ID: 1086438998

View in Genome Browser
Species Human (GRCh38)
Location 11:86809273-86809295
Sequence ATAAGGCAGTGTTCCCATTT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 167}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086438995_1086438998 -4 Left 1086438995 11:86809254-86809276 CCTGATCTTTAATGCTTCCATAA 0: 1
1: 0
2: 1
3: 14
4: 181
Right 1086438998 11:86809273-86809295 ATAAGGCAGTGTTCCCATTTAGG 0: 1
1: 0
2: 3
3: 13
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086438998 Original CRISPR ATAAGGCAGTGTTCCCATTT AGG Exonic
900692598 1:3990024-3990046 ATAAGGGACTTTTCCCCTTTTGG + Intergenic
901603990 1:10444766-10444788 AAGAGACAGTGTTCACATTTGGG + Intronic
903783320 1:25837381-25837403 ATAATGAAGTATTCCCATATGGG + Intronic
907693664 1:56698148-56698170 CTAAAGCAGTTTTCCCATCTTGG + Intronic
909902596 1:81156956-81156978 ATAAGGCACTTTTCCCCATTTGG + Intergenic
910116136 1:83734307-83734329 AAAATGAAGTATTCCCATTTAGG + Intergenic
910262779 1:85307960-85307982 CTAAGGGATTGTTCCCTTTTTGG - Intergenic
910540448 1:88349944-88349966 AAAAAGTAGTCTTCCCATTTAGG - Intergenic
910577892 1:88787732-88787754 ATCAGGCATTTTTCCCACTTTGG + Intronic
910582574 1:88844669-88844691 ATAAGGCGGTTTTGCCATGTTGG - Intergenic
910622053 1:89266455-89266477 ATCAGGCAGTGTTTCAAGTTGGG + Exonic
911937532 1:103997803-103997825 ATAAGAAAGTGCCCCCATTTTGG + Intergenic
918813659 1:189153674-189153696 ATAAGGTAGAGTTCCCACTATGG + Intergenic
919470800 1:197976920-197976942 ATAAGGCTAATTTCCCATTTTGG + Intergenic
921556814 1:216608626-216608648 AGAAGCCAGTGTTCCATTTTTGG + Intronic
922852578 1:228746510-228746532 AGAAGGCCTTGCTCCCATTTTGG - Exonic
923235886 1:232032376-232032398 ATAAGGCAATATTGTCATTTGGG - Intronic
924239549 1:242028044-242028066 AGAATGCAGTGGTTCCATTTTGG - Intergenic
1063422936 10:5928020-5928042 AGAAGGCAGTGGTGCCATCTTGG - Intronic
1063733794 10:8729568-8729590 AGAAGGCAGTGCTCCATTTTTGG - Intergenic
1064259566 10:13774334-13774356 GGAAGGCAGTGTTCACAGTTTGG + Intronic
1064498502 10:15941742-15941764 ATCAAGCAGTCTTCCCACTTTGG - Intergenic
1066447697 10:35498651-35498673 ATCAGGCATTCTTCCCATCTGGG + Intronic
1070192002 10:74119537-74119559 AGAGGGCAGTGTTTCCTTTTTGG + Exonic
1070241591 10:74687360-74687382 ATAACCCAGTGTTCTCTTTTAGG - Intronic
1071688934 10:87794665-87794687 ATCAGGCATTGTTGACATTTTGG - Intronic
1073264840 10:102220333-102220355 ATCATGCAGTGTTCCCGTTTTGG - Intergenic
1074923067 10:118037685-118037707 CTAAGCCAGTATTCCCATTCAGG + Intronic
1079375410 11:19887617-19887639 ATATGGCAGTGTTGGTATTTTGG + Intronic
1079615070 11:22482041-22482063 ATAAGGTATTTTACCCATTTTGG - Intergenic
1080469556 11:32531821-32531843 ATAAGGCAATGTACACATTATGG + Intergenic
1081168951 11:39842694-39842716 ATTGGGCAGTTTTCCAATTTAGG + Intergenic
1084139886 11:67219513-67219535 AAAATGCAGTGTTGACATTTTGG + Intronic
1084953810 11:72680880-72680902 ACAAGTCACTGATCCCATTTGGG - Intergenic
1085060249 11:73439255-73439277 ATGAGGCACTGTTCTCATCTAGG + Intronic
1085855016 11:80166419-80166441 AAAAAACAGTATTCCCATTTTGG + Intergenic
1086005738 11:82033149-82033171 ATTTGGGCGTGTTCCCATTTGGG + Intergenic
1086357647 11:86021112-86021134 CTCAAGCAGTCTTCCCATTTTGG - Intronic
1086438998 11:86809273-86809295 ATAAGGCAGTGTTCCCATTTAGG + Exonic
1087877263 11:103373166-103373188 CTCAGGCAGTCTGCCCATTTTGG + Intronic
1090125770 11:124081943-124081965 ATAAGGCAGGATTCCTTTTTTGG - Intergenic
1090662574 11:128892170-128892192 ACAAGGCCGTGTTTCCAGTTTGG - Intronic
1091470734 12:724561-724583 CTAAAGCACTGTTCCCGTTTGGG - Intergenic
1093227094 12:16498270-16498292 ACTAGGAAGTGGTCCCATTTAGG - Intronic
1094265232 12:28550991-28551013 ATCAAAGAGTGTTCCCATTTTGG - Intronic
1099706395 12:86158582-86158604 ATAATGCTTTATTCCCATTTAGG + Intronic
1101053377 12:100887095-100887117 ATAAAGCAGTGTTCCCTTTAGGG + Intronic
1103277612 12:119725872-119725894 AATAGACAGTGTTCCCACTTAGG - Intronic
1104539362 12:129648230-129648252 ATGAGGCAGTGTACCAATCTGGG - Intronic
1105371692 13:19807286-19807308 ATAATGCAGTGTCAACATTTTGG - Intergenic
1106589744 13:31089127-31089149 ATAGGGCAGTGTTTAAATTTCGG + Intergenic
1107508680 13:41060727-41060749 ATAAGGAAGCGTTCCCATACCGG + Intronic
1107933937 13:45329011-45329033 AAAAGGCATTCTTTCCATTTTGG - Intergenic
1108237546 13:48424066-48424088 AAAAAGCAGTTTTCTCATTTGGG + Exonic
1110179278 13:72595800-72595822 ATAAGGCAGTCTTTCTATATTGG + Intergenic
1112920962 13:104612500-104612522 ATGAGGGAGGGTTCCCACTTAGG - Intergenic
1115482693 14:33877313-33877335 ATCAAGCAGTCTTCCCATCTTGG - Intergenic
1115945987 14:38661232-38661254 ATAAGGCACTGAAACCATTTGGG - Intergenic
1118225794 14:63897994-63898016 ATAAGACAAAGTTCCAATTTGGG - Intronic
1118739860 14:68731465-68731487 ATAAGGCTTTGTTCCCTTTGGGG + Intergenic
1121525368 14:94615688-94615710 AAATGGCATTGTTCCCATCTGGG + Intronic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1125928579 15:43583652-43583674 ATAAGACAGTGTTCCCAGAAGGG - Intronic
1125941745 15:43683487-43683509 ATAAGACAGTGTTCCCAGAAGGG - Intergenic
1126306669 15:47266508-47266530 ATAAGGCAGTGGTTCCATGTTGG - Intronic
1126843164 15:52736530-52736552 ATAAGGCAGTTTTCCCTTGCTGG + Intergenic
1127332147 15:57949866-57949888 ATTAGGCAGTGTACCTGTTTAGG + Intergenic
1128748189 15:70129821-70129843 ATAAAGCAGAGGTCCTATTTGGG - Intergenic
1131129304 15:89885706-89885728 CTCAGGCAGTCTTCCCACTTTGG - Intronic
1133658440 16:7889996-7890018 GTAATGCAGTGTTGCGATTTCGG - Intergenic
1134198070 16:12174378-12174400 AGAAGACAGTGGTCCCATCTTGG + Intronic
1134279223 16:12803202-12803224 ATGGGGCAGTGTTACCATTTCGG + Intronic
1136075366 16:27813586-27813608 ATGACGCAGTGTTGCCATTCTGG + Intronic
1137618488 16:49860121-49860143 ACAAGGCAGTGTTCACTTTGTGG + Intergenic
1138246003 16:55467757-55467779 AAAAGGAAGTGTTCCAAATTGGG + Intronic
1138650528 16:58458424-58458446 AATAGGCAGTGTTAACATTTTGG - Intergenic
1140674980 16:77319380-77319402 AGAAGACAGTGATTCCATTTGGG - Intronic
1141194066 16:81846337-81846359 ACAAGGCTGTGGTCCCACTTAGG - Intronic
1147200274 17:38796975-38796997 ATACTTCAGTGTCCCCATTTGGG - Intronic
1150478129 17:65489247-65489269 ATCAGGCACTGATCCCATTCTGG + Intergenic
1151081697 17:71336630-71336652 ATAAGTCACTGTGCCCACTTCGG + Intergenic
1151574341 17:74944213-74944235 ACAGAGCAGTGTTCCCATGTAGG - Intronic
1153936158 18:9925133-9925155 ATAAACCAGTATTCCCATTCTGG - Intronic
1156463463 18:37334467-37334489 CTAAGGCAGTGGTCCCACTGTGG - Intronic
1159522623 18:69545779-69545801 AGATGGCAGTATTCACATTTTGG + Intronic
1159544805 18:69825983-69826005 GTATGGCAGTGTTAACATTTTGG + Intronic
1159928219 18:74288105-74288127 ATAAGCCAGTCTTCCCTCTTAGG + Intronic
1159991480 18:74913951-74913973 ATAAGGCATGGGTCCCATCTTGG + Intronic
1164418366 19:28065312-28065334 GCAAGACAGTCTTCCCATTTAGG - Intergenic
1165306523 19:35006005-35006027 TCAAGGCAGGATTCCCATTTAGG - Intronic
1168457921 19:56528634-56528656 TTAAGGCTGTGTTCCCTTGTTGG + Exonic
930702544 2:54473397-54473419 ATATGGCATTGTTGCCATGTTGG + Intronic
932443233 2:71751551-71751573 AGAAGGCAGTGTATCCATTTAGG - Intergenic
937784361 2:125877859-125877881 ATTGGGCAGTGTGGCCATTTTGG - Intergenic
938230931 2:129658338-129658360 ATAAGACAGTGTTATAATTTTGG + Intergenic
939504922 2:143033448-143033470 AGAAGGCAGCATTCCCCTTTAGG + Intronic
1170123275 20:12934950-12934972 ATAGGGCAGTGAGCCCCTTTAGG + Intergenic
1171496393 20:25559205-25559227 ATAAGGCAGTGTGCTCAGCTCGG + Intronic
1176384794 21:6133976-6133998 ATAGGGCAGCCTTCCCATGTGGG + Intergenic
1177503689 21:21993589-21993611 ATAACTCAGTCTTCCAATTTTGG - Intergenic
1178037903 21:28605145-28605167 CCAAGGCAGAATTCCCATTTGGG + Intergenic
1178276395 21:31241771-31241793 TTCAAGCAGTCTTCCCATTTTGG - Intronic
1178663836 21:34529424-34529446 ATAAGGCAGTCTTACCCTATGGG - Intronic
1179738678 21:43404276-43404298 ATAGGGCAGCCTTCCCATGTGGG - Intergenic
949149603 3:750122-750144 ATAGTGCAGTTTTTCCATTTGGG - Intergenic
949232238 3:1764585-1764607 ATAAGGGAGTGTTCTCATTTTGG - Intergenic
949437537 3:4045901-4045923 ATAAGCCAGTGTGCCCAGCTCGG - Intronic
952565323 3:34650357-34650379 ATAGGGCACAGTGCCCATTTTGG + Intergenic
953963845 3:47286860-47286882 ACAAGGAAGTGGTACCATTTAGG - Intronic
954460678 3:50625237-50625259 AGAAGGCAGGGCTCTCATTTGGG + Intronic
955764940 3:62333288-62333310 AAAAGAAACTGTTCCCATTTGGG - Exonic
956670241 3:71682355-71682377 TTAAGGCAGTTTACCCATCTTGG - Exonic
959259040 3:104051510-104051532 GTAAGGAAGGGGTCCCATTTCGG - Intergenic
959822476 3:110752922-110752944 ATTCAGCATTGTTCCCATTTTGG + Intergenic
960130159 3:114047426-114047448 CTTAGGCAGTCCTCCCATTTTGG - Intronic
962471421 3:135712522-135712544 ACAAGGAAGTGGTCCCAGTTCGG - Intergenic
964625373 3:158753520-158753542 ATAAGGCAGTCCTCCCACCTCGG + Intronic
965294626 3:166927885-166927907 TAAAGGCAGTGCTTCCATTTTGG - Intergenic
966572503 3:181461393-181461415 GTAAGGCCGTGTTCCCTCTTGGG + Intergenic
967582636 3:191178269-191178291 CTTATGCTGTGTTCCCATTTTGG - Intergenic
971897902 4:32620820-32620842 AAAAGCAAGTGTTCCCTTTTTGG - Intergenic
977081428 4:92533709-92533731 ATATGGTAGTGTTGCCTTTTAGG + Intronic
980380273 4:132004837-132004859 CTAAAGCAATCTTCCCATTTTGG - Intergenic
981429556 4:144644731-144644753 ATAAGGCAGTTGTCCCATTTTGG - Intergenic
987036162 5:14020723-14020745 CTCAGGCAATCTTCCCATTTTGG - Intergenic
989429744 5:41338894-41338916 ATAATGCAATGTTCTCACTTGGG + Intronic
992079459 5:73220526-73220548 AAAAGGCAGTGTTCAAAATTAGG + Intergenic
992511219 5:77437381-77437403 AGATGGCAGTGTACGCATTTGGG - Exonic
992980652 5:82167996-82168018 ATAAGGCACTATTCCAATGTAGG - Intronic
996786599 5:127243770-127243792 ATAAGCCACTGTTCACATTTTGG + Intergenic
997164418 5:131643910-131643932 ATAAAGTAGTATTCTCATTTTGG + Intronic
998036000 5:138916619-138916641 CTCAAGCAGTGTTCCCACTTTGG + Intronic
999162899 5:149519857-149519879 ATAAGTCAGTGTTCCCACACTGG + Intronic
1000708468 5:164540873-164540895 GAAAGGCAGTCTTCCCATTTGGG + Intergenic
1001464358 5:171949927-171949949 GTAAGACAGTGTGCACATTTAGG - Intronic
1003131492 6:3398794-3398816 ATAAAGCAGTTCTCCCATCTCGG - Intronic
1003394820 6:5744078-5744100 ACAAACCACTGTTCCCATTTGGG - Intronic
1003982637 6:11403864-11403886 ATAAGTCTGACTTCCCATTTAGG - Intergenic
1004014080 6:11716493-11716515 AGAAGGCACTGTTCCCAAATGGG + Intronic
1005766644 6:29017418-29017440 AAATGTCAGTGTTTCCATTTAGG - Intergenic
1007064313 6:38974538-38974560 AGAAAGCAGTTTTCACATTTAGG + Intronic
1007754125 6:44087793-44087815 ACAAGGCAGTGTTCTGCTTTAGG + Intergenic
1009040056 6:58165434-58165456 GTAAGGCAGTGATAGCATTTGGG - Intergenic
1009215950 6:60920290-60920312 ATAAGGCAGTGATAGCATTTGGG - Intergenic
1011287090 6:85736536-85736558 CTAAAGCAATCTTCCCATTTTGG - Intergenic
1012669800 6:102029739-102029761 ATAAGGCAATGTTCCTAATAAGG - Intronic
1012781232 6:103560206-103560228 ATAACGCAAAGTTCACATTTGGG + Intergenic
1016312162 6:142745840-142745862 ATGAGGCAGTGTTCACATTTGGG + Intergenic
1016484385 6:144520261-144520283 ATAAGCCAGTGTTTTTATTTTGG - Intronic
1018855178 6:167669727-167669749 AGAAGGCAGTGTTCACAGGTGGG - Intergenic
1020582022 7:10014315-10014337 ATAAGACAATGGTCTCATTTAGG - Intergenic
1021677842 7:23098619-23098641 CTAAGGCAGTATTGCCATTTAGG - Intergenic
1026477712 7:70750968-70750990 AAAAGTCAGTGTGCCCATTAAGG - Intronic
1027193067 7:76009223-76009245 GGAAGGCAGTGTGCCCAGTTCGG - Intronic
1028612842 7:92731558-92731580 AGAAGCCAGTGTTTCCATTTAGG - Intronic
1028718817 7:94005055-94005077 ACAAGGCAGTGTGCCAATTAGGG + Intergenic
1031562213 7:123252095-123252117 AAAAGGCAGTGTTCACATCTAGG + Intergenic
1031999580 7:128256039-128256061 ACATGGCAGTGTTCCTATTTGGG + Exonic
1032421853 7:131787087-131787109 ATAAGTTAGTATTCTCATTTTGG + Intergenic
1033398430 7:140998054-140998076 AAAGGGCAGTATTTCCATTTTGG - Intergenic
1033785918 7:144730054-144730076 AAAAGGCAATGTTCTTATTTAGG - Intronic
1039119602 8:34130881-34130903 AAAAGGCAGACTTCACATTTCGG + Intergenic
1039945701 8:42127476-42127498 ATAAGGTAGATTTCCCATTCTGG + Intergenic
1041097802 8:54366770-54366792 TTAATACAGTGTACCCATTTGGG + Intergenic
1041188201 8:55324683-55324705 AGAATGCAGTGTTCCAATTAAGG + Intronic
1043651369 8:82596820-82596842 ATAAGGCATTAATCCCATTAGGG + Intergenic
1045946704 8:107804831-107804853 CTAAGACAGTGGTCCCCTTTTGG + Intergenic
1046295647 8:112215943-112215965 ACAAGGCAGGGTTCCTATTCTGG + Intergenic
1047349650 8:124061654-124061676 CTAAGGCAGACTTCCTATTTGGG + Intronic
1048519389 8:135139752-135139774 ATAAGGCACTACTCCCATTCAGG + Intergenic
1048914817 8:139172296-139172318 ATAATGGAGTGTTTCAATTTGGG + Intergenic
1049558072 8:143293514-143293536 ATAAAGCAGTGTTCTCATGGGGG - Intronic
1049753655 8:144297828-144297850 ATACGGCACTGTTCACGTTTTGG + Intronic
1051927491 9:22346780-22346802 ATAAGGCAATGTTCCTACTTTGG - Intergenic
1052046115 9:23796012-23796034 AAAACGAAGTGTACCCATTTTGG + Intronic
1052061918 9:23970586-23970608 CTAAGGCAGGGTTACCAGTTGGG - Intergenic
1052661498 9:31438707-31438729 ATAATGCAGAGCTCCCTTTTAGG - Intergenic
1059049117 9:110903028-110903050 AGTAGGCAGTCATCCCATTTAGG - Intronic
1062366504 9:136211963-136211985 CTAAGGCCGTGTCCCCACTTGGG - Intronic
1187254422 X:17629397-17629419 TCAAGGAAGTGTTGCCATTTTGG - Intronic
1187450241 X:19389565-19389587 ATAAGGAAGGGGTCTCATTTTGG - Intronic
1196928143 X:120654638-120654660 ATAAGCCAGTCTTCCCTTGTAGG - Intergenic
1197695298 X:129543080-129543102 ATAAGGCAGAGTTGGCATTCAGG + Intronic
1201514511 Y:14804712-14804734 ATAAGTCAATTTTCCCATGTCGG + Intronic