ID: 1086447890

View in Genome Browser
Species Human (GRCh38)
Location 11:86887338-86887360
Sequence CATTTCCCATTTCACATCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 593
Summary {0: 1, 1: 0, 2: 1, 3: 47, 4: 544}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086447890_1086447895 -6 Left 1086447890 11:86887338-86887360 CCCAAGATGTGAAATGGGAAATG 0: 1
1: 0
2: 1
3: 47
4: 544
Right 1086447895 11:86887355-86887377 GAAATGGGAAATGACCAGAAGGG 0: 1
1: 0
2: 6
3: 37
4: 399
1086447890_1086447898 12 Left 1086447890 11:86887338-86887360 CCCAAGATGTGAAATGGGAAATG 0: 1
1: 0
2: 1
3: 47
4: 544
Right 1086447898 11:86887373-86887395 AAGGGGTCAAAAAAACAGTCAGG 0: 1
1: 0
2: 1
3: 15
4: 226
1086447890_1086447896 -5 Left 1086447890 11:86887338-86887360 CCCAAGATGTGAAATGGGAAATG 0: 1
1: 0
2: 1
3: 47
4: 544
Right 1086447896 11:86887356-86887378 AAATGGGAAATGACCAGAAGGGG 0: 1
1: 0
2: 2
3: 38
4: 404
1086447890_1086447894 -7 Left 1086447890 11:86887338-86887360 CCCAAGATGTGAAATGGGAAATG 0: 1
1: 0
2: 1
3: 47
4: 544
Right 1086447894 11:86887354-86887376 GGAAATGGGAAATGACCAGAAGG 0: 1
1: 0
2: 4
3: 74
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086447890 Original CRISPR CATTTCCCATTTCACATCTT GGG (reversed) Intronic
901520551 1:9781019-9781041 CATTTCACATTTCAGGTTTTGGG + Intronic
901935736 1:12625457-12625479 CTGTTCCCATTTCACAGATTAGG + Intergenic
902164329 1:14557742-14557764 CAATTCACCTTTCAGATCTTGGG - Intergenic
902531854 1:17095815-17095837 CAATTCCCATTTCACAGCTCAGG - Intronic
903556006 1:24193871-24193893 CAGTTCCCATTTCACAGATAAGG + Intergenic
903627118 1:24739078-24739100 AATTTTCCATTTAATATCTTTGG - Intergenic
904443318 1:30546886-30546908 CAATTCCCATTTCACAGATGGGG + Intergenic
905463440 1:38135957-38135979 CATTTCCTCTTTCTCATCGTTGG - Intergenic
905948119 1:41920634-41920656 TATTTCCCATCTAACATCTCAGG + Intronic
906106588 1:43297604-43297626 CATTTCAGATTTCACATTTTCGG - Intergenic
906140810 1:43532329-43532351 CCTCTCCCATTTCACAGCTCAGG - Intronic
906559661 1:46747143-46747165 CATTTCCCTGTTCACTGCTTTGG + Intergenic
906610407 1:47197902-47197924 CATTTCGGATTTCAGATTTTTGG + Intergenic
906911236 1:49953645-49953667 CATTTCAGATTTCAGATTTTTGG + Intronic
907279380 1:53336197-53336219 AATTTTCCATTTAATATCTTTGG - Intergenic
907574699 1:55515598-55515620 CATTTCCCATTTCTTTCCTTAGG + Intergenic
908858870 1:68460556-68460578 AATCTCCCATTTTACATATTGGG + Intergenic
908906434 1:69017247-69017269 CATCTCACATTACACATATTAGG - Intergenic
909580468 1:77227801-77227823 CATTTCCCAGTTCTCCTCATTGG - Intergenic
909747141 1:79111731-79111753 CATTTCCCATTTCAATTTGTAGG + Intergenic
909852921 1:80491793-80491815 CATTTCAGATTTCAGATGTTTGG - Intergenic
910047942 1:82940070-82940092 CTGTTCCCATTTCACATTTCAGG + Intergenic
910372968 1:86537576-86537598 CATTTCCCATTTCACAGGTAAGG - Intergenic
911588016 1:99713562-99713584 AATTTCACATTTCAGAGCTTGGG - Intronic
911633360 1:100207179-100207201 CATTTCAGATTTCAGATATTTGG - Intronic
913005361 1:114625078-114625100 CAGTTTCCATTTCCCAGCTTAGG - Intronic
913749796 1:121950427-121950449 AATTTCCCTTTTCAGATCTACGG + Intergenic
914951663 1:152120562-152120584 CATATCCCACTTCAAATCATTGG - Intergenic
915228993 1:154431934-154431956 AATTTCCCATTTAATATTTTTGG + Intronic
915681999 1:157590300-157590322 CATTTCATATTTCAGATTTTTGG - Intronic
916920548 1:169461526-169461548 CTTTTCCAATTATACATCTTAGG + Intergenic
917563852 1:176190313-176190335 CATTTCAAATTTCAGATTTTTGG + Intronic
917786852 1:178468327-178468349 CATTTTTTATTTCACAGCTTAGG - Intronic
917908081 1:179609481-179609503 CATTTCAAATTTCAGATTTTTGG + Intronic
918128143 1:181602408-181602430 CATTTCAGATTTCACATTTTTGG - Intronic
918902789 1:190445654-190445676 AATTTTCAATTTCACATTTTTGG + Intronic
920740455 1:208576945-208576967 CATTTCCCAATTCACAGGTCAGG - Intergenic
920943776 1:210509336-210509358 CATTTCAGATTTCAGATTTTTGG + Intronic
921242773 1:213203226-213203248 CATTTCAAATTTCAAATTTTTGG - Intronic
921267757 1:213439195-213439217 CATATGCCAATTCACATCATGGG - Intergenic
921577569 1:216854597-216854619 CCTTTCCACTTTCACTTCTTAGG + Intronic
921810837 1:219511823-219511845 CATTTTCTATATCACATCTTAGG - Intergenic
922249049 1:223830309-223830331 CATTTCAGATTTCAGATTTTTGG + Intronic
922307203 1:224354497-224354519 AATTTTCCATTTAACATTTTAGG - Intergenic
922768262 1:228167196-228167218 CTTTTTCCATATCACATCTCTGG + Intronic
923204052 1:231740925-231740947 CATTTCAAATTTCAGATTTTTGG + Intronic
923416130 1:233762958-233762980 CATTTCCAGTTTGACATCATTGG + Intergenic
923836161 1:237613708-237613730 CATTTCGAATTTCAGATTTTTGG - Intronic
1063929513 10:11015221-11015243 AATTTCTCATTTCACTGCTTTGG - Intronic
1064281243 10:13953419-13953441 AATTTCCCATTGACCATCTTTGG - Intronic
1064484142 10:15767342-15767364 CATCTCCAATTCCACCTCTTTGG + Intergenic
1064595319 10:16938759-16938781 TATTTTCCATTTCATATCTAAGG - Intronic
1066447291 10:35495020-35495042 CATTTTGGATTTCACATTTTTGG + Intronic
1067672859 10:48341357-48341379 CATTTCAGATTTCAGATGTTTGG - Intronic
1067961663 10:50859753-50859775 CCATTCCCATTTTGCATCTTAGG + Intronic
1068113931 10:52715411-52715433 TATTTTCCATTTCAGATGTTGGG + Intergenic
1068257605 10:54533822-54533844 CTTTAACCATTTCAAATCTTTGG + Intronic
1068539765 10:58278732-58278754 CATTTCAGATTTCAAATTTTTGG - Intronic
1068566426 10:58580447-58580469 CATTTCAGATTTCAAATTTTTGG + Intronic
1069814281 10:71183838-71183860 CATTTCTCATCACCCATCTTAGG - Intergenic
1071456473 10:85855132-85855154 CATTGCCCATCTCCCAGCTTTGG + Intronic
1071590398 10:86867167-86867189 CATTTCAGATTTCAGATTTTTGG - Intronic
1072489616 10:95891422-95891444 CATTTCAGATTTCAGATTTTGGG - Intronic
1072607302 10:96995364-96995386 AATTTCTCATTTCACTGCTTCGG - Intergenic
1072734339 10:97868969-97868991 TATTTCCCATTTTACATATGGGG + Exonic
1072901475 10:99411323-99411345 CTTTTCCACTTTCAGATCTTAGG - Intronic
1073193659 10:101670336-101670358 CATTTCCCATTTAACACATGTGG - Intronic
1073881587 10:107987597-107987619 CATTTTCCCTTCCAAATCTTTGG - Intergenic
1073929496 10:108557894-108557916 AATTTCCATTTTTACATCTTTGG - Intergenic
1074758187 10:116643503-116643525 AATTTCCCATTTCCTATTTTGGG + Intronic
1074954737 10:118377504-118377526 CATTAGCCATGTGACATCTTAGG + Intergenic
1075319386 10:121477821-121477843 CATTTCCCTCTTCAGATCGTTGG + Intergenic
1075504110 10:123007560-123007582 CCTTTCCCATTTCCCTACTTAGG - Intronic
1076375716 10:129983376-129983398 CAATCCCCCTTTCACATTTTGGG - Intergenic
1077132070 11:978045-978067 CATTTCCTCTTTCCCAGCTTCGG - Intronic
1077583131 11:3430293-3430315 CATTCCCCATTTTACAGCTGGGG + Intergenic
1078263478 11:9734090-9734112 CATTTCCAATTTCAGACTTTTGG - Intronic
1078765400 11:14292119-14292141 CATTTCAGATTTCAGATTTTTGG + Intronic
1078798609 11:14619926-14619948 TATTTCCCATTTCATAAGTTAGG + Intronic
1078901512 11:15647021-15647043 CATTTCTCCCTTCGCATCTTAGG - Intergenic
1079383307 11:19957853-19957875 CATTTGCCATTAGACATCTGTGG - Intronic
1079511305 11:21214199-21214221 CATTTCGGATTTCAAATTTTTGG - Intronic
1079653147 11:22956222-22956244 CTTTTCCCATTTAACAGCTCTGG - Intergenic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1079962605 11:26942513-26942535 CATTTCCATTTTTACATTTTCGG + Intergenic
1081002571 11:37693314-37693336 TAGTCCCCATTTCACATATTTGG - Intergenic
1081239355 11:40683838-40683860 GTTTTCCCTTTTCAAATCTTTGG - Intronic
1081273712 11:41120667-41120689 CCTTTCCCCTTTCAGATCTAAGG + Intronic
1081278564 11:41180987-41181009 CAGTTACCAGTTCTCATCTTTGG + Intronic
1081748575 11:45490233-45490255 CATTTCCGATTTCAGATTTTTGG - Intergenic
1082216097 11:49571729-49571751 TATTTCCAATTTCACATTTTAGG + Intergenic
1082906580 11:58313780-58313802 CATTTTCCCTTTCCCAACTTGGG - Intergenic
1082933678 11:58634703-58634725 CACTTTCTATTTCTCATCTTGGG + Intergenic
1084240047 11:67813096-67813118 CATTCCCCATTTTACAGCTGGGG + Intergenic
1084832399 11:71779745-71779767 CATTCCCCATTTTACAGCTGGGG - Intergenic
1085370544 11:75999826-75999848 CATTTCAGATTTCAGATTTTAGG + Intronic
1085433574 11:76479187-76479209 CATTTCAGATTTCAGATTTTCGG - Intronic
1085850658 11:80115777-80115799 CATTTCCCATTCCACATTACTGG + Intergenic
1086290566 11:85304513-85304535 CATTTCAGATTTCAGATTTTGGG - Intronic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1086633485 11:89052746-89052768 TATTTCCAATTTCACATTTTAGG - Intronic
1087324353 11:96702615-96702637 CATCTACCCTTTCTCATCTTAGG - Intergenic
1087420001 11:97910355-97910377 TATATCTCATTTCACATTTTTGG + Intergenic
1087534848 11:99430170-99430192 CCTTTCCCCTTTACCATCTTTGG - Intronic
1087872939 11:103321032-103321054 AAATTCCCATTGTACATCTTTGG - Exonic
1088344016 11:108802243-108802265 CATTTCAGATTTCAGATTTTTGG - Intronic
1088488506 11:110364673-110364695 CCTTGCTCATTTCACATTTTGGG - Intergenic
1088582427 11:111328986-111329008 CATTTCAAATTTCAGATTTTTGG + Intergenic
1089902930 11:122007139-122007161 CATTTGCAACTTCACACCTTAGG + Intergenic
1090813995 11:130274251-130274273 CATTTCAAATTTTACATTTTTGG + Intronic
1092410284 12:8247639-8247661 CATTCCCCATTTTACAGCTGGGG + Intergenic
1092668042 12:10828559-10828581 CATTTCAAATTTCAGATTTTTGG + Intronic
1093077929 12:14776079-14776101 CAGTACAGATTTCACATCTTTGG + Intronic
1093185127 12:16011417-16011439 CATTTCACATTTCAGATTTTTGG - Intronic
1096031821 12:48424345-48424367 TATTTCCTAATTCACTTCTTGGG - Intergenic
1096988739 12:55780897-55780919 AATTTCCCATTTAATATTTTAGG + Intronic
1098031877 12:66263476-66263498 CATTTCAGATTTCAGATCTTTGG + Intergenic
1098347082 12:69516949-69516971 CATTTCAGATTTCAAATTTTTGG - Intronic
1098360236 12:69647369-69647391 CGTTTCCCCTTTCAGAGCTTGGG - Intronic
1098383030 12:69889497-69889519 CATTTCAGATTTCAGATTTTTGG - Intronic
1098643413 12:72866976-72866998 CATTTCAGATTTCAGATTTTGGG + Intergenic
1099029455 12:77507045-77507067 TATTTCACATTTCACAACATTGG + Intergenic
1100511502 12:95279203-95279225 CATTTCAAATTTCAAATTTTTGG - Intronic
1101179562 12:102199679-102199701 CATTTCAGATTTCAGATTTTGGG - Intergenic
1101909042 12:108849099-108849121 GATTTCCCAATTCCAATCTTGGG + Intronic
1105500001 13:20963596-20963618 CATTTCAAATTTCAGATTTTCGG - Intergenic
1105979794 13:25506874-25506896 CATTTCAAATTTCAGATTTTCGG + Intronic
1106019843 13:25904190-25904212 CATTTCAGATTTCACATTTTTGG + Intronic
1106077329 13:26472052-26472074 TACTTCCCACTTCACATCATCGG - Intergenic
1107004135 13:35588063-35588085 CATTTTACATTTTACATTTTTGG + Intronic
1107357696 13:39585322-39585344 TATTTGCCATATCACATTTTTGG - Intronic
1108090332 13:46842925-46842947 CATTTTCCATTTAATATTTTCGG - Intronic
1108312221 13:49205538-49205560 CATTTCCAATTTCAGATTTTTGG + Intronic
1108427034 13:50313019-50313041 AATTTACCATTCCGCATCTTTGG - Intronic
1109410011 13:61951144-61951166 CATTTCAAATTTCAGATTTTTGG - Intergenic
1109889950 13:68598170-68598192 CATTTCAGATTTCAGATTTTGGG + Intergenic
1110096607 13:71531657-71531679 CAGTTCCCAATACACATCTGTGG + Intronic
1111280915 13:86023675-86023697 CATTTCAGATTTCACATTTTTGG - Intergenic
1111523264 13:89432484-89432506 AATTTCCTACTTCACATCCTTGG + Intergenic
1112581843 13:100682958-100682980 CATGACCCATTTCACACCTAGGG + Intergenic
1112742487 13:102490854-102490876 CTGTTCCCAGATCACATCTTGGG + Intergenic
1112768424 13:102771776-102771798 CCTTCCCCATTTCACCTGTTGGG - Intronic
1113080035 13:106509798-106509820 CATTTCCCATTTCCTTTCTAGGG + Intronic
1113153557 13:107291318-107291340 CTTTTCAGATTTCACATTTTTGG - Intronic
1113956182 13:114100941-114100963 AATTTTCCATTTAACATTTTTGG + Intronic
1115005567 14:28479393-28479415 CATTTCTCTTTTCTCCTCTTAGG - Intergenic
1115092450 14:29594512-29594534 CATTTCCCATTTTACAGATGAGG + Intronic
1115389510 14:32838780-32838802 AATTTCCCATTTAATATTTTGGG - Intergenic
1115713403 14:36075135-36075157 CATTTCATATTTTAGATCTTAGG - Intergenic
1116410908 14:44622348-44622370 CATTTCAGATTTCAGATTTTTGG - Intergenic
1116926633 14:50645298-50645320 CATTTCAAATTTCAGATTTTTGG - Intronic
1116941523 14:50796133-50796155 CATTTTCCATTTCTCCTATTTGG + Intronic
1117154194 14:52921774-52921796 CATTTCAGATTTCAGATTTTTGG + Intronic
1117194723 14:53328404-53328426 AATGACCCATTTCAGATCTTTGG - Intergenic
1117606370 14:57432472-57432494 CATTTCCCTTTCCTCATCTATGG - Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118315778 14:64725313-64725335 CCTTTCCCAGATCACATCTGGGG - Intronic
1118811014 14:69273741-69273763 CAATACCCACTTCACATATTTGG + Intronic
1118946195 14:70389723-70389745 CATTTCAAATTTCAGATTTTTGG + Intronic
1119074828 14:71626852-71626874 CATTTTGCCTTTCAAATCTTTGG + Intronic
1120390175 14:83896993-83897015 CATTTCCAATTTCAGATTTCTGG - Intergenic
1120860588 14:89251810-89251832 CATTTCCCATAGCACATCATTGG - Intronic
1121444487 14:93969965-93969987 CTTTTCCCATTTCACAGATGTGG - Intronic
1122669804 14:103362079-103362101 AATTTTCCATTTCATATTTTTGG + Intergenic
1124452615 15:29810048-29810070 CATTTCAGATTTCAGATTTTTGG - Intronic
1124692436 15:31836023-31836045 CATTTCAGATTTCAGATCTTTGG + Intronic
1125081534 15:35679371-35679393 CAGCTCCCATTTCAAATATTTGG - Intergenic
1125132273 15:36297222-36297244 GATTTTGAATTTCACATCTTGGG + Intergenic
1125404930 15:39342158-39342180 CATTTCTCTTTTGCCATCTTGGG - Intergenic
1126171517 15:45699278-45699300 CATTGCCCACTTCATATCTAAGG + Intergenic
1126317735 15:47388359-47388381 GATTTTCCATTTCATATTTTTGG - Intronic
1126853959 15:52819219-52819241 CATTTCGCATTTTACATTTGAGG + Intergenic
1127873703 15:63094317-63094339 CTTTCCCCATTTCACATTTCTGG - Intergenic
1127917485 15:63467083-63467105 CGTTTCACATTTCACAGCTGGGG + Intergenic
1128259907 15:66226005-66226027 AATTTGCCATTTAACATTTTTGG - Intronic
1128498902 15:68213725-68213747 CATTTCAGATTTCAGATTTTTGG + Intronic
1129621233 15:77148471-77148493 TGTTTTTCATTTCACATCTTTGG + Intronic
1129832569 15:78680354-78680376 CATTTCCAATTTCGGATTTTCGG - Intronic
1130767218 15:86882970-86882992 CATTTCACAATTCACATCTCTGG - Intronic
1131521587 15:93120192-93120214 CATTTTCAATTTCAGATTTTCGG + Intergenic
1131672382 15:94633205-94633227 CATTTCACTATTCAGATCTTGGG - Intergenic
1133144261 16:3772011-3772033 AATTTCCCATTTAATATTTTTGG + Intronic
1135467483 16:22699708-22699730 CATTTCTAATTTCAGATTTTTGG - Intergenic
1135504704 16:23026432-23026454 CATTTCAAATTTCAAATCTCTGG - Intergenic
1135640963 16:24119469-24119491 CAGTTCCCATTTCCCATCCTGGG - Intronic
1135693919 16:24570034-24570056 CTTTTCTGATTTGACATCTTTGG - Exonic
1135899171 16:26440782-26440804 CTTCTCCCATTTCACATATAAGG + Intergenic
1136703863 16:32169326-32169348 CATTTGCCATTTCATATCCGTGG - Intergenic
1137227955 16:46532963-46532985 AATTTACCATTTGACATTTTTGG - Intergenic
1137926051 16:52543312-52543334 CATTTCGGATTTCAGATTTTTGG - Intronic
1139890142 16:70246956-70246978 CATTTCGCTTTTCAGATCATGGG - Exonic
1140097327 16:71885409-71885431 CATTATCCATTTGACATCTTAGG - Intronic
1140317309 16:73911683-73911705 AATTTCCCATTTGACATAGTGGG + Intergenic
1140685358 16:77428661-77428683 CATTTCAGATTTCAAATTTTTGG - Intronic
1203066193 16_KI270728v1_random:1020402-1020424 CATTTGCCATTTCATATCCGTGG + Intergenic
1144198336 17:12916975-12916997 CATTTTGGATTTCACATATTCGG + Intronic
1144321444 17:14125060-14125082 CATTTCACTGTTCACATTTTAGG - Intronic
1146201525 17:30862823-30862845 CATTTCAAATTTCAGATTTTTGG - Intronic
1148916200 17:50981096-50981118 CATTTCAGATTTCAGATTTTTGG - Intronic
1149957508 17:61069109-61069131 TATTTCCCAAGTCACTTCTTTGG - Intronic
1150193193 17:63265227-63265249 CATTTCATATTTCAGATTTTTGG + Intronic
1150206175 17:63409954-63409976 CATTTTGGATTTCACATTTTTGG - Intronic
1151521339 17:74632537-74632559 CATTTCCCATTTCCAATCCCCGG + Intergenic
1153060983 18:994938-994960 TATTTCTAATGTCACATCTTTGG - Intergenic
1153267942 18:3289689-3289711 CCATGCCCATTTCACTTCTTTGG + Intergenic
1153723569 18:7932931-7932953 AATTTTCCATTTGACATTTTCGG - Intronic
1153849901 18:9084040-9084062 TATTTCCCGTTTCACATTCTAGG + Intergenic
1154015825 18:10616199-10616221 CATTTCAGATTTCAAATTTTTGG - Intergenic
1154189686 18:12219443-12219465 CATTTCAGATTTCAAATTTTTGG + Intergenic
1154229394 18:12540805-12540827 AATTTTCCATTTAATATCTTTGG - Intronic
1154275869 18:12959583-12959605 CATTTCAGATTTCAGATTTTTGG + Intronic
1155733014 18:29185204-29185226 CATCTCCCTTTTGACATCCTGGG + Intergenic
1155822741 18:30398465-30398487 CATTCCCCATTTCAACTTTTAGG + Intergenic
1155846741 18:30717318-30717340 CATTTCACATTTCACTACTTTGG - Intergenic
1156133871 18:34012009-34012031 CATTTCACATTTTATATCTCAGG - Intronic
1156346471 18:36261212-36261234 CATTTCAGATTTCAGATTTTTGG - Intronic
1156876599 18:42021727-42021749 CATTTCAGATTTCAAATTTTTGG - Intronic
1156912686 18:42429265-42429287 AATTTCCCATCTCCCATCTGAGG + Intergenic
1157667286 18:49498573-49498595 CATTTCGGATTTCAGATTTTCGG + Intergenic
1157865457 18:51179607-51179629 CATTTAGGATTTCACATTTTCGG + Intronic
1158151526 18:54378235-54378257 CATTTTCCTCTTCACATTTTCGG - Exonic
1158671921 18:59483411-59483433 CATTTCAGATTTCAGATTTTTGG - Intronic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159323143 18:66881125-66881147 CATTTTAGATTTCCCATCTTAGG + Intergenic
1159801607 18:72907110-72907132 CATTTCAGATTTCATATTTTTGG - Intergenic
1160487210 18:79304517-79304539 CATTTCCAATTTTAGATTTTTGG + Intronic
1162662462 19:12181177-12181199 CACTCGCCATTTCCCATCTTCGG - Intronic
1165908156 19:39206346-39206368 CATTACCCATTTCACAGATGAGG - Intergenic
1166623725 19:44330124-44330146 CATTTCACATTTCAGATTTTTGG - Intronic
1168715516 19:58524918-58524940 CATTTCCCATCTCAGGCCTTGGG - Intronic
924970409 2:121746-121768 TAGTTCCCATTTCACATGTGAGG + Intergenic
925835580 2:7943155-7943177 CATTTGCCTTTTAACATTTTGGG + Intergenic
926352951 2:12013996-12014018 CATTTCCCTTTTCAAAGCTGGGG - Intergenic
927247741 2:20971445-20971467 CCTTTCCCATTTTCAATCTTTGG - Intergenic
927449602 2:23196323-23196345 CATTTCAGATTTCAGATTTTTGG + Intergenic
927535697 2:23856375-23856397 CATTTCAGATTTCAGATTTTTGG + Intronic
928014064 2:27637706-27637728 CATTTCAGATTTCAAATTTTTGG - Intronic
928048217 2:27960802-27960824 CTTTTTCCACTTCACATGTTAGG + Intronic
928120962 2:28583151-28583173 CATTTCAGATTTCAGATTTTCGG - Intronic
928162862 2:28944943-28944965 CATTTTCCATTTAATATTTTTGG + Intronic
928177624 2:29045747-29045769 CATTTCCGATTTCAGATTTTTGG + Intronic
928210572 2:29320589-29320611 CAATTCCCTCTTCACACCTTGGG - Intronic
928229228 2:29482046-29482068 CTTTTCCCATTTGAGATCTGTGG - Intronic
928465467 2:31518900-31518922 CAGTTCCAATTCCACATTTTTGG - Intergenic
928543728 2:32309300-32309322 CATTTTGCATTTCAGATTTTTGG + Exonic
928796724 2:35032552-35032574 AATTTTCCATTTTACATTTTTGG + Intergenic
929942967 2:46348788-46348810 CATTTCAAATTTCAGATTTTTGG - Intronic
930612591 2:53559855-53559877 AATTTTCCATTTAACATTTTTGG + Intronic
930779360 2:55208447-55208469 CATTTCAGATTTCAAATTTTTGG + Intronic
930993783 2:57691544-57691566 GAGATACCATTTCACATCTTTGG + Intergenic
931318443 2:61153580-61153602 CATTTTAAATTTCACACCTTTGG - Intronic
931532395 2:63230939-63230961 CAGATCCCATTTCTCAACTTTGG + Intronic
931973058 2:67611778-67611800 CATTTCAGGTTTCACATTTTTGG - Intergenic
931983589 2:67720536-67720558 CATTTCAGATTTCAGATTTTTGG + Intergenic
932531982 2:72544803-72544825 CATTTCCCATTTCTCATCACTGG + Intronic
932596715 2:73098229-73098251 CATTTCAGATTTCAGATTTTTGG - Intronic
932750594 2:74369197-74369219 CAGTTCCCGATTCACATCCTAGG + Exonic
932927693 2:75995600-75995622 CATTTTCTATTCCAGATCTTTGG + Intergenic
933231944 2:79817975-79817997 CATTTACCATTTCGCATATTGGG + Intronic
934583052 2:95462274-95462296 CATTTGCCTTGTCACATTTTGGG - Intergenic
934596398 2:95614440-95614462 CATTTGCCTTGTCACATTTTGGG + Intergenic
934786371 2:97011106-97011128 CATTTGCCTTGTCACATTTTGGG - Intronic
935119249 2:100167058-100167080 AATTTTCCATTTAACATTTTTGG + Intergenic
935344085 2:102088552-102088574 CATTTCTCATTTCAAAACTTAGG - Intronic
935761890 2:106328385-106328407 CATTTTGCATTTCAGATTTTTGG + Intergenic
936265538 2:111002949-111002971 CATTTCAGATTTCATATTTTTGG + Intronic
936381517 2:111990790-111990812 CATTTCAGATTTCAGATTTTGGG + Intronic
937074777 2:119094942-119094964 CATTTGCCATTTCCAATGTTTGG + Intergenic
937363538 2:121245029-121245051 CATTCCCCATTTGCCATGTTAGG - Intronic
937838126 2:126494818-126494840 CATTAACCATTTCACAACTCTGG + Intergenic
939326619 2:140698621-140698643 CTTTTCCAATTACACAACTTCGG - Intronic
940119683 2:150250308-150250330 CAATTCACATTTCCCATGTTAGG - Intergenic
940274281 2:151922661-151922683 CATTTCCAGTATCAGATCTTTGG + Intronic
940332379 2:152489246-152489268 CCTTTCCCATTCCACCTCTTCGG - Intronic
940428718 2:153561595-153561617 CATTTTGCATTTCAGATTTTTGG + Intergenic
941285224 2:163603666-163603688 CATTTCTGAATTCACATCTGTGG + Exonic
941638488 2:167961864-167961886 CAGGACCCATTTCACATCTTGGG + Intronic
942297308 2:174530225-174530247 AATTTTCCATTTAACATTTTTGG + Intergenic
942560949 2:177217895-177217917 CAGTTCCCATGACACATATTTGG + Intronic
942685657 2:178528831-178528853 CAGTACCCATTTCACATCAGTGG + Exonic
942745580 2:179228319-179228341 GATTACACATTTCACATTTTGGG + Intronic
942877633 2:180820631-180820653 ATTATCCCATTTCACATCTATGG - Intergenic
943538621 2:189183619-189183641 CCTTCCCTATTTCAGATCTTTGG - Intergenic
943931089 2:193854233-193854255 GAGTTCCCATTCCAAATCTTAGG - Intergenic
943978598 2:194515715-194515737 CATTTTGGATTTCAAATCTTTGG + Intergenic
944153323 2:196585424-196585446 CATTTCCTTTTTCCCCTCTTTGG - Intronic
944280229 2:197887141-197887163 CATATACCATCTCAGATCTTTGG + Intronic
944615649 2:201456900-201456922 CATTTCACATGTCACAACTCTGG - Intronic
944700634 2:202242944-202242966 GATGTCCCATTCCAAATCTTGGG + Intergenic
945311468 2:208318431-208318453 CATTGCCCATATTACACCTTAGG - Intronic
945744928 2:213708822-213708844 CACTTGCCATTTAACATTTTGGG - Intronic
945905781 2:215591399-215591421 CATTTCCCTTTTGACAGATTTGG - Intergenic
946058002 2:216918261-216918283 CACTTCCCATCTCAGATCCTGGG + Intergenic
946264114 2:218523426-218523448 CATTTCAGATTTCAGATTTTTGG + Intronic
946265853 2:218540677-218540699 AATTTTCCATTTAACATTTTTGG + Intronic
947685942 2:232084393-232084415 CATTTCAGATTTCAGATTTTAGG - Intronic
947827992 2:233119038-233119060 CCTTTCAGATTTCACATCTCTGG + Intronic
947878448 2:233483697-233483719 CATTTCAGATTTCAAATTTTTGG + Intronic
948136522 2:235640436-235640458 CATTACCCATCTCAGAACTTAGG + Intronic
948886127 2:240885826-240885848 CATTTCCTATTCTCCATCTTTGG - Intergenic
1169507767 20:6231366-6231388 CATATTTCGTTTCACATCTTTGG + Intergenic
1170177706 20:13490809-13490831 CATTCCCCATTTTACAGCTATGG - Intronic
1170788022 20:19484436-19484458 CATTTCAGATTTCAGATTTTTGG + Intronic
1170794111 20:19531758-19531780 CGTTTCCCAGTTCATACCTTGGG - Intronic
1171500039 20:25585946-25585968 CATTTCGGATTTCAGATGTTTGG - Intergenic
1172928604 20:38564538-38564560 CATTTCCCCTTTCCAATTTTTGG + Intronic
1173189679 20:40866453-40866475 CATTTCAGATTTCAGATGTTTGG - Intergenic
1173698390 20:45043684-45043706 CATTTCAAATTTCATATTTTTGG + Intronic
1173754889 20:45507258-45507280 AATTTTCCATTTCATATTTTTGG + Intergenic
1175608054 20:60327731-60327753 CATTTCCCACTTCCCATTTCTGG - Intergenic
1176694026 21:9952049-9952071 CTTTTCCCAGTTCTTATCTTTGG + Intergenic
1177330974 21:19662275-19662297 CATTTCAGATTTCAAATTTTGGG - Intergenic
1177775276 21:25560456-25560478 AATTTCCCATTTCTCATTCTAGG - Intergenic
1178382879 21:32125894-32125916 CACTTCCCTTTACTCATCTTAGG - Intergenic
1178421264 21:32445309-32445331 CCTGTCCCATTCCACATCTGTGG + Intronic
1178758509 21:35377283-35377305 CATTTTACATTTTATATCTTTGG - Intronic
1178799757 21:35781752-35781774 CATTTCCCTTTTGAGTTCTTTGG + Intronic
1179335614 21:40449399-40449421 CATTTACAATTTCACATTGTGGG - Intronic
1181486528 22:23235053-23235075 CAGTTCCCATTTCACCTCCTGGG + Intronic
1181565131 22:23731923-23731945 CTTTTCCCTTTTCATATGTTAGG - Intergenic
1181733631 22:24865524-24865546 CTTTTCTCATTTCACAGCTAGGG + Intronic
1182167388 22:28190035-28190057 TATTCCCCATTTTACATTTTAGG + Intronic
1182208702 22:28654752-28654774 CATTTCCCACTTCCCACCTAAGG - Intronic
1182434338 22:30320686-30320708 CATTTTCTACTTCCCATCTTTGG - Intronic
1182520988 22:30884502-30884524 CAGGCCCCATTTCACATCTCTGG + Intronic
1184113470 22:42408915-42408937 TTTTTCCCATTTCACAGCTCTGG - Intronic
1184412567 22:44333366-44333388 CATTTCCGATGCCACATCCTGGG + Intergenic
1184490870 22:44808136-44808158 CATTTCCCAGATGACATCTGAGG - Intronic
949281357 3:2351668-2351690 AATTTCCCATTTAATATTTTTGG + Intronic
949384336 3:3482964-3482986 CATTTACTATGTTACATCTTAGG - Intergenic
950274548 3:11647629-11647651 CATTTTTCATTTCAGATTTTTGG + Intronic
950644868 3:14371108-14371130 CATTGCCCATTTCACAGATGAGG - Intergenic
952244046 3:31565801-31565823 CATTTCAGATTTCAATTCTTTGG - Intronic
953258069 3:41308759-41308781 CATTTCAGATTTCAGATTTTTGG + Intronic
953334763 3:42085089-42085111 CATTTCAGATTTCAGATTTTTGG + Intronic
953345060 3:42168549-42168571 CATTTCCCACTTCTGATCCTTGG + Intronic
953777392 3:45832433-45832455 CATTTCAGATTTCAGATTTTTGG + Intronic
953945709 3:47145651-47145673 CATTTCAGATTTCACATTTTTGG + Intronic
955248467 3:57251739-57251761 GATTTCCCATTTCACATTCCTGG + Intronic
955541919 3:59985577-59985599 CATTTGGCATTTCCCATCTCAGG + Intronic
955624575 3:60904060-60904082 CATTTCTCATTTTCCAGCTTTGG + Intronic
955835522 3:63050322-63050344 CATTTCAAATTTCAGATTTTTGG + Intergenic
955884272 3:63580939-63580961 TATTGCCCATTTCACAGATTTGG + Intronic
956799137 3:72740980-72741002 CATTTCCCAATTCAAATTTCCGG + Intergenic
957055522 3:75439768-75439790 CATTCCCCATTTTACAGCTGGGG + Intergenic
959188742 3:103082439-103082461 GAATCCCCATTTCTCATCTTCGG + Intergenic
960196163 3:114770948-114770970 CATTTCAGATTTCAGATTTTCGG + Intronic
960334714 3:116402175-116402197 TATTTGCGATTTCACATGTTAGG + Intronic
961298867 3:125908838-125908860 CATTCCCCATTTTACAGCTGGGG - Intergenic
961472649 3:127125828-127125850 CAGTTCCAATGTCACCTCTTTGG - Intergenic
961794964 3:129402821-129402843 CACTTCCCCTTTCTCATCCTTGG + Intronic
961854723 3:129858360-129858382 AATTTCCCATTTTACATTTTTGG + Intronic
961889195 3:130116153-130116175 CATTCCCCATTTTACAGCTGGGG + Intergenic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
962700035 3:137988857-137988879 CATTTCCCCTCTGACTTCTTAGG - Intergenic
962753191 3:138449672-138449694 CACTTCCCATCCCACACCTTTGG - Intronic
963618969 3:147580369-147580391 CATTTCCCATAAGACATTTTAGG + Intergenic
963687661 3:148457724-148457746 CATTTCAGATTTCAAATTTTGGG + Intergenic
963768290 3:149361725-149361747 GATTTCCAATGTCACAACTTTGG - Intergenic
964089333 3:152855707-152855729 CATTTCAGATTTCAAATTTTTGG - Intergenic
965573719 3:170196903-170196925 CATTTTCCATTTAATATTTTTGG - Intergenic
965610645 3:170540200-170540222 AATTTTCCATTTCATATTTTTGG + Intronic
965726831 3:171726494-171726516 CATCTCCCATTTCACACTGTGGG - Intronic
965983972 3:174728651-174728673 TTTTTCCCATTTCACATATGAGG + Intronic
966623640 3:181993168-181993190 CATTTCCCAAATCACATTTTAGG - Intergenic
966825336 3:183960355-183960377 AATTTCCCATTTCTCTACTTTGG + Intronic
967764089 3:193258533-193258555 CATTTCCGATTGTACTTCTTTGG - Intronic
967958897 3:194902479-194902501 CCTTTCCCATTTTTCATATTTGG + Intergenic
968998335 4:3960076-3960098 CATTCCCCATTTTACAGCTGGGG + Intergenic
969323546 4:6427450-6427472 CAGCTCCCATTTCACACCCTTGG + Intronic
969755664 4:9148576-9148598 CATTCCCCATTTTACAGCTGGGG - Intergenic
970618700 4:17794453-17794475 CATTTCAGATTTCAAATTTTTGG + Intergenic
970784449 4:19779823-19779845 CATTTCTGATTTCACTTATTTGG + Intergenic
971764028 4:30806078-30806100 CATTTCGGATTTCAGATTTTTGG + Intronic
972667192 4:41177874-41177896 CATTTCAGATTTCAGATTTTTGG - Intronic
972715482 4:41641802-41641824 CATTTCAGATTTCAGATTTTTGG + Intronic
972899887 4:43669770-43669792 CTTTTCCCATCTCACACTTTGGG + Intergenic
972964491 4:44492780-44492802 CATTTCAGATTTCAGATTTTTGG - Intergenic
973690646 4:53426515-53426537 CATTTCAGATTTCAGATTTTTGG + Intronic
973905518 4:55526032-55526054 CATTTCAGATTTCAGATTTTCGG + Intronic
974639573 4:64610856-64610878 CATTTACCATTTCACTTCTAGGG - Intergenic
974856611 4:67468534-67468556 AATTTTCCATTTAACATTTTTGG + Intergenic
975274809 4:72484364-72484386 CATTTACCCTTTCAAAACTTGGG + Intronic
975834402 4:78406865-78406887 CATTTCAGATTTCAGATTTTTGG - Intronic
976261476 4:83149018-83149040 CACTTACCATTTCACCACTTAGG - Intergenic
976369117 4:84266857-84266879 CATGTCACATTTCACAGCTTTGG - Intergenic
976380798 4:84396021-84396043 CATTTCAGATTTCAGATTTTTGG + Intergenic
976418260 4:84804962-84804984 CATTTCAGATTTCAGATTTTTGG - Intronic
976914001 4:90347475-90347497 AATTTTCCATTTCATATTTTTGG - Intronic
976923676 4:90469929-90469951 CATTTCAAATTTCATATTTTTGG - Intronic
977364605 4:96052200-96052222 CCTCTCCCATTTCCCATTTTAGG + Intergenic
977444640 4:97115217-97115239 CATTTCAGATTTCAAATTTTTGG + Intergenic
977463316 4:97353657-97353679 CATTTCAGATTTCACATCTTTGG - Intronic
978172016 4:105683379-105683401 AATTTCCCAATTCATAACTTGGG - Intronic
978305660 4:107325369-107325391 CATTTCAGATTTCAGATTTTTGG - Intergenic
978367897 4:108001822-108001844 AATTTCCCATTTAATATTTTTGG + Intronic
979585572 4:122411684-122411706 CATTTCATATTTCAGATTTTTGG + Intronic
980366649 4:131812242-131812264 CTTTTCCCAGTTCTTATCTTTGG + Intergenic
980449483 4:132951131-132951153 CATTTCTCATTTTACTTATTTGG - Intergenic
981016930 4:139983657-139983679 CATTTCAGATTTCAGATTTTTGG + Intronic
981301803 4:143195307-143195329 CATTTCAGATTTCAAATTTTTGG + Intronic
981315149 4:143334610-143334632 CAATTCCCATTTCACATATCGGG + Intergenic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
982019379 4:151188488-151188510 CATTTCAGATTTCAGATTTTTGG - Intronic
983111708 4:163758311-163758333 GATTTCCAATCTCACATCTTAGG + Intronic
983150952 4:164280709-164280731 CATTTTCCACTTCAAATTTTGGG + Intronic
983563738 4:169127959-169127981 CATTTCGGATTTCAGATTTTTGG - Intronic
984009405 4:174352718-174352740 CATTTCAGATTTCAGATCTTTGG - Intergenic
984631794 4:182068487-182068509 CTTTCCTCATTTCTCATCTTAGG - Intergenic
984647239 4:182232967-182232989 AATTTTCCATTTAACGTCTTTGG + Intronic
985118159 4:186612511-186612533 CATTTCGGATTTCAGATTTTTGG + Intronic
985190950 4:187372209-187372231 CACTTCACATTTCAGATTTTTGG + Intergenic
985198164 4:187455539-187455561 CATTTCCCATTTCAGTTTTATGG + Intergenic
985333942 4:188871569-188871591 CATTTTACATTTCTCACCTTTGG + Intergenic
986079433 5:4374970-4374992 AATTTTCCATTTAACATTTTTGG - Intergenic
986084392 5:4429509-4429531 GAATTCCCATTCCACATATTTGG - Intergenic
986232380 5:5878373-5878395 CATTTAACATATCACACCTTGGG + Intergenic
987181959 5:15377378-15377400 CATTTCCGGTTTCACATATCTGG + Intergenic
987794912 5:22615056-22615078 AATTTTCCATTTAACATTTTTGG + Intronic
988419153 5:30984766-30984788 CATTTCCCTTTTGTCAACTTTGG + Intergenic
988468372 5:31513003-31513025 CATTTGTCATCTCACAGCTTGGG - Intronic
989021148 5:37010884-37010906 CATTTCCGATTTTAGATTTTTGG - Intronic
989162343 5:38403692-38403714 AATTTCCCATTTAATATTTTTGG + Intronic
989362168 5:40614581-40614603 GATTTCCCATTTTCCATCATGGG - Intergenic
989436019 5:41414675-41414697 AATTTTCCATTTAACATTTTTGG - Intronic
989491821 5:42064881-42064903 AATTTCCCATTTAATATTTTTGG - Intergenic
989848559 5:46177790-46177812 TATTCCCTTTTTCACATCTTGGG + Intergenic
990054326 5:51552297-51552319 CATTTGTAATTTCACAGCTTTGG + Intergenic
990851252 5:60207274-60207296 CATTTCCCCTTAACCATCTTAGG - Intronic
991087827 5:62664504-62664526 CATTTCAGATTTCAGATTTTAGG + Intergenic
991292206 5:65044032-65044054 CAATTCCCATTTCACAGATGAGG + Intergenic
991903984 5:71489257-71489279 CATTTCCCATTAGACATTTTAGG + Intronic
991973865 5:72166705-72166727 CATTTCCCTTTACACATCCTCGG - Intronic
992491945 5:77253388-77253410 GTTTTCCCCTTTCACATCTTTGG + Intronic
992787010 5:80179778-80179800 TATTTCACATTTCAGATGTTTGG + Intronic
992817633 5:80461069-80461091 CATTTCAGATTTCAGATTTTTGG - Intronic
993207571 5:84902818-84902840 AATTTCCCATATCACATTTTTGG - Intergenic
993729546 5:91406170-91406192 CAATTCAGATTGCACATCTTTGG + Intergenic
993840348 5:92870408-92870430 TTTTTCCCATTACACATTTTTGG + Intergenic
994322382 5:98408232-98408254 CATTTCCCACTTCCCAAATTAGG + Intergenic
995074290 5:107963316-107963338 AATTTCTCATTTCCCATTTTGGG - Intronic
995277707 5:110295666-110295688 AATTTTCCATTTAATATCTTAGG - Intronic
995290470 5:110445605-110445627 CATTTACCATTTCAGGTTTTTGG + Intronic
995539208 5:113168013-113168035 CATTTCAGATATCACATTTTTGG + Intronic
996093490 5:119374252-119374274 CATTTCAGATTTCAAATTTTTGG - Intronic
997138703 5:131354784-131354806 CATTTCAGATTTCAGATTTTTGG - Intronic
997378181 5:133413711-133413733 TCTTTCGCATTTCCCATCTTTGG + Intronic
997942194 5:138168381-138168403 TATTCCCCATGTCACATTTTAGG + Intronic
998491430 5:142550518-142550540 CATTTCCCAGAGCACACCTTTGG - Intergenic
998585077 5:143419007-143419029 CATTTCCGATTTCAGAATTTGGG - Intronic
999089146 5:148920400-148920422 AATATCCCATTCCACATCTGTGG - Intergenic
1000679917 5:164170833-164170855 CATTTCCCATATCAGGTCCTGGG - Intergenic
1000906760 5:166973628-166973650 CATTTCAGATTTCAAATTTTTGG + Intergenic
1001270932 5:170311171-170311193 CATATCCCATTTGACATATCAGG + Intergenic
1001292162 5:170471485-170471507 CATCTCCCTTTTCACAGCTCAGG + Intronic
1001350763 5:170961522-170961544 CATTTCAAATTTCAGATTTTTGG - Intronic
1001359810 5:171071397-171071419 CTTTTTCCATTTCAAATTTTGGG - Intronic
1001715136 5:173809212-173809234 CTTTTAACATTTCATATCTTTGG + Intergenic
1001822062 5:174718300-174718322 CATTTCACATTTCACCTCCGCGG + Intergenic
1002257388 5:177968114-177968136 CATTTAGCATTTCATATTTTGGG - Intergenic
1002946726 6:1768587-1768609 CATTTCAGATTTCAGATTTTTGG - Intronic
1004221724 6:13753106-13753128 CATTTACGATTTCAAATATTTGG - Intergenic
1005141647 6:22638449-22638471 AATTTCCCATTTCATACTTTTGG + Intergenic
1006675923 6:35763202-35763224 CATTTCTCTTATCACAACTTAGG + Intergenic
1007721928 6:43890370-43890392 TATTTCCCATTTCACAGATAAGG + Intergenic
1007825477 6:44596689-44596711 CACTTCCCATTTCACCTCATAGG + Intergenic
1007911036 6:45514355-45514377 CCTTTCCCATTTCACAGGTAGGG + Intronic
1008460879 6:51769500-51769522 CATTTCTCATTTTATATATTGGG + Intronic
1008466824 6:51840842-51840864 CATTGTGCATTTAACATCTTGGG - Intronic
1008781218 6:55108430-55108452 CTTTCCCCATCTCACATTTTGGG - Intronic
1009730332 6:67594587-67594609 ACTTTTCCATTTCACAGCTTAGG + Intergenic
1010361309 6:74997641-74997663 TATTTCCCATTTCAGTTTTTTGG - Intergenic
1012119809 6:95352645-95352667 CATTTCAGTTTTCACATTTTTGG - Intergenic
1012302395 6:97605736-97605758 TATTTCTCATTTTACATCCTTGG + Intergenic
1013861030 6:114635576-114635598 ATTTTCCCATTTCATATTTTTGG - Intergenic
1014013980 6:116508432-116508454 CATTAGCCAGTTCACACCTTTGG - Intronic
1015184088 6:130393703-130393725 CATTTCCCGTTTTACATGATGGG - Intronic
1015394935 6:132722750-132722772 AATTTCACATTTTACATGTTTGG - Intergenic
1017912382 6:158805053-158805075 GATTTCCAATTTCTGATCTTGGG + Intronic
1018205986 6:161437429-161437451 TATTTTCCATTTAATATCTTCGG + Intronic
1018394533 6:163367642-163367664 CATTTTACATTTTACATATTTGG - Intergenic
1018470448 6:164091808-164091830 AATTTTCCATTTAATATCTTTGG - Intergenic
1020345620 7:7159948-7159970 CATTTCCTTTCTCACATCCTAGG + Intronic
1020969122 7:14911793-14911815 CATTTTTATTTTCACATCTTTGG - Intronic
1020994791 7:15249813-15249835 CTTTCCCAATTTCACATCTGGGG - Intronic
1021274561 7:18633538-18633560 CTTTTCCCATTTCAAATATAAGG - Intronic
1021381186 7:19968415-19968437 CATTTCCCATTTAACTTATCTGG - Intergenic
1021791431 7:24209870-24209892 TATTTCCCCTTCCACATCCTTGG + Intergenic
1021865341 7:24950766-24950788 CATTTCACCCTTAACATCTTTGG - Intronic
1022150042 7:27593162-27593184 CATTTCGGATTTCAGATTTTTGG - Intronic
1022457509 7:30571807-30571829 CATTTCCAATTTAAAATATTAGG + Intergenic
1022746081 7:33173656-33173678 CATTTTCAAATTTACATCTTTGG + Intronic
1023168719 7:37369339-37369361 CATTTCAGATTTCAGATTTTTGG - Intronic
1024558504 7:50623959-50623981 CATTTCAGATTTCAGATTTTTGG + Intronic
1024668022 7:51565136-51565158 TATTTCACATTTCTCATCCTGGG - Intergenic
1024765858 7:52658559-52658581 CATTTTCCATTTAAAATTTTTGG - Intergenic
1024950729 7:54857875-54857897 CCTTTGCCCTTTCACATCTTGGG + Intergenic
1025577975 7:62671978-62672000 TATTTCCCATTTGTCATTTTCGG - Intergenic
1025728502 7:64089413-64089435 CTTTTCCCTTTTCATATGTTAGG + Intronic
1026633837 7:72063693-72063715 CATTTCTGATTTCAGATTTTAGG - Intronic
1027654754 7:80916846-80916868 TATATCTCATTTCACATTTTAGG + Intronic
1028352438 7:89865198-89865220 CAATTCGCATTTTACTTCTTGGG + Intergenic
1029634167 7:101772874-101772896 CATTACCAACTTCACAACTTTGG - Intergenic
1030317288 7:108128559-108128581 CATTTTCTATTTCCCATTTTAGG + Intronic
1030801203 7:113855016-113855038 CATTTCAGATTTCAGATTTTTGG - Intergenic
1030919712 7:115367099-115367121 GATTTTCCATTTAACATTTTTGG + Intergenic
1031291217 7:119938383-119938405 CATTTCCCAGTTCCCAGCCTAGG + Intergenic
1031517081 7:122714422-122714444 CATTTCCATTTTAAAATCTTTGG + Intronic
1032329475 7:130964301-130964323 CATTTCCCATTTTAGAGCTGAGG - Intergenic
1033417941 7:141180816-141180838 CATTTCTCATTTCACAGATAAGG - Intronic
1034094849 7:148397846-148397868 CATTTGCCATTTCACCTGTCAGG + Intronic
1036378911 8:8223882-8223904 CATTCCCCATTTTACAGCTGGGG - Intergenic
1036699810 8:11005271-11005293 AATTTCCCATTTAATATTTTTGG + Intronic
1036850655 8:12198718-12198740 CATTCCCCATTTTACAGCTGGGG + Intergenic
1036872020 8:12440983-12441005 CATTCCCCATTTTACAGCTGGGG + Intergenic
1038240420 8:25802988-25803010 TTGGTCCCATTTCACATCTTAGG - Intergenic
1038350102 8:26768491-26768513 CATTTCGGATTTCAGATTTTCGG - Intronic
1038812447 8:30863279-30863301 CATTTCAGATTTCAAATTTTTGG + Intronic
1039998587 8:42557197-42557219 CATTTCCCAGTCCACAGCTCAGG + Intergenic
1040660916 8:49574182-49574204 TATTGCCTATTTCACATTTTGGG + Intergenic
1040821637 8:51565089-51565111 CATTTCAGATTTCACATTTTTGG - Intronic
1040969837 8:53123822-53123844 CATTTCCCCTTCCCCATCCTTGG + Intergenic
1042231920 8:66566073-66566095 CTTTTCCAATTTGACAACTTTGG + Exonic
1042477892 8:69269713-69269735 CATTTCAGATTTCAGATTTTCGG + Intergenic
1043381372 8:79705771-79705793 CTTTTTCCATTTCAGAACTTGGG - Intergenic
1044343824 8:91079556-91079578 CATTTCCAATATGACATCTATGG - Intronic
1045668683 8:104521192-104521214 CATTTCACACTTCAGATTTTTGG - Intronic
1045859803 8:106803300-106803322 CAATCCTCACTTCACATCTTAGG + Intergenic
1048206708 8:132421364-132421386 CCTTTCCCATTTCCCAGCGTTGG - Intronic
1048471847 8:134711364-134711386 CATTTCCGATTTCGGATTTTTGG + Intronic
1048512977 8:135079077-135079099 CATTTCTCATTTCCCATTTCTGG - Intergenic
1049362793 8:142220237-142220259 CATGTCCCATTTCACAGATGAGG + Intronic
1049906406 9:221223-221245 CATTTCTCCTTTCTAATCTTGGG - Intronic
1050016459 9:1239079-1239101 CCTTTCCTATCTCACATCCTAGG + Intergenic
1050700251 9:8330223-8330245 CGTTTCCCATTTCATCTCATTGG - Intronic
1050928735 9:11298324-11298346 TATTTGCCATTTTAAATCTTAGG - Intergenic
1051115029 9:13684871-13684893 GATTTTCCATTTAACATTTTTGG - Intergenic
1051813223 9:21074543-21074565 CCCTTCCCATATCACACCTTAGG - Intergenic
1052237113 9:26224493-26224515 CATTTCCCATTTAACAAGTGAGG - Intergenic
1053264705 9:36702515-36702537 CATTTCAGATTTCAGATTTTTGG + Intergenic
1053631003 9:39938149-39938171 CTTTTCCCAGTTCTTATCTTTGG + Intergenic
1053774765 9:41525356-41525378 CTTTTCCCAGTTCTTATCTTTGG - Intergenic
1054212884 9:62312549-62312571 CTTTTCCCAGTTCTTATCTTTGG - Intergenic
1055048596 9:71956668-71956690 CATTTCAGATTTCAGATTTTTGG + Intronic
1055483588 9:76734446-76734468 CACTTCTCATTACACAACTTTGG + Intronic
1056099652 9:83288864-83288886 CAGGTTCCCTTTCACATCTTGGG + Intronic
1056143071 9:83703256-83703278 CATTTCAGATTTCATATTTTTGG - Intronic
1056405626 9:86271528-86271550 CATTTCAGATTTCAGATTTTTGG + Intronic
1058207069 9:102121605-102121627 CATTTCCCATTTCAGAGAATAGG + Intergenic
1058488838 9:105472789-105472811 CATTTGCCACCTTACATCTTTGG + Intronic
1058577457 9:106419180-106419202 CAATTCCCATTTCACAGATGAGG - Intergenic
1058692343 9:107530289-107530311 CCTTTGTCATTTCACATGTTGGG + Intergenic
1058812725 9:108656883-108656905 AATTTCCCATATCTCATCTCAGG + Intergenic
1059616388 9:115956038-115956060 CTTTTCCCATTTAATATTTTAGG - Intergenic
1059639360 9:116201675-116201697 TAATTCCCATTTCACATGTGAGG + Intronic
1059740400 9:117144319-117144341 CATTTCGGATTTCAGATTTTCGG - Intronic
1059749960 9:117238399-117238421 CCTTGCCCATTTCAAAGCTTTGG + Intronic
1060025777 9:120169933-120169955 CATTCCCCATTTAACATATAAGG + Intergenic
1060210130 9:121705124-121705146 CATTGCCCAGCTCAGATCTTGGG - Intronic
1060710348 9:125857376-125857398 CATTTCGAATTTCAGATTTTTGG + Intronic
1060827245 9:126694261-126694283 CATGTCCCATTTCACAGATGAGG + Intronic
1062041160 9:134404944-134404966 CATTTCCCCTTTCAGATCCTTGG - Intronic
1062434972 9:136542984-136543006 CAGTGCCCATTTTACATCTGAGG + Intronic
1062679178 9:137767896-137767918 CATTTTGCATTTCAGATTTTTGG + Intronic
1203413477 Un_KI270589v1:21369-21391 CATATTTCCTTTCACATCTTAGG + Intergenic
1203684835 Un_KI270757v1:37843-37865 CATATTTCCTTTCACATCTTAGG - Intergenic
1187000303 X:15169746-15169768 AATTTCCCATTTCACTTGTGTGG + Intergenic
1187710480 X:22048422-22048444 CATTTCCTATTTCCCTTCTCTGG + Intronic
1188018642 X:25133368-25133390 CATTTCAGATTTCAGATTTTTGG + Intergenic
1188522871 X:31058236-31058258 CATTTCAGATTTCAGATTTTTGG - Intergenic
1190577171 X:51851819-51851841 AATTTCCCATTTAATATTTTTGG + Intronic
1192376062 X:70563507-70563529 AGTAACCCATTTCACATCTTAGG - Intronic
1193343113 X:80374942-80374964 CATTTCAGATTTCAGATTTTTGG + Intronic
1194020706 X:88688801-88688823 CATTTCTCATTTTACATATCTGG - Intergenic
1194100637 X:89699565-89699587 CATTTCCCAATTCACATTCTTGG + Intergenic
1194165254 X:90507503-90507525 CTTTTCCACTTTCACATTTTGGG - Intergenic
1194221414 X:91197188-91197210 AATTTCCTATTTAACATGTTTGG - Intergenic
1194515870 X:94853997-94854019 CATTTCTCCTTTCACACTTTGGG - Intergenic
1195096613 X:101507317-101507339 CATTTCCCATTTTAAATATGGGG - Intronic
1195699076 X:107688843-107688865 CATTTCAGATTTCAGATTTTTGG - Intergenic
1196291025 X:113941331-113941353 CATTTCAGATTTCAGATATTTGG + Intergenic
1196711482 X:118768304-118768326 CATTTACCATCTCACAGTTTCGG + Intronic
1196979163 X:121192362-121192384 AATTTTCTATTTCACATATTTGG - Intergenic
1197346907 X:125335214-125335236 CATTTCAGATTTCAAATCTCTGG - Intergenic
1197429216 X:126340066-126340088 AATTTCCCATTTTATATTTTTGG - Intergenic
1197658117 X:129139852-129139874 CATTTTCCATATTGCATCTTAGG + Intergenic
1197660319 X:129163592-129163614 CATTTCAAATTTTACATTTTTGG + Intergenic
1197871073 X:131063416-131063438 CATTTCCCTTTTCAAAGCTAAGG + Intronic
1199013135 X:142780248-142780270 CACTTCCCATTTCTCATTTTAGG - Intergenic
1200453592 Y:3360625-3360647 CATTTCCCAATTCACATTCTTGG + Intergenic
1200511518 Y:4085313-4085335 CTTTTCCACTTTCACATTTTGGG - Intergenic
1200557924 Y:4660942-4660964 AATTTCCTATTTAACATATTTGG - Intergenic
1201164522 Y:11196503-11196525 CATTTCGGATTTCAGATTTTTGG + Intergenic