 CCCGGCCCCTCTCCGGCCTTCGG + Intronic
1152724843 17:81940096-81940118 CCCGCGCCACCTCCAGCCTGCGG + Exonic
1152840672 17:82566056-82566078 CCCTCCCCGCCCCCAGCCCCTGG - Intronic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1153480739 18:5543821-5543843 CGCGCCTCGCCCCAGGCCTCGGG + Intronic
1154416287 18:14177699-14177721 CCCTACCGGCCCCCGGCCTCGGG - Intergenic
1154492741 18:14933980-14934002 CCTTGCCCGCCTCCCGCCTCTGG + Intergenic
1155171730 18:23271714-23271736 CCAGCCCCATCTCCGACCTCTGG + Intronic
1156350436 18:36297664-36297686 CCCGCCCCGCCCCCCGCGGCCGG + Intergenic
1157387067 18:47266319-47266341 CCCACCCCCACCCCGGCCTCTGG - Intergenic
1157464188 18:47930512-47930534 CCCGCCCCGCCCCCAGGCCCGGG + Exonic
1158976573 18:62715952-62715974 CCCGCGCCGCCTCCTGCGCCCGG - Exonic
1160114868 18:76068468-76068490 CCCGCCCCTCCTCCAGCCTCTGG + Intergenic
1160388491 18:78512525-78512547 CCCACCCAACCTCAGGCCTCTGG - Intergenic
1160500750 18:79400254-79400276 CCCGCCCCGCCCCCGCCCCCCGG - Intronic
1160566304 18:79788468-79788490 CCCGCTCCGCCGCGGGCCGCAGG + Intergenic
1160631269 18:80247597-80247619 CCCGCCCCGCCCCCGAGCCCCGG + Intergenic
1160738711 19:676336-676358 CCCGCCCCGCCCGCGGCCCGCGG + Intergenic
1160749799 19:728350-728372 TCCGGCCGGCCTCCCGCCTCTGG - Intronic
1160862133 19:1241929-1241951 GCCGCCCCGGCTGCCGCCTCTGG + Exonic
1160880101 19:1315813-1315835 CCCCCCGCGGCTCCGGGCTCAGG + Intergenic
1160909238 19:1467255-1467277 CCGGCCCCTCCTCCCGCCGCCGG - Exonic
1161014769 19:1978214-1978236 CCCCTCCTGCCTCCTGCCTCGGG + Intronic
1161065633 19:2236062-2236084 CCGACCCGGACTCCGGCCTCCGG + Intronic
1161203702 19:3029378-3029400 CCCGCGCCCCCCCCGGCCCCCGG + Intronic
1161225943 19:3146029-3146051 CCCGCCCCTTCTCCGTGCTCCGG + Intronic
1161299248 19:3534931-3534953 CCCGCCCAGCCGCCTTCCTCGGG - Intronic
1161821053 19:6531514-6531536 TCCTCCCCGCCCCCGGCCTGGGG - Intronic
1162022527 19:7874282-7874304 TCACCTCCGCCTCCGGCCTCCGG + Exonic
1162079408 19:8209447-8209469 CCAGCCCCGCCGCCGGCCCTCGG + Exonic
1162104797 19:8363953-8363975 CCCGCCCCCGCTCCAGGCTCAGG - Intronic
1162604266 19:11694754-11694776 CCAGCCCCTCCTCCCGTCTCGGG + Intergenic
1162799853 19:13104433-13104455 CCCCCCTCGCCCCGGGCCTCAGG + Intergenic
1162914107 19:13865291-13865313 CCCCCCCCGCCCACGGCCTAGGG + Intronic
1162932376 19:13963432-13963454 CCCGCCCAGCCTGCAGGCTCGGG + Intronic
1162944160 19:14032150-14032172 CCCACCCCGCCCCGGGGCTCCGG - Intronic
1162951107 19:14072654-14072676 CCCGCCCTGGCCCCGCCCTCGGG - Intronic
1163023571 19:14496354-14496376 CCCCCCCCTCCTCAGCCCTCCGG - Intergenic
1163210573 19:15836887-15836909 CCAGCTCCTCCTCCGGTCTCGGG + Intergenic
1163676855 19:18659751-18659773 GGCGCCCCTCCTCCGGCCCCGGG - Intronic
1163713467 19:18860753-18860775 CCCTCACGGCCTCCAGCCTCAGG + Intronic
1163755770 19:19105461-19105483 CCGGCCCCGCCTCCGCACTTTGG + Intronic
1164137652 19:22428387-22428409 GCCGCCCCTCCTCCGCCCGCTGG + Intronic
1164162135 19:22634207-22634229 CCCCCCCCCCCCCCGCCCTCAGG - Intergenic
1164179631 19:22807461-22807483 GCCGCCCCTCCTCCGCCCGCTGG + Intergenic
1164834643 19:31349562-31349584 CCCCCTCCTCCTCTGGCCTCTGG - Intergenic
1165157258 19:33796229-33796251 CCCGGGCCTCCTCCGGGCTCGGG - Intronic
1165682639 19:37790650-37790672 CCCGCGCCGCCTTCTTCCTCAGG - Intronic
1165871405 19:38975794-38975816 GCCGCCCCTCCTCCGGCTGCGGG + Exonic
1166367439 19:42284553-42284575 CCCCCCCCGCCGCCCCCCTCCGG - Intronic
1166529328 19:43533387-43533409 CCCGGCGCGCGTCCGGCGTCGGG - Exonic
1166741806 19:45118901-45118923 CCCGGCCCACCTGCCGCCTCTGG + Intronic
1166781466 19:45345634-45345656 CCCGCAGCGCCTCCAGCCCCTGG - Exonic
1166869823 19:45864414-45864436 CCCGCCCCCGCTCCGGCCCCGGG - Exonic
1166876673 19:45901917-45901939 CCCGCCCCCACTCCTGCCCCCGG - Intronic
1166982414 19:46639188-46639210 CAGGCCCCGCCTCCGTCGTCGGG - Intergenic
1166996297 19:46721184-46721206 CCACCCCCACCTCCTGCCTCAGG - Intronic
1167072986 19:47231248-47231270 CCCGCCCCGCCCCCGCCCGGCGG + Intronic
1167347432 19:48955233-48955255 CCCGCACCACTTCCTGCCTCTGG + Intronic
1167376412 19:49114547-49114569 CCCGCCCCGCCCACCCCCTCCGG - Intronic
1167415016 19:49365487-49365509 CCAGTCCCTCCTCCGGCCCCAGG + Exonic
1167439426 19:49499915-49499937 CCCCCGCCCCCTCCGGTCTCTGG + Intergenic
1167574329 19:50310492-50310514 CCCTCCCAGCCTCCAGGCTCTGG + Exonic
1167767209 19:51491432-51491454 CACTCCCCGCCCCCGGCCTCTGG - Exonic
1168072828 19:53962312-53962334 CCCGCGCCGCCTCCGCCCCAGGG - Intergenic
1168354226 19:55691922-55691944 CCAGCCCCCACGCCGGCCTCTGG + Exonic
1168584759 19:57583550-57583572 TCGGCCCCGCCTCCCGCCTCTGG + Intronic
1168722749 19:58563242-58563264 GCGGCCCCGGCTCCGGCCCCTGG + Exonic
926117840 2:10224564-10224586 CCCACCCCGCCTCCAGGCTGAGG - Intergenic
926130930 2:10302832-10302854 CCCGCCCCGGCCCCCGCCTCCGG + Intergenic
926267923 2:11343862-11343884 CCCGCCCTGCTTCCGGCAGCCGG - Intronic
927213227 2:20651191-20651213 TCCGCCCCGCCTCTGGCCACAGG - Intergenic
927689204 2:25195785-25195807 CCCTCCCACCCTCCTGCCTCTGG + Intergenic
927982065 2:27380542-27380564 CCCGACGCGCCTCCGGCCTGCGG + Exonic
929539572 2:42809961-42809983 CGCGCGCCGCCACCGGCCCCTGG + Intergenic
930730444 2:54723679-54723701 CCCTCCCCGCCTCCCGCACCCGG - Intronic
931291998 2:60881585-60881607 CCCGCTCCGCCCCCTGCCCCTGG + Exonic
931671615 2:64653498-64653520 CCGGCCCCTCCTCCGCCCTCCGG + Intronic
932313920 2:70767475-70767497 CCCGCTCGGCCGCCGCCCTCCGG - Intronic
932355987 2:71068737-71068759 TCCGCCCCGCCTTCGGGCCCAGG - Intronic
932567156 2:72917450-72917472 CCCGCCCCGCCCCCCACCTTGGG + Intronic
932591466 2:73070632-73070654 CCCTCCCCGGCTCCGGTCTCCGG + Intronic
932776417 2:74530546-74530568 CCCGCCCGCCCTCCAGCCTGTGG - Intronic
932780233 2:74554700-74554722 CCCGCCCCGCCTCCCGCCGCAGG + Exonic
933666998 2:84971669-84971691 GCCGCCCCGCCTCCAGCACCAGG - Intronic
933847465 2:86337420-86337442 CCCTCCCCGCCCCCGGCCCCGGG - Intronic
934907354 2:98216983-98217005 CCCGCCCCGCACCCAGTCTCAGG + Intronic
935046719 2:99489785-99489807 CCCACCCCGCCGCCGGCCCGGGG + Intronic
935255856 2:101308844-101308866 CGCGCCCCGCCTCGGCCCACAGG - Intergenic
935396947 2:102619500-102619522 CCCGCCCCGCCCCCGCCCGCGGG + Intergenic
936389011 2:112055209-112055231 CCGGCCCCGCCTCCGCGCTCGGG + Exonic
936517916 2:113193716-113193738 CCTGCCCGGTCTCAGGCCTCTGG - Intronic
937132502 2:119524084-119524106 CTCGCCCTTTCTCCGGCCTCGGG - Intronic
937212538 2:120284794-120284816 CCCGTCCCACCCCTGGCCTCTGG + Intronic
937262410 2:120595076-120595098 CCCGCCCCGCCCCGCCCCTCTGG + Intergenic
937368969 2:121284889-121284911 CCCGCCCAGCGTCCCGCCTAGGG - Intronic
937921584 2:127135347-127135369 CCCCCTCATCCTCCGGCCTCCGG + Intergenic
938263806 2:129912411-129912433 CCCGCTAGGCCTCAGGCCTCAGG - Intergenic
939096596 2:137839692-137839714 CCCTCACCTCTTCCGGCCTCTGG + Intergenic
939715419 2:145578086-145578108 CCCGTCCCACCTCCAGCCCCTGG + Intergenic
939969665 2:148644970-148644992 CCCGCCCCGCCGCCGCCGCCCGG + Exonic
941930082 2:170929832-170929854 CAGGCCCCGCCTCCGGACTGCGG - Intronic
941934661 2:170973625-170973647 CGCGCCCCGCCAGCGGCCGCGGG + Intergenic
942045117 2:172095516-172095538 CCCGCCCAGCATCAGGCCGCAGG + Intergenic
945102444 2:206274753-206274775 CCCGCGCCGCTTCTCGCCTCCGG + Exonic
945780550 2:214166405-214166427 CCCTCCACGCCCCCGGGCTCGGG + Intronic
946322010 2:218959858-218959880 CCCGCCGGGCCTCCGGCCCTTGG - Exonic
947568317 2:231210199-231210221 CCTGCTCCGCTTCAGGCCTCTGG + Intronic
947651078 2:231786638-231786660 CCCGCCCCGCCCCCGCCTTGGGG + Intronic
947715351 2:232336360-232336382 CTGGCCCCTCCTTCGGCCTCTGG - Intronic
948194795 2:236087300-236087322 CCCGCCCCCACCCCGGGCTCTGG - Intronic
1168760825 20:348229-348251 CCCGCCCCGCCCGCCTCCTCCGG + Intronic
1168765829 20:381201-381223 CCCTCCCGCCCCCCGGCCTCCGG - Intronic
1168769759 20:407957-407979 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1168769776 20:407986-408008 CCGGCCCCGCCCCCAGCCCCCGG + Intronic
1168777781 20:462358-462380 ACGGCCCCACCTCCGGCCACTGG - Exonic
1168897984 20:1337057-1337079 CCTGCCCCGACTCCACCCTCAGG - Intronic
1168965125 20:1894336-1894358 CTCCCCTCGCCTCCGGACTCCGG - Exonic
1169122681 20:3106851-3106873 CCTGCCCGGCCTCCTGCCTGTGG - Intergenic
1169130600 20:3164738-3164760 GCCGCCCCACCTCCCGCCGCAGG + Exonic
1169143606 20:3239065-3239087 CCCGCCGCGCCCCCGGGTTCAGG + Intronic
1169224312 20:3846824-3846846 CCCGCCCCGCCTCCTCGCTGCGG + Exonic
1169260323 20:4133728-4133750 CCTGCCCCACCTCCAGCCCCTGG - Intronic
1169800367 20:9507205-9507227 ACCGCCTCGCCTGCAGCCTCGGG - Intergenic
1170156616 20:13274671-13274693 CCCCCCCCGCGCCCGGCCCCCGG + Intronic
1170292016 20:14781197-14781219 CCCGCCCCACCTCAAACCTCTGG + Intronic
1171458694 20:25286500-25286522 CCAGCCCCGCCACAGGCCACAGG - Intronic
1172255021 20:33509975-33509997 CCCACCCCACCACAGGCCTCGGG + Intronic
1172618700 20:36306388-36306410 CCCGCCCCGGCTCCGGCCCGCGG - Exonic
1172627204 20:36354089-36354111 GCCGGCCGGCCTCCCGCCTCAGG + Intronic
1172702843 20:36863419-36863441 CCCGGCGCGGCTCCGGCCGCTGG + Exonic
1172841011 20:37902908-37902930 CCGGCCCCGCCTCCGCACTCGGG + Intergenic
1173220068 20:41125274-41125296 CCAGCCCTGCCTCCAGCCTCAGG - Intergenic
1173823263 20:46031779-46031801 CCCTCCCCGCCCCCGCCCCCTGG - Intronic
1174045182 20:47728142-47728164 CCCTCCCCCTCTCCGGCCTGTGG - Intronic
1175847036 20:62064852-62064874 CCCGCCCCCGCCCCGGCCGCCGG - Exonic
1175847200 20:62065286-62065308 CCCGCGCCGGCCCCGGCCCCGGG - Exonic
1175945241 20:62555568-62555590 CCCACCCTGCCACAGGCCTCAGG + Intronic
1176077408 20:63254629-63254651 CCACCCCCGCCTGCGGCCCCTGG + Intronic
1176298131 21:5085234-5085256 CCGGCCCCGCCTCTGTCATCAGG - Intergenic
1176414871 21:6468297-6468319 ACGGCCCCGCCCGCGGCCTCCGG - Intergenic
1176549375 21:8214696-8214718 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1176555776 21:8253458-8253480 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1176557268 21:8258919-8258941 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1176568303 21:8397730-8397752 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1176574713 21:8436492-8436514 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1176576210 21:8441954-8441976 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1176611327 21:8987785-8987807 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1177775525 21:25562158-25562180 CCAGCGCCGCCTGCAGCCTCGGG + Intergenic
1178314824 21:31559107-31559129 GCCCCTCCGCCTGCGGCCTCGGG + Intronic
1178610222 21:34073450-34073472 CCCGCCCCCTCTCCGCCCGCGGG - Intronic
1179674942 21:42974822-42974844 CCCTCCCCGCCCCCTGCCCCGGG - Intronic
1179690371 21:43076619-43076641 ACGGCCCCGCCCGCGGCCTCCGG - Intronic
1179858898 21:44176715-44176737 CCGGCCCCGCCTCTGTCATCAGG + Intergenic
1179891678 21:44338774-44338796 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891692 21:44338809-44338831 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891706 21:44338844-44338866 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891720 21:44338879-44338901 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891755 21:44338958-44338980 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891769 21:44338993-44339015 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179891784 21:44339028-44339050 CCCGCCCCGGCTCCTCCCTCCGG + Intronic
1179925151 21:44530037-44530059 CCCGAGCCTCCTCCGGGCTCTGG - Intronic
1180201700 21:46228631-46228653 CCCGCCCCAACGCCGGCCGCCGG + Intronic
1180782548 22:18529185-18529207 CCCGCCCCGCCCACGCCTTCAGG - Intronic
1181126100 22:20703214-20703236 CCCGCCCCGCCCACGCCTTCAGG - Intergenic
1181239439 22:21468523-21468545 CCCGCCCCGCCCACGCCTTCAGG - Intergenic
1182073060 22:27476906-27476928 CTCGCCCCACCTCCCGTCTCAGG - Intergenic
1182260572 22:29071147-29071169 CCCCCCCCACCTCCTGCCACCGG - Intergenic
1182315485 22:29444115-29444137 CCTGCCACCCCTCCGGCCTGGGG - Intergenic
1182335557 22:29581124-29581146 CGCGCCCCGCCTCCGCCACCAGG - Exonic
1182469951 22:30542382-30542404 CTCCCCTCGCCTCCGGACTCCGG - Intronic
1182518460 22:30871953-30871975 CTCGCCCAGCCTCAGGCCCCAGG - Intronic
1182696992 22:32204533-32204555 CCCTCCCCGCCCCCTGCCGCAGG + Intergenic
1183050644 22:35257875-35257897 CCCGGGCCGTCTCCGCCCTCGGG + Intronic
1183585897 22:38752772-38752794 CCCCCCCGGCCCCCGGCCCCCGG + Intronic
1183702400 22:39457714-39457736 CCCGCCCCCACCGCGGCCTCCGG - Intronic
1183815144 22:40293606-40293628 CCCCCTCCGCCCCCGCCCTCAGG - Intronic
1183958847 22:41398772-41398794 CCCGCCCTGCCTCAGGCCAAAGG - Exonic
1184292021 22:43502470-43502492 CCTGCCCTGCCTCAGGCTTCAGG - Intronic
1184782429 22:46655962-46655984 CCCGCCCCGCCTCCGTTCTGGGG - Intronic
1185276299 22:49951468-49951490 CCCGCCCAACCTCCTGCCACAGG - Intergenic
1185333443 22:50261623-50261645 CCCGCCCGCCCGCCGGCCGCTGG + Exonic
1185335688 22:50270056-50270078 CTCGCCCTGCCTCCGCCCCCGGG - Intronic
1185368146 22:50446357-50446379 CCCCCCCCCCCCCCCGCCTCCGG + Exonic
1185409243 22:50673912-50673934 CCCCCCCCGCCCCAGGCCTGGGG - Intergenic
1203252761 22_KI270733v1_random:125543-125565 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1203254260 22_KI270733v1_random:131012-131034 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1203260817 22_KI270733v1_random:170629-170651 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1203262316 22_KI270733v1_random:176091-176113 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
950652126 3:14413696-14413718 CCAGCCCCACCCCCGGCCCCAGG - Intronic
952354281 3:32570448-32570470 CGCGCTGCGGCTCCGGCCTCCGG - Intronic
952582419 3:34850172-34850194 CCCGCTCCGCCACCAGCTTCAGG - Intergenic
953464425 3:43106173-43106195 CCCGCGCCGCCACCAGCCTGCGG + Intergenic
953761336 3:45689512-45689534 CCCGCCGCGCCTCAGGCCTCTGG - Intronic
953871368 3:46630047-46630069 CCCGCACCGCCTCCCTCCGCAGG - Intergenic
953909204 3:46883291-46883313 CCCGCCGCCCGCCCGGCCTCCGG + Intronic
954113137 3:48446903-48446925 CCCGGCCCGCCGCCGGGCACCGG + Exonic
954456244 3:50601271-50601293 CCCGCTCCCCCTCCCGCCTGCGG + Intergenic
954558883 3:51539085-51539107 CCCGCCAAGCCTCCGGCCACTGG - Intergenic
954693119 3:52406409-52406431 CCCGCCCCGGCCCCGCCATCAGG + Intronic
956761242 3:72447004-72447026 CACTCCCCGTCGCCGGCCTCGGG - Intergenic
958698251 3:97554667-97554689 TCCGCCCAACCTCCAGCCTCAGG + Intronic
959085678 3:101849214-101849236 CGCCTCCCGCCTCCCGCCTCCGG - Intronic
961003397 3:123388985-123389007 CCCGCCCCGCCTCCTTCCCCAGG - Intronic
961028811 3:123584799-123584821 TCCGCCCCGCCGCTGGCCGCAGG + Intronic
961034429 3:123632513-123632535 GCCTCCTCGCCTCTGGCCTCTGG + Intronic
961446225 3:126983013-126983035 CCCGCCCCGCCCCCGGGCTCTGG + Intergenic
961573956 3:127819934-127819956 CCTGCCCTGCCTCCAGCCCCTGG - Intronic
961614779 3:128170135-128170157 CCCGCCCCGCCTCCCCCGCCTGG + Intronic
961754921 3:129121836-129121858 CCGCCCCCGGCTCCGCCCTCAGG + Intronic
961755030 3:129122192-129122214 ACCGCCCCGACTCCGCCCACAGG + Intronic
961755042 3:129122225-129122247 CCCGCCCCGACTCCGCCCTCAGG + Intronic
963028515 3:140942678-140942700 CACGCCCCACCTCGGACCTCGGG + Intronic
963214099 3:142724846-142724868 CCCGCCTCGCCTGCTGCCTCAGG + Intronic
966839603 3:184077915-184077937 CCAGCCCATCCTCCCGCCTCCGG + Intergenic
967762343 3:193240604-193240626 CCCGCCCCGCCCCCCTCCCCCGG - Intergenic
968086871 3:195877771-195877793 CCAGGCCTGCCTCCAGCCTCTGG - Intronic
968213343 3:196867799-196867821 CCCGCCCCGCCTCCCGACCCGGG - Intergenic
968319063 3:197749821-197749843 CCCGCCCCGCCCGCAGCCGCGGG + Exonic
968454293 4:689206-689228 CCGGCCCCACCTCCGCCCGCAGG - Exonic
968506443 4:973353-973375 CCGGCCCCGGCCCCGGCCCCGGG + Exonic
968671824 4:1856142-1856164 GCCGCCCCGCCCCGCGCCTCCGG - Exonic
968729384 4:2262451-2262473 CGCGCCCCGCCACCGGCCATTGG - Intergenic
968922951 4:3532114-3532136 CCCCCTCCGCCTCCGACCCCTGG + Intronic
969052798 4:4385375-4385397 CCCGCCCCGCCCCCCGTCTCAGG - Intronic
969658009 4:8509188-8509210 CCCTCCCTCCCTCCGTCCTCAGG - Intergenic
975622171 4:76306584-76306606 CCCGCCCCGCTCCCCGCCCCTGG - Intronic
977693769 4:99946247-99946269 CCAGCCCCGGCTCCGGGCTGGGG - Intronic
978776554 4:112511150-112511172 TCAGCCCCTCCTCCTGCCTCCGG + Intergenic
980920875 4:139084366-139084388 GCCGGCCCGCCTCCCGCCGCCGG + Intronic
981508365 4:145527954-145527976 CCCGCCCCGGCCCCGGCCCTGGG + Intronic
981722476 4:147815465-147815487 CTCCCCCCGCCCCCCGCCTCCGG - Intronic
984908164 4:184649063-184649085 CCAGCCCAGCCTCCCGCCCCCGG + Intronic
984908209 4:184649187-184649209 CCGGCCCAGGCTCCCGCCTCCGG + Intronic
985129655 4:186726757-186726779 CCCGCCTCGCCCCCCGCCCCGGG + Intergenic
985999607 5:3620219-3620241 CCAGCACCCCCTCCAGCCTCTGG + Intergenic
990456613 5:55994987-55995009 CCCGCCCCGCCGCGGGACTGGGG - Exonic
990910197 5:60844381-60844403 GCCGCCCCGGCTCCTCCCTCCGG - Exonic
992098123 5:73381372-73381394 CCCACCTCGCCTCCAGCCGCCGG + Intergenic
992226217 5:74621670-74621692 CCCCCCCCGCCCCCCGCCCCCGG + Intergenic
992778180 5:80106001-80106023 CCCGCCCCTGCTCTGTCCTCAGG - Intergenic
997259609 5:132455845-132455867 CCCTCCCAGCCTCCAACCTCTGG - Intronic
997470494 5:134114664-134114686 CCCGCCCCGCCCCCGGCACTCGG + Intergenic
999250930 5:150181941-150181963 GCAGACCAGCCTCCGGCCTCTGG + Intronic
999300108 5:150485870-150485892 CCCGCCCCGGCCCCCGCCCCGGG + Intronic
999513195 5:152274234-152274256 CCTGCCCCACCTCCAGCCTCTGG + Intergenic
1000043061 5:157499602-157499624 CACACTCCGCCCCCGGCCTCAGG + Exonic
1001106067 5:168855706-168855728 CCCTCCCTGCCCCCAGCCTCTGG - Intronic
1002055339 5:176595390-176595412 CCTGCCCCTCCTGGGGCCTCTGG - Intronic
1002058101 5:176610152-176610174 CCCGCCCCGCGCCCCGCCCCGGG + Intergenic
1002121157 5:177006096-177006118 TCCGCGCCGCCTCACGCCTCGGG - Intronic
1002559464 5:180071747-180071769 CCCGCCCCGCCTCTAGGCGCCGG - Exonic
1002893399 6:1357221-1357243 TTCCCCCTGCCTCCGGCCTCTGG - Intergenic
1003175956 6:3752158-3752180 GCAGCCCCGCCTCCGGACCCCGG - Intergenic
1003218249 6:4135199-4135221 CCCGCCCGGAGTCCGGCCCCAGG + Intronic
1003315012 6:5004063-5004085 CCCGCCCCGCCCCTTCCCTCCGG + Intronic
1003328835 6:5112811-5112833 CCTGCCCCAGCTCCAGCCTCTGG - Intronic
1004157903 6:13186764-13186786 CCCGCCCCACCTCCGGTCTGTGG - Intronic
1005891884 6:30147005-30147027 CCGGCCCAGCCTCCAGCCTGTGG - Exonic
1006153884 6:32003754-32003776 CCTGTCCTGCCCCCGGCCTCTGG - Intergenic
1006155199 6:32009925-32009947 CCCACCCAGCCCCCGGCCCCGGG + Intergenic
1006160192 6:32036491-32036513 CCTGTCCTGCCCCCGGCCTCTGG - Intergenic
1006161505 6:32042659-32042681 CCCACCCAGCCCCCGGCCCCGGG + Intronic
1006333728 6:33410219-33410241 CTAGCCCCGCCTCTGGACTCTGG - Intergenic
1006606295 6:35259875-35259897 CCCGCCCGGCCTCCCGCCCTGGG - Intronic
1006665134 6:35688403-35688425 CCCGCTCCGCCTCCGGTCTCTGG - Intronic
1006860834 6:37170665-37170687 CACCCCCCGCCTCCGGCCCGGGG + Intronic
1007363730 6:41375679-41375701 CCCGCCCCGGCTCCCGCTCCGGG - Intergenic
1007378171 6:41470428-41470450 CCCGCCCCACCCGCGCCCTCAGG + Intergenic
1007400444 6:41599731-41599753 CAGGCCCCGCCTCTGGCCTCAGG - Exonic
1007584259 6:42979048-42979070 CCAGCTCCGCCGCCGGCCACGGG + Exonic
1007701929 6:43770812-43770834 TCCACCCCGCCTCCGGGCGCGGG - Exonic
1010786256 6:80004537-80004559 GCCGCCCCTCCTCCTGCGTCAGG - Intronic
1011983962 6:93419140-93419162 CCGGCCGCGCCTCCGGCGCCGGG - Intronic
1012170823 6:96015585-96015607 CTCTCCCCGCCACCGGCCTGTGG - Intergenic
1014632459 6:123803654-123803676 CCCGCCCCACCCCCGCCCGCCGG + Intergenic
1015994941 6:138987944-138987966 CCGGCTCCGGCTCCGGCCGCGGG + Exonic
1016010774 6:139135568-139135590 CCCGCCGCGCCTCCGGCGCCCGG - Exonic
1016864008 6:148747941-148747963 CCCGCCCCACCTCCGCCACCCGG + Intronic
1017614692 6:156232478-156232500 CCTGCCTTGCCTCCAGCCTCAGG + Intergenic
1018368911 6:163149643-163149665 CCCGCACAGCCTCCGCCCTCTGG + Intronic
1018682555 6:166275840-166275862 CCCGCGCCGCTTCCGCTCTCCGG + Intergenic
1019297463 7:285776-285798 CCCTTCCCGCCTCAGTCCTCGGG + Intergenic
1019343102 7:517652-517674 CCAGCCCCACCCCCGGCTTCTGG - Intronic
1019348162 7:540590-540612 CCCACCCCGCCTAAGGTCTCCGG + Intergenic
1019472641 7:1229677-1229699 CCCGCCCGGGCCGCGGCCTCTGG - Intergenic
1019533267 7:1514226-1514248 CTGCCTCCGCCTCCGGCCTCCGG - Intergenic
1019554100 7:1620011-1620033 CCCGCCCCCGCCCGGGCCTCAGG + Intergenic
1019570865 7:1711404-1711426 CCCTCCCCTCCTCTGGCCTCTGG - Intronic
1019708647 7:2508344-2508366 CCCGACCCGCCTCCTCCTTCCGG + Intergenic
1019765127 7:2844252-2844274 CACGCCCCGCCGCTCGCCTCAGG + Exonic
1020137380 7:5594579-5594601 CCCGCGCCGCCCCCGGGCCCAGG + Intronic
1020178091 7:5898777-5898799 CCCGCCCCGGCCCCCACCTCGGG - Exonic
1020278227 7:6637282-6637304 CCCGCCCCGCCCGCGCCCGCGGG - Intergenic
1020304836 7:6826198-6826220 CCCGCCCCGGCCCCCACCTCGGG + Exonic
1020347789 7:7183236-7183258 CCCGCCCCGCCGCAGACCTGTGG + Intronic
1023230726 7:38025309-38025331 CCAGCACCGGCTCCAGCCTCTGG + Intronic
1025769923 7:64495074-64495096 CCCGCCCCTCCTCCTTCCCCTGG + Intergenic
1029839580 7:103347797-103347819 CCCGCCCCAGCTCCGAGCTCCGG - Intronic
1030033470 7:105388987-105389009 CCCGCCCCGCCCCCACCCGCCGG + Intronic
1030715110 7:112800495-112800517 CCTGCCCAGCCTGCTGCCTCTGG - Intergenic
1032074566 7:128830335-128830357 CCCGCCGCGCCCGCGGCCCCCGG - Intergenic
1032708235 7:134440665-134440687 CCAGCCCAGCCTCAGGACTCTGG - Intergenic
1033390647 7:140924609-140924631 CCGGCGCCGGCGCCGGCCTCGGG + Exonic
1033486775 7:141797894-141797916 TCCACCCCGCCCCCAGCCTCTGG + Intergenic
1034349038 7:150404895-150404917 GCCGCTCCGCCGCCGGGCTCCGG + Intronic
1034425004 7:151009630-151009652 CCAGCCCCACCCCCGGCCCCAGG + Intronic
1034446226 7:151115516-151115538 CCCGCACCGCCGCCGGCCTCTGG + Intronic
1034522703 7:151632538-151632560 CCCGCCCCCACTCCGCCCCCCGG + Intronic
1034620286 7:152451663-152451685 CCCCCCCCGCCCCCCGCCGCAGG + Intergenic
1034945812 7:155261028-155261050 CCAGCCCTGCCTCTGTCCTCTGG - Intergenic
1035238814 7:157517144-157517166 CCCGCCCTGCCTGCAGCCTCAGG - Intergenic
1035266575 7:157692968-157692990 CCCTCCCCGCCACCCTCCTCCGG + Intronic
1035389423 7:158495752-158495774 GCAGCCCCGCCTCCGGGCTGAGG - Intronic
1035404263 7:158587840-158587862 CCGGCCCCGCCCCCGGCGGCAGG + Intergenic
1035535296 8:386335-386357 CCCGCCCAGCCTCTGGCCTGAGG + Intergenic
1035732768 8:1864557-1864579 CCAACCCCACCTCCTGCCTCGGG + Intronic
1036699480 8:11002543-11002565 CCCGCCCAGCCACAGGGCTCTGG - Intronic
1037560979 8:20074115-20074137 CACGCCCCACCTCCTGACTCTGG - Intergenic
1037802862 8:22044575-22044597 CCAGCCCCGCCTCCTGGCCCAGG - Intronic
1038038390 8:23705000-23705022 CCGGCCTCGGGTCCGGCCTCGGG + Intronic
1038542486 8:28401832-28401854 CCCGCCCCACCTCCGGCTCCGGG + Intronic
1038816386 8:30909401-30909423 CCCGCCCCCACTCCCCCCTCAGG + Intergenic
1039484431 8:37899673-37899695 CCAGCCCCGCCTCCGGCGCCCGG - Intergenic
1039843444 8:41309334-41309356 CCCGCGCCGCCTCCGACCGCAGG - Exonic
1041045076 8:53880746-53880768 CGCGCCCCGCGTGGGGCCTCGGG + Intronic
1041244881 8:55880247-55880269 GCCGCACCGCCTCTGGGCTCCGG + Intronic
1042591489 8:70402762-70402784 CCCGGTCCGCCTCCCGCCCCCGG + Intronic
1043296207 8:78666282-78666304 CCCGCCGCGCCTCCGGAGGCTGG + Intronic
1043366146 8:79535799-79535821 CCCCCCCCGCTTCTGGCTTCTGG + Intergenic
1044467742 8:92526376-92526398 CCCACCCTGCCTCCTGCCACTGG + Intergenic
1045432055 8:102123818-102123840 CCGGCCCCGGCCCCGGCCCCCGG + Intronic
1045443655 8:102239121-102239143 GCCTCCCCGCCTGCGGCCTAAGG + Intergenic
1047211896 8:122847341-122847363 CCCGCCCTGCCTCCTGCCCCAGG + Intronic
1047980346 8:130174592-130174614 CCCACCCCTCCTCCCACCTCTGG + Intronic
1048586171 8:135776156-135776178 CCTCCCCCTCCTCTGGCCTCTGG - Intergenic
1049336667 8:142090195-142090217 GCGGCCCCGCCTCCACCCTCTGG - Intergenic
1049693688 8:143973578-143973600 CCCGCCCCGCCCCCGCACCCAGG + Intronic
1049843758 8:144790003-144790025 CCACCCCCGCCCCCGGCCTCGGG + Intronic
1051058777 9:13021222-13021244 CCCCCCCCCCCACCAGCCTCTGG - Intergenic
1051272292 9:15367246-15367268 CCCACCCCTACTCCAGCCTCTGG + Intergenic
1053128802 9:35604268-35604290 GCAGCCCCTCCTCCGGCCTTAGG + Intergenic
1053188296 9:36037245-36037267 CCCGCCTCGGCACCAGCCTCTGG - Intronic
1053290453 9:36876202-36876224 CCCACCTCTCCTCTGGCCTCAGG + Intronic
1053312371 9:37027727-37027749 CCCGCCCCGCCCCCGCCCGGAGG - Intronic
1053397413 9:37787140-37787162 CCCGCCCAGCCACCGCCTTCGGG - Intronic
1054820449 9:69516207-69516229 CCCGCCTCGCCGCCGCCCGCGGG + Exonic
1055785205 9:79863731-79863753 CCGGCCCCGGCCCCGGCCCCGGG + Intergenic
1057298109 9:93861023-93861045 ACCGCCCCGGCTCCTGCCTTAGG - Intergenic
1058412311 9:104747631-104747653 CCCGCCGCGCCTCCCGCGCCGGG + Intergenic
1058724377 9:107787989-107788011 CCGGCCCCGCCTCCAACATCGGG - Intergenic
1059375400 9:113876641-113876663 CCAGCGCCCCCTCCGGCCCCGGG + Intronic
1059769855 9:117414888-117414910 CCGGCCCCGGCTCGGGGCTCCGG - Exonic
1060280777 9:122214173-122214195 CCCGCCCCGCCACCCGGGTCCGG + Intronic
1060543969 9:124449939-124449961 CCGGCTCTGCCTCCGGCCACTGG + Intergenic
1061003785 9:127917029-127917051 CCGGCCCCGCCCCCTGCCTCTGG - Intronic
1061348200 9:130043219-130043241 CCCGCCCCTCCCCCGCTCTCCGG - Intergenic
1061479785 9:130891815-130891837 CCCACCCCTCCACCAGCCTCAGG + Intergenic
1061517280 9:131097041-131097063 CCGCCTCCGCCTCCCGCCTCCGG + Intronic
1061517284 9:131097048-131097070 CGCCTCCCGCCTCCGGTCTCGGG + Intronic
1061582446 9:131546116-131546138 CCCGCCCCGTGTCCCGCCTCTGG + Intergenic
1062031446 9:134363812-134363834 CACGTCACGCCTCCGGCCCCGGG - Intronic
1062052534 9:134455059-134455081 CCAGCCACGCCTCGGGGCTCAGG - Intergenic
1062320389 9:135988001-135988023 CCCGCCCATCCTCTGGCCTCTGG + Intergenic
1062323231 9:136000725-136000747 CCCGCCCCCCCCCCCGCCCCGGG - Intergenic
1062361079 9:136188430-136188452 CACGCCCCGCCCCCGGCCCCAGG - Intergenic
1062385850 9:136311265-136311287 GCTGCCCCGCCTCTGGGCTCAGG - Intergenic
1062467333 9:136687056-136687078 CCCGCCCCGCTCCGGGGCTCCGG - Intronic
1062483605 9:136763568-136763590 CCCGCCCCTCCTCTGTCTTCGGG - Intronic
1062491702 9:136808076-136808098 GCCGCGCCGGCTCCGGCCTCCGG + Exonic
1062544128 9:137054095-137054117 CCCGCCCCTCGTCCCGCCCCGGG - Intergenic
1203740813 Un_GL000216v2:175607-175629 CCCGACCACCCTCCGGCCACAGG + Intergenic
1203469164 Un_GL000220v1:108694-108716 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1203470661 Un_GL000220v1:114156-114178 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1203476985 Un_GL000220v1:152666-152688 CCCGCCTCGCCGCCGCCCGCGGG + Intergenic
1203478482 Un_GL000220v1:158128-158150 CCGGCCCCGCGTCCTCCCTCGGG + Intergenic
1185467667 X:364221-364243 CCCAGCGCGCCTCCGGCCCCAGG + Intronic
1186496237 X:10014882-10014904 CCCGCTCCGCCACCTTCCTCCGG - Intergenic
1188407221 X:29826544-29826566 CCCTCCCCACCTCCAGCCCCTGG + Intronic
1188650594 X:32627145-32627167 CCCGCCCCCCCCCCCGCCCCAGG + Intronic
1190248513 X:48706065-48706087 CCTGGCCCGCCTCAGGCCTCTGG - Intronic
1190266051 X:48827555-48827577 CTTGCCCCGACTCCGACCTCCGG + Intergenic
1190891982 X:54577575-54577597 CCCTCACCACCTCCAGCCTCTGG + Intergenic
1192264530 X:69529780-69529802 CCCGCCCTGCTGCCGGTCTCTGG + Exonic
1192266032 X:69538652-69538674 CCCGCCCAGGCCCCTGCCTCTGG - Intergenic
1195668424 X:107450124-107450146 CCCGCCCTGCCCCCGGCTCCCGG - Intergenic
1199082241 X:143590186-143590208 TCCCCCCCGCCCCCCGCCTCAGG + Intergenic
1200003274 X:153072730-153072752 CCCGCGCCGCCCCCGGACCCCGG - Intronic
1200004449 X:153077279-153077301 CCCGCGCCGCCCCCGGACCCCGG + Intergenic
1200079717 X:153570176-153570198 CCCGCCACCCCTCCAGCCCCGGG - Intronic
1200138622 X:153886500-153886522 ACCGCCCGGCCCCAGGCCTCTGG - Intronic
1200163119 X:154019298-154019320 CCCGCCCCGCTTCCGTCCCCAGG - Exonic