ID: 1086439451

View in Genome Browser
Species Human (GRCh38)
Location 11:86813728-86813750
Sequence ATGGAGAAGGAGACTTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 293}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086439448_1086439451 6 Left 1086439448 11:86813699-86813721 CCATAAAATATAATTTTTAATAT 0: 1
1: 4
2: 36
3: 349
4: 2687
Right 1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG 0: 1
1: 0
2: 2
3: 23
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086439451 Original CRISPR ATGGAGAAGGAGACTTATGA AGG Intronic
900859434 1:5217632-5217654 AGGGAGAAGCAGACTTTGGAGGG - Intergenic
900919986 1:5663934-5663956 ATGGAGATGGAGACTGAAGAGGG + Intergenic
901013256 1:6212712-6212734 AATGAGCAGGAGATTTATGAAGG + Exonic
903896724 1:26611147-26611169 AGGGGGAAGGAGACTGATGTGGG - Intergenic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
904654496 1:32034088-32034110 ATGAATCTGGAGACTTATGAAGG + Intronic
905649349 1:39646215-39646237 ATGGAGCAGGAAAGTGATGATGG - Intergenic
907948979 1:59162461-59162483 ATCCAGAAGGAGGCTTCTGATGG - Intergenic
908428725 1:64035145-64035167 ATGATGATGGAGACTCATGAGGG - Intronic
908662024 1:66447067-66447089 TTGGAGAAAGATTCTTATGATGG + Intergenic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
918374487 1:183895439-183895461 AGGGAGAAGGAGATTGATGGAGG + Intronic
918943851 1:191034926-191034948 ATGGAGAATCAGATTTATGGAGG - Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
919504632 1:198383891-198383913 TGGGAGAAGGAGACTTATACTGG - Intergenic
920689278 1:208133463-208133485 ATTTAGAAGGAGACTTTTGCTGG + Intronic
921001667 1:211050390-211050412 ATGGAGAAGGGTGTTTATGACGG - Intronic
921418584 1:214919808-214919830 ATGGAGAAGGAGAATCAGGAAGG - Intergenic
921420526 1:214942097-214942119 AATGAGAAGGAGACTGATGTAGG - Intergenic
923375275 1:233355873-233355895 AAGGAGAAGGGGACAGATGAGGG - Intronic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924145909 1:241074383-241074405 ATAGAGAAGGATACTGAAGAGGG + Intronic
924478055 1:244398825-244398847 ATACACAAAGAGACTTATGAGGG + Intergenic
1063149166 10:3321214-3321236 ATGGAGATGGGGACTGATGCAGG + Intergenic
1063342195 10:5276816-5276838 ATGGTGAAGGAGAGAAATGAAGG + Intergenic
1063465037 10:6237414-6237436 TTGCAGAAGGAGGCTTAGGAAGG + Intergenic
1064009301 10:11722563-11722585 ATATAGAAGGAGATTTATTATGG - Intergenic
1069102668 10:64342419-64342441 CTGGAGAAGGAGAGGTATTATGG - Intergenic
1069207526 10:65710443-65710465 AAGGAGAGGGAGAGTGATGAGGG + Intergenic
1069426064 10:68289633-68289655 AAGGAGAAAGAGACTTAGAAAGG + Intronic
1070341934 10:75505926-75505948 ATGGAGGAGGAGAGTTAATATGG - Intronic
1070407610 10:76110986-76111008 ATGGAGAATGACACTTCAGAGGG - Intronic
1072167328 10:92826785-92826807 ATTGAGAAGGTGATTTTTGAAGG + Intergenic
1073929552 10:108558988-108559010 ATGTAGAAGAAGACATATGTAGG + Intergenic
1075922074 10:126221999-126222021 CTGGAGAGGGGGACTTCTGATGG - Intronic
1075952534 10:126494029-126494051 ATGCACAAGGATATTTATGAAGG + Intronic
1076326320 10:129626271-129626293 ATGGAGAAGGAGAGGCATGCGGG - Intronic
1077451263 11:2647828-2647850 ATGAAAAAGGAGACTTACAATGG - Intronic
1077742715 11:4864871-4864893 ATGGATAGGAAGACTTTTGATGG - Intronic
1078034901 11:7793645-7793667 TTGGAGCAGGAGAGTCATGATGG + Intergenic
1078294412 11:10052869-10052891 ATGCATAAGGTGATTTATGAAGG - Intronic
1078827199 11:14940538-14940560 ATATAGAAAGAGATTTATGAGGG + Intronic
1079157251 11:17959564-17959586 AGGAAGTTGGAGACTTATGAAGG - Exonic
1079944330 11:26722817-26722839 ATGGAGAAGGCCACTGAAGAAGG - Intronic
1080215650 11:29836981-29837003 ATGGTGATGGCGACTGATGATGG - Intergenic
1080908878 11:36575093-36575115 GTGGTGAAGGAGTCTTGTGATGG + Exonic
1082701911 11:56442246-56442268 TTAGAGAAGGAGACTAATAAAGG + Intergenic
1085808515 11:79658813-79658835 ATGGAGATGGAGACTTTAGGAGG - Intergenic
1086439451 11:86813728-86813750 ATGGAGAAGGAGACTTATGAAGG + Intronic
1086609821 11:88742384-88742406 CTGGAAAAGGAAACTTAAGACGG + Intronic
1087239200 11:95756654-95756676 AGGGAGAAGCAGGATTATGAGGG + Intergenic
1087564836 11:99841652-99841674 AAGGAGAAGGAGAATGAAGAAGG + Intronic
1088109967 11:106249883-106249905 ATGGAGATGGAAATTTATGAGGG + Intergenic
1089317299 11:117600787-117600809 AGGGAGAAGGTGATTTATGAAGG + Intronic
1089626937 11:119757110-119757132 ATGGAGCTGGAGAGTAATGATGG + Intergenic
1090195157 11:124809258-124809280 ATGCACAAGGAAACTTTTGAGGG + Intergenic
1091040836 11:132279715-132279737 GTGGAGAAGGTGAGTTATTAGGG - Intronic
1091858533 12:3758245-3758267 ATGGGAAAGCAGAATTATGAGGG - Intronic
1096520729 12:52183213-52183235 ATGGGGATGGAGACTTCCGAAGG - Intronic
1097036276 12:56126545-56126567 ATGGAGAGGGTGACCTATGGAGG - Exonic
1097043398 12:56169926-56169948 ATAGAAAAGGAGAGTTATCAGGG + Intronic
1097144532 12:56930810-56930832 ATAGAGAGGGAGAAGTATGATGG - Intronic
1097633020 12:62087207-62087229 ATGGAGATGGATAGTCATGATGG + Intronic
1098976494 12:76907744-76907766 ATGGCAAAGGAGAATTAAGATGG + Intergenic
1099051257 12:77783983-77784005 AGGGAGAAGCAGAGTCATGATGG - Intergenic
1099704626 12:86136391-86136413 ATGGAGATGGAGAATAATGGAGG + Intronic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1102095913 12:110241252-110241274 AGGGAGAAGCAGACTTAGGTAGG + Intergenic
1102243651 12:111341607-111341629 ATGCAGAAGGAGAGTGAGGAGGG + Intronic
1102260496 12:111440324-111440346 ATGGACAGTGAGATTTATGAAGG - Intronic
1102527307 12:113521030-113521052 ATGGAGAAAAAGACATTTGAAGG + Intergenic
1102863686 12:116357583-116357605 ATAGAGAAAGAGATTTATTATGG + Intergenic
1102893234 12:116578352-116578374 ATGGAGCAGGAGCCTGTTGAAGG - Intergenic
1104548746 12:129736204-129736226 ATAAAGAAGGAGACTTTTGTAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1105755116 13:23456880-23456902 AAGGAGATGGTGACTTCTGAAGG + Intergenic
1107377501 13:39820530-39820552 ATTGAAAAGGAGGCTTAGGAAGG - Intergenic
1107757500 13:43640621-43640643 ATTGAGAATGAGAGTTATAAAGG - Intronic
1107982021 13:45743119-45743141 ATGGAGCAGGAGACTCAGGCAGG - Intergenic
1108948559 13:56057445-56057467 ATGGAAAAGGAAACTAATCAAGG + Intergenic
1109984760 13:69965465-69965487 ATGGAGAAGGGGAGAAATGAGGG - Intronic
1109997084 13:70142723-70142745 TTGGAGAAGAATACTTATAAAGG + Intergenic
1111166373 13:84462942-84462964 AAGGAGAAGGAGACTGATCAAGG - Intergenic
1113074391 13:106453465-106453487 AGGGAGAAGGAAACTGCTGAGGG + Intergenic
1113273901 13:108707000-108707022 CTGGACAAGGAGACCCATGAGGG - Intronic
1113672225 13:112183052-112183074 GTGGAGAAGGAGGCTGACGATGG - Intergenic
1114307019 14:21432712-21432734 ATGGAGTAGAAGACCTTTGAGGG - Intronic
1115074866 14:29376217-29376239 ATGGAGCAGGATAGTAATGATGG - Intergenic
1116608525 14:47035130-47035152 ATGCAAATGGAGAGTTATGATGG - Exonic
1117219334 14:53586576-53586598 AGAGAGATGGAGACTTATTAAGG - Intergenic
1117787689 14:59303957-59303979 ATGGAGAATGTGGCTTATGTGGG + Intronic
1118090271 14:62467747-62467769 TGGGAGAAGGAGACATATAATGG + Intergenic
1118349080 14:64960760-64960782 ATGTAGAAGGAGGCTTATGTTGG + Intronic
1119149593 14:72346367-72346389 ATGGAGAAGGAGCAGTGTGAGGG + Intronic
1119544606 14:75462486-75462508 CTGTAGAAAGAGACTAATGAAGG - Intronic
1119973024 14:78993680-78993702 ATGGGGAAAGACACATATGAAGG + Intronic
1120281991 14:82450923-82450945 CTGGAAAAGGAGATTTATGCCGG + Intergenic
1121628161 14:95402000-95402022 AAGGAGAAAGGGATTTATGATGG - Intergenic
1122101520 14:99414140-99414162 ATGAAGAAGCAGATTTATGGCGG - Intronic
1122254237 14:100464928-100464950 ATGGAGTAGGGGACTTGAGATGG - Intronic
1125983302 15:44023904-44023926 ATGGAAAACGAGACCTAGGAAGG - Intronic
1126534870 15:49750494-49750516 ATAGAGATGGAGAGATATGAAGG + Intergenic
1128079103 15:64845607-64845629 ATGGAGAAGGGGACAACTGAAGG - Intronic
1128160521 15:65420746-65420768 CTGTAGAAGGAGAATGATGATGG - Intronic
1128521509 15:68378003-68378025 ATAGAGAAGCATACTTCTGATGG + Intronic
1128686175 15:69687342-69687364 AGGGAGAAGGAAAGTTAGGAAGG + Intergenic
1128773975 15:70304662-70304684 ATGTAGAAAGAGAATTATAAAGG - Intergenic
1130068122 15:80622806-80622828 ATGGATCAGAAGACTTAAGATGG + Intergenic
1130702932 15:86204028-86204050 GTGAAGGATGAGACTTATGATGG + Intronic
1135784151 16:25333154-25333176 ATGGGGAAGGAGACAGATGAAGG + Intergenic
1137334060 16:47531000-47531022 TTGGAGAAGGAAAAATATGAAGG + Intronic
1137554196 16:49460475-49460497 ATGGAGAAGGGGAGGTTTGAGGG + Intergenic
1138041946 16:53680840-53680862 AGGGAGAAGGAGAAATAGGAGGG + Intronic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1139296335 16:65904721-65904743 AGGGAGACAGAGACTCATGAAGG - Intergenic
1139749980 16:69103936-69103958 ATGGAGAAGAAGCCTTAGGTTGG - Intergenic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1141244518 16:82293530-82293552 AGGGAGGAGGAGACTTTTGCAGG + Intergenic
1146636658 17:34511459-34511481 AGGGAGAAGGAGCATTCTGATGG + Intergenic
1147041341 17:37721650-37721672 ATGGAGCAGGAGAGTTCTGAAGG - Intronic
1148918050 17:51000724-51000746 ATTGAGATGGAGTCTTGTGATGG - Intronic
1149304335 17:55333834-55333856 ATGGATAAGGAGCCTCTTGAAGG + Intergenic
1149496675 17:57122730-57122752 AAGGAGGAGCAGATTTATGAAGG + Intergenic
1151084337 17:71363656-71363678 ATGAAGAAGGAAAGTAATGAAGG + Intergenic
1151092812 17:71462019-71462041 ATGGTGATGAAGATTTATGAAGG + Intergenic
1152103511 17:78316142-78316164 TTGGAAAAGGAGACTTGTGCCGG + Intergenic
1153522772 18:5967861-5967883 GTGGAAAAGGGGACTTGTGAAGG + Intronic
1154092186 18:11375783-11375805 ATGAAGACTGAGACTTTTGAGGG - Intergenic
1154143876 18:11850021-11850043 ATGGTGAAGGTGGCTTTTGAAGG + Intronic
1156675739 18:39525185-39525207 ATGGAGAAAGAGGCTTCTCAAGG - Intergenic
1156820597 18:41367929-41367951 ATGGACAAGGAGGCCTATGTTGG + Intergenic
1157633842 18:49129684-49129706 ATGGAGCAGGCGACTGAAGAGGG + Intronic
1158038075 18:53058879-53058901 TTGGAGAAGTAGCCTCATGAAGG + Intronic
1158248014 18:55453373-55453395 ATGGAAAATGTGACTAATGATGG - Intronic
1158280413 18:55819393-55819415 ATGGAGAAGGAGACCAAAGAGGG + Intergenic
1158421624 18:57299841-57299863 ATGGACAAGGAGACTGAGGTAGG + Intergenic
1158615131 18:58980116-58980138 ATGGATCAGGAGACTTATGAAGG + Intronic
1160138561 18:76296999-76297021 ATGGAGAAATAGACATATGTAGG + Intergenic
1160951276 19:1668816-1668838 ATGGGGAAGGAGAATTTCGAAGG + Intergenic
1161306425 19:3571726-3571748 AGGGAGAAGCCGACTTATGGAGG + Intronic
1161985474 19:7651082-7651104 ATGGATGAGGAGAGTTGTGAAGG + Intergenic
1163779788 19:19240173-19240195 AGGGAGAAGGAGAGAGATGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166941274 19:46367612-46367634 TTTGAGAAGCAGATTTATGAGGG + Intronic
1167922185 19:52791081-52791103 CTGGAAAAGGAGACCTATAAGGG - Intronic
925745340 2:7039047-7039069 ATGGAGAGAGAGATGTATGATGG + Intronic
926366477 2:12138434-12138456 ATGGAGAAGTAGGCTTCAGAAGG - Intergenic
927276391 2:21265930-21265952 TGGAAGAAGGAGAGTTATGAAGG + Intergenic
928140492 2:28724207-28724229 AGGGGGAAGGAGACTTTTCAGGG + Intergenic
928407200 2:31023801-31023823 CTGGAGGAGGAGAGTGATGAGGG - Intronic
929993708 2:46811869-46811891 AAGGAGAAGGAGACAAAAGAAGG - Intergenic
930731898 2:54735929-54735951 CTGGAGAAAGTGACTTTTGAAGG + Intronic
932124112 2:69127852-69127874 AGGGAGAAGAAGACTTAGGGAGG + Intronic
932871575 2:75405230-75405252 AGAGAGAAGGAGATTTATGATGG - Intergenic
935574000 2:104690149-104690171 ATGGAGGAAGGGACTTATGCAGG - Intergenic
936574332 2:113641053-113641075 ATGGAGGAGGAAATGTATGAGGG - Intronic
936594851 2:113838299-113838321 ATGGAGAAAGGGGCCTATGAAGG + Intergenic
937138565 2:119577277-119577299 ATGGAGGTGGGGACTTAGGAAGG - Intronic
937541340 2:122957995-122958017 ATGGACAAGAAGGCTTATCAAGG + Intergenic
938010152 2:127822289-127822311 AAGAAGTAGGAGCCTTATGATGG - Intergenic
938243132 2:129758377-129758399 AAGGAGAATGAGGATTATGAAGG + Intergenic
938775613 2:134538823-134538845 ATGGGGAAGGAGACCTGGGAGGG + Intronic
940958696 2:159757703-159757725 ATGGAGTAAGAGACTTATTAAGG - Intronic
942862150 2:180627786-180627808 ATGGAGATAGAGATTTATTATGG + Intergenic
944126282 2:196296664-196296686 ATGAAGAAGGAGAATTATAGGGG + Intronic
948322520 2:237082062-237082084 ATGGAGAAGAAGACTTTGAAAGG + Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1169763313 20:9120779-9120801 ATGGAGGAGGAGGCTCCTGACGG - Intronic
1174149387 20:48475476-48475498 ATGGAGCTGGAGACTCAGGAAGG - Intergenic
1174897432 20:54465699-54465721 ATGGAGAAAGAGACTAAAAAGGG + Intergenic
1175058663 20:56221349-56221371 ATGGAGCAGGTGACTCAGGAAGG - Intergenic
1175214164 20:57381815-57381837 ATTGAGCAGGAGACTTCTCATGG - Intergenic
1175281249 20:57805369-57805391 ATTGAGAAGGTGACATTTGATGG - Intergenic
1177072970 21:16534153-16534175 AAGGAAAAGGAGACAGATGAAGG + Intergenic
1179289954 21:40009666-40009688 CTTGAGGAGGAGACTTGTGATGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1180041198 21:45281127-45281149 GTGGAAAAGGAGGCTGATGATGG - Intronic
1181776101 22:25161113-25161135 AAGGAGAAGGAAAGTTAGGAAGG - Intronic
1182392436 22:30010166-30010188 ATGTAGAAGGAGCCTTACTAAGG + Intronic
1182795361 22:32987700-32987722 ATAGAGAAGGAGATTTTTGTGGG + Intronic
1182824429 22:33252352-33252374 ATGGAGAAGGAGAGTTAGGCTGG - Intronic
1184221958 22:43106575-43106597 ATGGAGGAGGAGATATTTGAGGG - Intergenic
1185425840 22:50769835-50769857 ATGGAGGAGGAAATGTATGAGGG + Intronic
949102972 3:168196-168218 ATGGTGAAGGAGACTTGTTTTGG - Intergenic
949407223 3:3727127-3727149 AGGGAGAAGGAGACTCTTCATGG + Intronic
949508362 3:4747121-4747143 TTGGAGAAATAGCCTTATGATGG + Intronic
949592375 3:5507943-5507965 ATGGAAAAGGAGACTCAGGAAGG + Intergenic
951397845 3:22192040-22192062 ATGGAGAAAGAGATGAATGATGG - Intronic
951613731 3:24520430-24520452 ATGGAGAAGGGCACTTAAAATGG - Intergenic
953470905 3:43165196-43165218 ATGAAGAAACAGATTTATGAAGG - Intergenic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
953692227 3:45129280-45129302 ATTGACAAGGAGCCTTAAGATGG - Intronic
955417154 3:58703096-58703118 ATGAAGCAGGATACTTATGGTGG - Intergenic
957261392 3:77906519-77906541 ATGGAGAAGGAGGCTGAAGAAGG + Intergenic
957562910 3:81846864-81846886 AGGGAGAAGTAGACATCTGAAGG + Intergenic
958105524 3:89067764-89067786 ATGGAGAAGGTTACCCATGATGG + Intergenic
958126915 3:89368378-89368400 ATGTAAGAGGAGATTTATGATGG + Intronic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959365312 3:105450954-105450976 ATGTAGAGGGAGAATTAGGATGG + Intronic
959533787 3:107463040-107463062 AGGCAGAAGGAAACTTTTGAGGG + Intergenic
960673319 3:120172301-120172323 ATGGAGAAGGGGACTAAACAAGG - Intronic
961547119 3:127642382-127642404 ATGAAGCAGCAGATTTATGAAGG + Intronic
962183221 3:133230573-133230595 ATGGGAGAGGAGACATATGAAGG + Intronic
963927847 3:150969952-150969974 ATGGAAAAGGTAACTTATCAAGG - Intronic
964744476 3:159999410-159999432 ACAGAGAAGAGGACTTATGATGG - Intergenic
965173557 3:165300218-165300240 ATAGAGAAGAAGACTAATAAGGG - Intergenic
965792431 3:172404169-172404191 ATGGAGAAGTGGATTTATGGAGG - Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966343450 3:178951344-178951366 ATAGAGAAAGAGATTTATTATGG + Intergenic
966626836 3:182026005-182026027 ATGGACAGGGATACTTTTGAAGG - Intergenic
970896871 4:21113897-21113919 ATGGAGAAAGAAACTAATTATGG - Intronic
970981440 4:22103212-22103234 ATGGAGGAAGACATTTATGATGG + Intergenic
971743310 4:30547480-30547502 AAGGAGAAGAATAATTATGAAGG + Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
973619059 4:52709688-52709710 ATGGAGGAGGAGACTGAGAAAGG + Intergenic
975416721 4:74113221-74113243 AAGGAGATGGAGAGTTTTGAGGG - Intergenic
976504087 4:85826277-85826299 ATGGAGAAGGGGATTAATGAAGG - Intronic
977023290 4:91784428-91784450 ATGGAGAGAAAGACTTATTAAGG + Intergenic
977169460 4:93742768-93742790 GAGGAGAAGGAGAGATATGAGGG - Intronic
977320934 4:95515005-95515027 ATGGAGATGGAGAAATATCAAGG - Intronic
977461241 4:97328339-97328361 AGGGAGAAGGTCACATATGAGGG + Intronic
978445167 4:108773221-108773243 ATGCATAAGGAGAGGTATGAGGG - Intergenic
979040519 4:115786530-115786552 ATGGAGATGGATAGTGATGATGG - Intergenic
979903358 4:126252225-126252247 ATAGAGAAGGAGGCTTAGGATGG + Intergenic
982232728 4:153223519-153223541 AGGGAGATGGTGACTTTTGAGGG + Intronic
983637856 4:169916510-169916532 ATGAAGAAAAAGGCTTATGAAGG - Intergenic
984005387 4:174299879-174299901 ATGAAGAAACAGAATTATGAAGG - Intronic
984546574 4:181111617-181111639 ATGGAGAAGAAAACAAATGACGG - Intergenic
986566769 5:9123467-9123489 AAGGAGAAGGAGAAGAATGATGG + Intronic
987202252 5:15589287-15589309 TTGGAGGAGGAGACTTGTGGGGG + Intronic
988641264 5:33042575-33042597 GTGGAGCAGAAGACTTAAGAAGG + Intergenic
989668773 5:43889370-43889392 AGGGAGAATGTGACTTATGAAGG + Intergenic
990352843 5:54936087-54936109 AGGGAGAATGAGACTCAGGAAGG - Intergenic
991009345 5:61866795-61866817 ATGGAGAAATAGACTCTTGATGG - Intergenic
991926319 5:71708553-71708575 ATGGAGAGGGTGACTTAAAAAGG + Intergenic
993710529 5:91220303-91220325 ATGGAGAAAGAGAATTAGAAAGG + Intergenic
993814966 5:92532040-92532062 ATGAAAAAGAATACTTATGAAGG + Intergenic
994448001 5:99902313-99902335 AAGGACAAGGAGAGATATGAGGG - Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995646698 5:114320734-114320756 ATGGAGAAGAAGATACATGAAGG - Intergenic
995963743 5:117878112-117878134 ATGGAGAAGAAGTTTTATGATGG + Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
999095950 5:148978461-148978483 GTGGAGGAGGAGAGGTATGAAGG - Intronic
999629087 5:153551621-153551643 TGGGAGAAGGAGCCTTCTGAAGG - Intronic
1002696109 5:181092274-181092296 ATGGAGAAGGAGATAGACGAGGG + Intergenic
1002770257 6:284254-284276 ATGGAGGAGGAGACTTAAGAGGG + Intergenic
1003035222 6:2635717-2635739 ATGCAGAAAGAGTCTTAAGATGG + Intergenic
1003148593 6:3529786-3529808 ATGAAAGAGGAGACTTATTATGG + Intergenic
1003347705 6:5286032-5286054 CTGGAGAAAGAGACATAAGAAGG - Intronic
1003377001 6:5588674-5588696 TTGGAGAAAGAGTCCTATGATGG - Intronic
1004119187 6:12803383-12803405 AAGGAGGAGGAGACATATTAGGG + Intronic
1004775415 6:18838847-18838869 ATGGAGAATCAGACCTATGGAGG - Intergenic
1005219114 6:23565846-23565868 AAAGAGAAGGAGAGTAATGAAGG - Intergenic
1007041055 6:38722810-38722832 ATGGAGAAGGATGCTGAAGATGG + Exonic
1007528200 6:42515414-42515436 AGGGAGAGGGTGAGTTATGATGG + Intergenic
1007734349 6:43971372-43971394 AAGGAAAAGGAGACTCAAGAGGG + Intergenic
1007762097 6:44139224-44139246 ATGGAGAAGGGGAGGGATGAAGG - Intronic
1007773298 6:44208430-44208452 GTGGAGAAGGGGATTTATGGTGG - Intergenic
1010288830 6:74112046-74112068 AGGGAGAAGGAGAAAGATGAAGG - Intergenic
1010561684 6:77358870-77358892 ATAAAGAAGGAGACTAAAGAAGG + Intergenic
1010793622 6:80093339-80093361 TTGGAGATGAAGACTTTTGAGGG + Intergenic
1011599385 6:89045704-89045726 ATGGAGATGGAAAAGTATGATGG + Intergenic
1013003874 6:106052082-106052104 CTGGAGATGGATACTGATGATGG + Intergenic
1014311739 6:119812293-119812315 ATGGAAAAGCAGATTTATCATGG - Intergenic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1015376413 6:132515023-132515045 AAGGACAAGTTGACTTATGAAGG + Intergenic
1017029684 6:150210275-150210297 TTGGAGAAGGACAGTAATGACGG - Intronic
1018248336 6:161843297-161843319 ATGGAGAAGGAGACAGAAGGTGG - Intronic
1019133470 6:169893951-169893973 ATGGAGGAAGAGAATTAGGATGG + Intergenic
1019456420 7:1130107-1130129 ATGGAGCAGGCCACGTATGAGGG + Intronic
1023215323 7:37856275-37856297 TTGGAGATGGAGACTTTAGAAGG + Intronic
1023606192 7:41933289-41933311 CTGGAGTTGGTGACTTATGAGGG - Intergenic
1023836289 7:44069825-44069847 AGGGAGAAGGAGAGATAGGAGGG + Intergenic
1024635226 7:51282953-51282975 ATGGAGAAAGAGAACTCTGAGGG + Intronic
1026176519 7:68002502-68002524 ATGGAGATGGAGAGAAATGAAGG - Intergenic
1026310988 7:69184158-69184180 AAGGAAAAGGAGACTGATGTGGG + Intergenic
1026649553 7:72203511-72203533 AGGGAGAAGGGGAGTTATCAAGG - Intronic
1026865510 7:73821808-73821830 ATGGGGATGGAGACTGATGCTGG + Intronic
1029448012 7:100625570-100625592 ATGGAGAAAGAGATATAAGAAGG + Intronic
1033729164 7:144157690-144157712 AAGGAGAATTAGATTTATGAGGG - Intergenic
1037590360 8:20306745-20306767 GTGGAGAAGGAGACCAGTGATGG + Intergenic
1038351380 8:26779319-26779341 ATGGAGAAGGAAAATTTGGAAGG - Intronic
1038775416 8:30526319-30526341 ATGGTTAAGGTGACTTCTGAAGG - Intronic
1039551429 8:38446002-38446024 GAGGAGAAGGACACTTCTGAAGG + Intronic
1039580315 8:38660712-38660734 AAGGAGATGGAGACTTGTGAGGG - Intergenic
1042795447 8:72657957-72657979 ATGGAGAAGGAGACAGATGGAGG - Intronic
1042881922 8:73502641-73502663 ATGCAGAAGGTGACCTTTGAAGG - Intronic
1043143057 8:76615393-76615415 ATTGAAAAGGAGAATTCTGAAGG - Intergenic
1044637069 8:94336661-94336683 GTGGGGATGGAGACTTGTGATGG + Intergenic
1045569804 8:103357103-103357125 ATGGAGATGGAGATTTGTGGAGG + Intergenic
1045976895 8:108139589-108139611 AAGGAGAAGGAGACTTGAAATGG - Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1048089302 8:131221517-131221539 AGGGACACGGAGACTTATTATGG - Intergenic
1048147303 8:131857978-131858000 ATGGAGAAGGAGAAGAAAGAAGG - Intergenic
1048572565 8:135667716-135667738 AGGGAGAGGGAGAGCTATGAAGG + Intergenic
1050086405 9:1970938-1970960 ATGGAGTAGGATAATTAAGATGG + Intergenic
1050506409 9:6353596-6353618 AGGCAGAAGGAAACTTTTGAAGG - Intergenic
1054676906 9:67864817-67864839 ATTGAAAAGGAGAATTTTGAAGG - Intronic
1056080750 9:83092136-83092158 ATGGAGAGGGATATTTTTGAAGG + Intergenic
1057185543 9:93055642-93055664 ATGGAGAAGGAGGGTGAGGAAGG + Intergenic
1057633950 9:96745654-96745676 ATGGAAAAAGAGACAAATGAAGG - Intergenic
1057834151 9:98430658-98430680 ATGGAGAGGGAGAACTATGCAGG - Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059358373 9:113718912-113718934 CTGGAGAAGGAGGCTCTTGATGG + Intergenic
1060206084 9:121683562-121683584 ATGGAGAAGGAGAAGTGTCAGGG + Intronic
1062017664 9:134299307-134299329 ATGTAGAAAGAGGTTTATGATGG - Intergenic
1186153797 X:6705172-6705194 ATGTAGAAGGGGATTTATTATGG + Intergenic
1187220150 X:17317870-17317892 ATGGTGGAGGAAACTTTTGAAGG + Intergenic
1188759375 X:34007026-34007048 CTGGGGAAGTAAACTTATGAGGG + Intergenic
1189426377 X:40905171-40905193 ATGGAGATGGAAAGTAATGATGG + Intergenic
1193247757 X:79249510-79249532 ATGGAGCAGAAGACTTAAGGAGG + Intergenic
1193743467 X:85245049-85245071 TGGGAAAAGGAGACTTATGCGGG + Intronic
1193860738 X:86663725-86663747 ATGGAGAATGATCCTTGTGAAGG - Intronic
1194653690 X:96546046-96546068 ATGGAGAAAGGGACCCATGAAGG + Intergenic
1195413926 X:104599622-104599644 AAGGAAAAGGAAACTTTTGATGG + Intronic
1195656995 X:107341215-107341237 ATGGAGAAAGAGACAAAAGATGG + Intergenic
1200039499 X:153355366-153355388 AAGGTGAAGGAGACTTCTGTGGG - Intronic
1200799959 Y:7377495-7377517 GTGCAGAAGGAGACAGATGAAGG - Intergenic
1202592578 Y:26502417-26502439 ATAGAGCAAAAGACTTATGAGGG - Intergenic