ID: 1086450705

View in Genome Browser
Species Human (GRCh38)
Location 11:86913659-86913681
Sequence AGAGTTGGAATTTAAGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086450705_1086450707 27 Left 1086450705 11:86913659-86913681 CCAGACTCTTAAATTCCAACTCT 0: 1
1: 0
2: 1
3: 22
4: 230
Right 1086450707 11:86913709-86913731 ACTAAAATATCAAGAGTTTTTGG 0: 1
1: 0
2: 1
3: 28
4: 412

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086450705 Original CRISPR AGAGTTGGAATTTAAGAGTC TGG (reversed) Intronic
902122909 1:14183201-14183223 AGAGGTGGAATTTCATAGTCCGG - Intergenic
905150889 1:35926539-35926561 CTAGTTGGAATTTCTGAGTCTGG + Exonic
907096039 1:51781916-51781938 GGAGATGGAATTTAAGAGTGTGG + Intronic
908386765 1:63650345-63650367 AGGGGTGGAATAGAAGAGTCTGG - Intronic
910839828 1:91550382-91550404 ATAGCTTGAATTTTAGAGTCAGG + Intergenic
913558624 1:119995950-119995972 AGAGTGGGAATCTTAGATTCTGG - Intronic
913639215 1:120794521-120794543 AGAGTGGGAATCTTAGATTCTGG + Intergenic
914279234 1:146155437-146155459 AGAGTGGGAATCTTAGATTCTGG - Intronic
914397714 1:147286618-147286640 AAAGTGTGAATTTTAGAGTCAGG + Intronic
914540277 1:148606367-148606389 AGAGTGGGAATCTTAGATTCTGG - Intronic
914626368 1:149464847-149464869 AGAGTGGGAATCTTAGATTCTGG + Intergenic
915833119 1:159149398-159149420 CCAGTTAGAATTTAAAAGTCAGG - Intergenic
916284191 1:163086334-163086356 AGATTTGGAATTTTAGGGACAGG + Intergenic
916303201 1:163299022-163299044 AGTGTTTGAATTTAAGAGGCAGG - Intronic
916489150 1:165286160-165286182 AGAGGAGGAAATTAAGATTCAGG - Intronic
917823368 1:178789683-178789705 AGAGGTGGTATTTAAAAGTGTGG + Intronic
918998265 1:191791537-191791559 AGAGTAGGTTATTAAGAGTCTGG - Intergenic
920594862 1:207259111-207259133 AGAGATGGCATCTAGGAGTCAGG + Intergenic
922336247 1:224620483-224620505 AGAGTTGGAATTTCTGATTGGGG + Intronic
922883073 1:228997188-228997210 AGAACTGGAAGTTAGGAGTCGGG + Intergenic
922996411 1:229965872-229965894 ATAGTTGGAAAGTAAGAGTCTGG - Intergenic
923082750 1:230674387-230674409 GAATTTGGAATTTAAAAGTCTGG + Intronic
923768987 1:236920824-236920846 AGAGTTGGAATTCAAGACCCAGG + Intergenic
924482895 1:244452434-244452456 AGAATTGGAAATTAAAAGTCCGG + Intergenic
924654802 1:245964164-245964186 AGAGCTGGTTGTTAAGAGTCTGG - Intronic
1064548543 10:16475461-16475483 CGAGTTGCAATGTAAGAATCTGG - Intronic
1068402302 10:56545975-56545997 AGAAGTGGAATTGGAGAGTCAGG - Intergenic
1069161259 10:65095115-65095137 AAAGTTGGAAACAAAGAGTCTGG + Intergenic
1070543968 10:77438300-77438322 AGTGTTGGAATTACAGATTCAGG - Intronic
1071114137 10:82197079-82197101 AGATCAGGAATCTAAGAGTCAGG + Intronic
1071856669 10:89632767-89632789 ACAGTAGGAATTTAGGAGGCAGG + Intronic
1072030581 10:91518155-91518177 ACAGTTGGGATTTATGAGTAGGG + Intergenic
1072417350 10:95260276-95260298 AGAGCTGGAATTCAAGGCTCAGG + Intronic
1072950574 10:99843526-99843548 AAAGCTGGAATTTGAGAGTCTGG - Intronic
1074124496 10:110517345-110517367 AGAGTCTGAATTTTAGAGCCAGG + Intergenic
1074487797 10:113904945-113904967 TGAGTTTGAACTGAAGAGTCTGG - Exonic
1074816510 10:117145626-117145648 AGAGTTAGAAATGAAGGGTCGGG + Intergenic
1074870654 10:117573410-117573432 AGAGTTGGATTTTAAGGGTCAGG + Intergenic
1074922260 10:118027273-118027295 AGAGTTCAGATTTAGGAGTCAGG - Intronic
1075325172 10:121525866-121525888 ATAGGTGTAATTTAAGAGCCTGG - Intronic
1075484561 10:122811760-122811782 AGAGATGGCCTTTAAGAGTAAGG - Intergenic
1079784016 11:24648201-24648223 ATAGTAGAAATTTAAGAGCCAGG - Intronic
1083964523 11:66035232-66035254 AGAGTTGGGATATAGGAGCCAGG + Intergenic
1084906637 11:72353453-72353475 ACATTAGGAAATTAAGAGTCGGG + Intronic
1086450705 11:86913659-86913681 AGAGTTGGAATTTAAGAGTCTGG - Intronic
1087400118 11:97654519-97654541 AGAGTTGGAAAGTTAGAGTTAGG + Intergenic
1087612444 11:100450967-100450989 AGAGCTGGGATTCAAGAGTAGGG - Intergenic
1089226371 11:116926085-116926107 AGAGGTGGGATTTGAGAGTTTGG - Intronic
1089807097 11:121100320-121100342 ACAGTTGGCATTTAAATGTCTGG + Intergenic
1090029039 11:123192406-123192428 GAAGCTGGAACTTAAGAGTCTGG - Intronic
1090492046 11:127173185-127173207 AGAGGTGAAATGTAAGAGGCAGG + Intergenic
1090996200 11:131868135-131868157 AGAATTAGAATTTTAAAGTCTGG + Intronic
1093925004 12:24901673-24901695 AGAGTGGAATTTTAAAAGTCTGG + Intronic
1094034300 12:26050386-26050408 ACAGTTTGAATTCAAGAGTTAGG - Intronic
1097776063 12:63647893-63647915 AGATTTGGAGTTAAAGAGGCTGG + Intronic
1100536393 12:95514093-95514115 ACAGTTAGCATTTAAAAGTCCGG - Exonic
1100709576 12:97241184-97241206 AGAGTGGAAATTTAAGACTATGG + Intergenic
1100800358 12:98224354-98224376 AGATTTCGAACTGAAGAGTCAGG + Intergenic
1104217710 12:126750403-126750425 AGAGTGGGAAATTAAGAAACAGG - Intergenic
1107570755 13:41655592-41655614 AGAGTTTGGATTTAAGACTCTGG + Intronic
1108472184 13:50778403-50778425 AGAGATGGAGATTGAGAGTCTGG - Intronic
1110760585 13:79226091-79226113 AGAGCTGCAATTAAACAGTCTGG + Intergenic
1110982634 13:81920367-81920389 AGATATGGAATATAAGATTCAGG + Intergenic
1112473258 13:99708505-99708527 AGAGCTGGAATTTCAGAACCTGG - Intronic
1112915081 13:104538330-104538352 AGGCTTTGAATTCAAGAGTCCGG - Intergenic
1113056318 13:106271945-106271967 AGAGATGTACTTCAAGAGTCAGG + Intergenic
1115117835 14:29904358-29904380 AGAGTTGGGATTTTAAATTCAGG - Intronic
1116641319 14:47467093-47467115 AGAGTAGTAATTTATGATTCTGG - Intronic
1117077547 14:52119304-52119326 AGAGTTGGAATTCTTGAATCAGG + Intergenic
1117195676 14:53337776-53337798 AGAAGTGGAATTTAAGTTTCAGG - Intergenic
1117874844 14:60241354-60241376 AGAGTGGGAATTTTGGAATCAGG + Intergenic
1118398252 14:65355784-65355806 AGAATTGGATTCTATGAGTCTGG - Intergenic
1122246126 14:100404740-100404762 ATACTTGGCATTTCAGAGTCAGG - Intronic
1122868286 14:104620372-104620394 AGAGTTTGAATTTCTGACTCAGG - Intergenic
1125433262 15:39619486-39619508 AGATTTGGAATTCAAAATTCAGG + Intronic
1125817600 15:42600123-42600145 AGAGGTGAAATATAGGAGTCTGG - Intronic
1127448805 15:59095842-59095864 AGATTTGGAATTTAAGTCACTGG + Exonic
1127558873 15:60115907-60115929 AGATTTGAAAGTTAAGTGTCTGG - Intergenic
1130760139 15:86810743-86810765 AAAGCTGAAATTTAAGAGTAAGG - Intronic
1131047442 15:89325348-89325370 AGAGTTTGGGTTCAAGAGTCTGG - Intronic
1135107022 16:19658698-19658720 AGAGGTGGCATTGAAGAGCCTGG + Intronic
1138314832 16:56060958-56060980 AGAGTTGCAATTTTAGACTTGGG + Intergenic
1139015091 16:62679973-62679995 AAAGTTTAAATTTAAGACTCAGG + Intergenic
1146621678 17:34403544-34403566 GGTGTTTGGATTTAAGAGTCTGG + Intergenic
1147454124 17:40524556-40524578 ACAGTTTGCATATAAGAGTCAGG - Intergenic
1147505814 17:41016405-41016427 AGAGTTGGGATTTTAAACTCAGG + Intronic
1148242489 17:46009759-46009781 AGAATTAGAATCTAGGAGTCTGG - Intronic
1149911506 17:60571125-60571147 AGAGTAGTAATTTAAAACTCTGG + Intronic
1149969158 17:61198809-61198831 ACATTTGGACTCTAAGAGTCAGG - Intronic
1150828928 17:68501163-68501185 AGAGTGAGAAATGAAGAGTCAGG - Intergenic
1153165863 18:2261618-2261640 AGAGGTGGAGTCTGAGAGTCAGG - Intergenic
1153266119 18:3271315-3271337 GGAGTTGGAATGTTAGAGTAAGG + Intronic
1154099292 18:11454977-11454999 ACAGTTAGAATTTAAGACTGGGG - Intergenic
1154936117 18:21059051-21059073 GGAGTTTGAATTTAGGAGTCTGG - Intronic
1155390694 18:25333538-25333560 AGAGATGGTATTTCAGAGACAGG - Intronic
1155488100 18:26369365-26369387 AGAGTTAGAAGTTAAGACTCAGG + Intronic
1155587291 18:27381342-27381364 AAAGTTGGAAATGAAGAGTAAGG + Intergenic
1155802696 18:30128900-30128922 ATATTTGGAATATAACAGTCAGG - Intergenic
1156049487 18:32915069-32915091 AGTTATGGAATTGAAGAGTCAGG + Intergenic
1157427836 18:47599423-47599445 AGACTTGGAAATTGAGACTCTGG - Intergenic
1157942704 18:51946465-51946487 AGAGCTGGAATTTAAGTCTGAGG + Intergenic
1158039560 18:53076450-53076472 AGAGGTGGAATTAAGGAGCCAGG - Intronic
1158731338 18:60026622-60026644 GGAGTTGAAGTTTAAGATTCAGG - Intergenic
1162908203 19:13835887-13835909 GGAGTTGGCATTTAACGGTCTGG + Intergenic
1168200726 19:54813547-54813569 AGAGATGGAATGTCTGAGTCTGG + Intronic
928095301 2:28401057-28401079 AGAAATGGAATTTAAAAGTTGGG + Intronic
929144465 2:38694561-38694583 AGAGCATGAATTTAAGTGTCTGG + Intronic
929755697 2:44762368-44762390 AGAATTGGTATTTAATAGTTTGG + Intronic
929803130 2:45121406-45121428 AGAGTTGGTATTTGCCAGTCTGG + Intergenic
929910914 2:46088934-46088956 AGAGTTGGACTTGAAAAGGCAGG - Intronic
930218464 2:48721436-48721458 AGAGTTGCAAGTAAAGAGTATGG + Intronic
931009151 2:57887923-57887945 AGTGTTGGAATTTAGTAATCAGG + Intergenic
931343619 2:61426314-61426336 AGAAATGCCATTTAAGAGTCAGG - Intronic
931625274 2:64251547-64251569 AGAGTTGGAACTTCAGAGTTGGG + Intergenic
931702322 2:64918996-64919018 AGAGTTATGAATTAAGAGTCTGG - Intergenic
932607874 2:73176544-73176566 AGAGTTGGAATTTGCGGGGCGGG - Intergenic
933323008 2:80800740-80800762 AGAGTTGGCATCTAAGAGAGAGG + Intergenic
935662484 2:105479138-105479160 AGAGATGGAGTTTAAGACTTAGG + Intergenic
937811933 2:126209203-126209225 AGAGTTTTTATTTAAGTGTCTGG + Intergenic
938008156 2:127805762-127805784 ACAGGTGGAATTTAAAAATCTGG + Intronic
938181580 2:129189540-129189562 AGAGTGAGCATTTAAGAGACAGG + Intergenic
939246995 2:139637830-139637852 AAAGCTGTAATTTAAAAGTCAGG - Intergenic
939631635 2:144533139-144533161 AGAGTTGGAGTTTAGAAGACTGG - Intergenic
940616703 2:156057733-156057755 AGAGTGGGAGTTTTAGAATCAGG + Intergenic
941849915 2:170169819-170169841 AGAGTGCTATTTTAAGAGTCTGG + Intergenic
942585318 2:177468941-177468963 AGAAGTGGAATTTAAAATTCTGG + Intronic
943033106 2:182709128-182709150 AGATTTGGAATTTTAGAACCAGG - Intergenic
945822527 2:214682170-214682192 AGAATTTGAATCTAACAGTCTGG + Intergenic
945911325 2:215652732-215652754 TGACTTGGAATTTAAGACTTAGG - Intergenic
947121677 2:226822195-226822217 AGAGTGGGACTAGAAGAGTCAGG - Intergenic
1169077672 20:2771415-2771437 AGATTTGGAACTTAAGAAACTGG + Intergenic
1169583999 20:7059510-7059532 GAAGTTTGAATTTAAGAGTGAGG - Intergenic
1169762210 20:9108177-9108199 TTAGTTGGATATTAAGAGTCTGG + Intronic
1172841401 20:37904478-37904500 AGAGTTGGACTGTATGAGCCCGG + Intronic
1174100109 20:48120925-48120947 GGAGTTGGAGTTTGAGGGTCAGG - Intergenic
1175168173 20:57061137-57061159 AGAATTGGAATTAAAGAGCAGGG + Intergenic
1175624174 20:60476712-60476734 AGAGATGGAATCCGAGAGTCTGG + Intergenic
1177211033 21:18071098-18071120 AGAGTAGGATTTTGAGGGTCTGG - Intronic
1179063846 21:38005473-38005495 AGAGGTGGAATTGAGGGGTCAGG - Intronic
951105484 3:18737109-18737131 TGAGTTTGAGTTTAAGAGTTTGG + Intergenic
951921456 3:27859293-27859315 AAATTTGGAATTTGAGAGTTTGG - Intergenic
952726317 3:36589471-36589493 AGAGTTAGAATTGATGAGTAAGG + Intergenic
952778025 3:37065290-37065312 AGGTTTAGACTTTAAGAGTCTGG + Intronic
953060757 3:39427122-39427144 GGAGTTGGATTTTGAGGGTCAGG + Intergenic
953805119 3:46061908-46061930 AAAGCTGGATTTGAAGAGTCTGG + Intergenic
956230993 3:67016512-67016534 AGCGATGGAACTTAGGAGTCTGG + Intergenic
956262837 3:67363966-67363988 AGAGTTGGAACTGAAGAAACTGG + Intronic
956499322 3:69864920-69864942 AAAGTTAAAATTTAAGGGTCAGG - Intronic
956949552 3:74265849-74265871 AGACCTGGGATTTAAGAGTGAGG + Intronic
957368212 3:79254680-79254702 AGAGCTGGTATTTCAGATTCAGG - Intronic
958821644 3:98980847-98980869 AAAGTTTGCATTTTAGAGTCAGG - Intergenic
958906958 3:99952433-99952455 AGAGTTGGAATTTTTGGGGCTGG - Intronic
960196945 3:114780352-114780374 AAAGTTGGAAGTGAAGAGTGAGG + Intronic
960252687 3:115473775-115473797 AGAGTTTGAATTTATGAAGCTGG + Intergenic
960395784 3:117135387-117135409 AGAGGTGGAGTTTGAGACTCTGG + Intronic
960677813 3:120214081-120214103 AGAGTTTAAATTCATGAGTCTGG + Intronic
960743786 3:120863773-120863795 AGAGTTCTAATTTAAAAGTTGGG + Intergenic
965289185 3:166855240-166855262 TGAGTTGGAATATAAGATTAAGG - Intergenic
968805565 4:2769568-2769590 AGAGTTGGAAGATAAGATTGAGG + Intergenic
970424624 4:15934771-15934793 AAAGTTGTATTTTAAGAGTGGGG - Intergenic
970671686 4:18403899-18403921 AAATCTGGAATTTTAGAGTCTGG - Intergenic
970691594 4:18626638-18626660 AGATTTGGAAGTTAAGTATCTGG - Intergenic
971725860 4:30311232-30311254 AGAGTATGCTTTTAAGAGTCTGG - Intergenic
972854633 4:43091840-43091862 AGAGTAGGGATTTTGGAGTCAGG - Intergenic
973058384 4:45688783-45688805 AGAGTGGGAATACAAGAGGCAGG + Intergenic
973994064 4:56438946-56438968 GGAATTGAAATTTAAGAGTCTGG - Intronic
979859863 4:125680698-125680720 AGAGTTTGAATTCTAGAGTAAGG + Intergenic
980205323 4:129712086-129712108 ACAGTTGCAAATTAAAAGTCTGG - Intergenic
982235768 4:153249685-153249707 AGGGCTGGGATTTAAGAGTTCGG - Intronic
982885440 4:160774419-160774441 AGAGTTGGTATTTGGGAATCAGG + Intergenic
983395179 4:167185064-167185086 ATGGTTGGAAATCAAGAGTCTGG + Intronic
983789471 4:171777988-171778010 AAATCTGGAATTTAAGAATCTGG - Intergenic
983944572 4:173570925-173570947 AGTGTTTGAATTTAAGATTTTGG - Intergenic
985335560 4:188889701-188889723 AGAGTTCAAATTTAAAAGTCAGG - Intergenic
987942153 5:24553477-24553499 AGAGATGGAAAGTAGGAGTCAGG - Intronic
989436987 5:41425713-41425735 ATAGTTGGAATTAAAAAGTATGG + Intronic
990729593 5:58793945-58793967 AGAATTGGAATTTAATTGTTAGG + Intronic
990943552 5:61227947-61227969 AGAGGTGGCATTTAAGAGGAAGG - Intergenic
993106695 5:83608183-83608205 AGTGTTACAATTTAAGAGCCAGG - Intergenic
995488950 5:112669696-112669718 AGTCTTGGAATTGAAGAGACAGG + Intergenic
996765063 5:127027916-127027938 AGGGTTTCAATTTAGGAGTCTGG - Intronic
996918354 5:128737008-128737030 AGAGCTTGAAGTTAAGAGTAAGG + Intronic
996960632 5:129244556-129244578 AGAGTTGGAAATTTAGAATCAGG + Intergenic
997046600 5:130326548-130326570 AAAGTTGGAAGTTAGGATTCAGG + Intergenic
998391853 5:141792327-141792349 AGAGTTGGATTTTAAAAGGAAGG - Intergenic
998491887 5:142554248-142554270 AGATTTAGAATTTCAGAGTCGGG + Intergenic
1001476166 5:172052451-172052473 AGTGATGGAGTTCAAGAGTCTGG - Intronic
1004074968 6:12336767-12336789 AGAGTTGTCATTTGAGTGTCTGG - Intergenic
1006589930 6:35147263-35147285 AGAGTGGGAATAAAAGAGTCAGG - Intronic
1009562014 6:65258230-65258252 ATTGTTGGAATTTAAAAGTGGGG + Intronic
1010130562 6:72487940-72487962 AGGGTTGGAATTTAAAAGTTTGG + Intergenic
1011727445 6:90224929-90224951 TGAGTTAGAATTTAAAAGGCTGG + Intronic
1012205822 6:96459109-96459131 AGAGAGGGATTTTAAGACTCTGG + Intergenic
1012618154 6:101303265-101303287 AGAGTTGTGACTTAAGGGTCAGG + Intergenic
1013275149 6:108577804-108577826 AAAGTTGGGATTAAAGAGTAAGG + Intronic
1014580890 6:123136225-123136247 AGAGTTCAAAGTTAAAAGTCTGG + Intergenic
1015156055 6:130097632-130097654 AGAGTTGGAATTAAGCAATCTGG - Intronic
1015388828 6:132657130-132657152 ATAGTTAGAATTTAAGTTTCAGG - Intergenic
1022362009 7:29669937-29669959 AGACTTGGAGTTAAAGAGGCTGG + Intergenic
1022699385 7:32743800-32743822 AGATTTGGAGTTAAAGAGGCTGG - Intergenic
1022934965 7:35165491-35165513 AGATTTGGAGTTAAAGAGGCTGG + Intergenic
1023535234 7:41201772-41201794 AGAGTTGGAAATTAAGAGGAGGG + Intergenic
1027254471 7:76422287-76422309 AGAGTAGCAATTTAGGAGGCCGG - Intronic
1028433762 7:90778122-90778144 AGCATTGGTATTTATGAGTCTGG - Intronic
1029283680 7:99452273-99452295 AGGGCTGGAATTTAAGAGCATGG + Intronic
1029830913 7:103258255-103258277 AGATTTGGAGTTAAAGAGGCTGG + Intergenic
1030923978 7:115428366-115428388 AGAGTATGAATATAAGAGTGTGG + Intergenic
1032568089 7:132969257-132969279 AGAGTCTGAAGTTAAGTGTCAGG - Intronic
1032826619 7:135576015-135576037 AGAGTTAGAAATTGAGAGTTTGG + Intronic
1036382826 8:8249429-8249451 AGAGTGGGAATTTGAAAGTGGGG + Intergenic
1037019095 8:13945961-13945983 AGGGATAGAATATAAGAGTCTGG - Intergenic
1039033826 8:33337473-33337495 AGAGTTGGAGCTGAAGAGGCAGG + Intergenic
1039842495 8:41304024-41304046 AGAGCTGGAGTTTGTGAGTCTGG - Intronic
1040544173 8:48384263-48384285 AGAAGTGGAAGTTAAGAGTGTGG - Intergenic
1040603670 8:48909519-48909541 AGAGTGGGAAGTTAGGAGCCAGG - Intergenic
1041042125 8:53857719-53857741 AGATTTGGATTTTTAGATTCGGG + Intronic
1042176210 8:66039290-66039312 AGAGGAGGAATTTAAGATTGAGG - Intronic
1043204820 8:77424941-77424963 AAAGTTGGAATATAAGACTAAGG - Intergenic
1044324046 8:90840199-90840221 AGAATTCAAATTTAACAGTCAGG + Intronic
1045567633 8:103337840-103337862 AGAGGTGGCAGTTAAGAGGCTGG - Intergenic
1047448553 8:124941907-124941929 ACAGTTGGCAGTTAACAGTCGGG - Intergenic
1050038061 9:1458753-1458775 TGGGTTGGAATTTAAGATTAAGG + Intergenic
1050362277 9:4841554-4841576 AGAGCTGGAAGCTAAGGGTCTGG + Intronic
1051058119 9:13012117-13012139 AGAGTGGGTTGTTAAGAGTCTGG - Intergenic
1051551327 9:18332864-18332886 AGAGTTGGGATTTTAAATTCAGG - Intergenic
1052394789 9:27925942-27925964 ACAGTTGTGATTTAAGAGGCAGG + Intergenic
1052633089 9:31065886-31065908 GGAGTTGGAATTTAAGACTGGGG - Intergenic
1054888600 9:70227470-70227492 AATGGAGGAATTTAAGAGTCTGG + Intergenic
1055281703 9:74681623-74681645 AAAACTGGGATTTAAGAGTCTGG - Intronic
1055513055 9:77014079-77014101 AGAGTGGAGATTTAAAAGTCAGG + Intergenic
1057067490 9:92069091-92069113 AGAGTTGGATTTTGAGACCCAGG + Intronic
1058125714 9:101192239-101192261 AGAGTTGCAATCTAAGTCTCAGG - Intronic
1060291232 9:122304836-122304858 AGGCCTGGAATTTAGGAGTCAGG + Intronic
1061220607 9:129248352-129248374 TGAGTTGGACTTGAAGGGTCTGG - Intergenic
1061615326 9:131775323-131775345 AGAGTTTAAATTAAAGAGCCTGG - Intergenic
1061771253 9:132924310-132924332 AGAATAGGAATCTATGAGTCTGG + Intronic
1185654323 X:1671797-1671819 AGATTTTGAAATTAAGAGGCAGG + Intergenic
1186055075 X:5641717-5641739 AGATTTGGAATCTGTGAGTCTGG - Intergenic
1186149517 X:6659500-6659522 AGACTCTGAATTTCAGAGTCAGG + Intergenic
1189060283 X:37746455-37746477 AGAGTGGGAGGTTAAGAGTAAGG - Intronic
1189255931 X:39639109-39639131 AGAGTTGCCATTCAAGAGTGAGG - Intergenic
1190183667 X:48216824-48216846 AGAGTTGGAAGATAAGAGTTGGG - Intronic
1190413341 X:50158283-50158305 ATAGCTGAAATTTGAGAGTCTGG - Intergenic
1192484668 X:71514716-71514738 AGAGTCAGGAATTAAGAGTCGGG + Intronic
1194006618 X:88502455-88502477 AGAGATTGAATTTAAGAATATGG + Intergenic
1195030062 X:100918274-100918296 AGTGTTGGAATCTCAGAGACTGG + Intronic
1196170166 X:112578851-112578873 AGAGTGGGAATGAAAGAGTTTGG + Intergenic
1197619429 X:128731268-128731290 AGAGTTAAAATTTAAGTGTGTGG - Intergenic
1197665547 X:129219495-129219517 GGAGTTGCAATTGAAGAGTCTGG + Intergenic
1198579468 X:138048081-138048103 AGAGTTGGAACTGAAAAGTAGGG + Intergenic
1198845221 X:140902953-140902975 AGAGTTGGAATAAAAGTTTCTGG + Intergenic
1199237582 X:145508928-145508950 AGGGTTATAATTCAAGAGTCAGG - Intergenic
1199974278 X:152883657-152883679 AATCTTGGAAGTTAAGAGTCCGG + Intergenic
1200946065 Y:8839462-8839484 AGAGTTGGAGATTAAGAGACTGG + Intergenic