ID: 1086451027

View in Genome Browser
Species Human (GRCh38)
Location 11:86916938-86916960
Sequence CATGAACTGAGCCTCGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086451027_1086451030 12 Left 1086451027 11:86916938-86916960 CCAGCACCGAGGCTCAGTTCATG 0: 1
1: 0
2: 1
3: 4
4: 93
Right 1086451030 11:86916973-86916995 AATGACAAAGTTGTTTTAAGTGG 0: 1
1: 0
2: 0
3: 31
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086451027 Original CRISPR CATGAACTGAGCCTCGGTGC TGG (reversed) Intronic
900484561 1:2915307-2915329 CAGGAACTGTGCCAGGGTGCCGG + Intergenic
902870308 1:19310281-19310303 CATGAACTGTGCCTCAGGCCTGG + Intronic
904453611 1:30632908-30632930 CATGAGCTGAGGCTCAGTTCAGG - Intergenic
905792605 1:40798212-40798234 CTTGGACTGAGCCTGGGTTCTGG - Intronic
906244287 1:44262276-44262298 CTTGAACTGGGCCTCTGTGAAGG - Intronic
908018091 1:59867987-59868009 CATGTACTGAGCCTTGGAGAAGG + Intronic
908651275 1:66336117-66336139 CAGGAACTGAGCCACAGTGAAGG - Intronic
908808011 1:67950559-67950581 GATGATCTGAGCCCCGGTACTGG - Intergenic
910666116 1:89727587-89727609 CCTGAACTGAGTCTTGATGCAGG + Intronic
911057987 1:93724020-93724042 AATGAACTGATCCTCTGTCCAGG + Intronic
915585349 1:156841165-156841187 CACCAACTGACCCTCAGTGCAGG - Intronic
920989333 1:210921784-210921806 CATGAAAAGAGCCTGGGTCCCGG + Intronic
924739250 1:246785425-246785447 CATGAACAGATGCTCAGTGCAGG + Intergenic
1064061001 10:12137125-12137147 CATCACCTGAGCCTAGGAGCTGG - Intronic
1067137253 10:43621508-43621530 CATGAACAAAGCCTGGGTACTGG + Intergenic
1069553725 10:69382834-69382856 CAGGAACTGAGCCGCAGTGGGGG + Intronic
1069774523 10:70918854-70918876 CAGGAACGGAGCCTGGGTGACGG + Intergenic
1069774530 10:70918885-70918907 CAGGAACGGAGCCTGGGTGACGG + Intergenic
1069994549 10:72334565-72334587 CATGCACTGAGCCAAGGTGATGG - Exonic
1070600637 10:77864120-77864142 CATTTGCTGAGCCTCGGTGGTGG - Intronic
1073820019 10:107251322-107251344 CATGACCTGAGCCTTGGTAACGG + Intergenic
1074085033 10:110203532-110203554 CCTGGTCAGAGCCTCGGTGCCGG - Intergenic
1075167083 10:120078588-120078610 CACGAACTCAGCCTCAGAGCTGG - Intergenic
1076617424 10:131765158-131765180 CAGGAACTGAACCTCCTTGCTGG - Intergenic
1077048720 11:557199-557221 CATGAACTGAGCCTGGGTACTGG - Intronic
1077296739 11:1829920-1829942 CATGACCTGAGCCTCCGGGGAGG - Intronic
1077296755 11:1829980-1830002 CATGACCTGAGCCTCTGGGGAGG - Intronic
1077296773 11:1830043-1830065 CATGACCTGAGCCTCTGGGGAGG - Intronic
1078148689 11:8740636-8740658 CATGAAGTGAGCCTGTCTGCAGG + Intronic
1081771236 11:45651656-45651678 CAGGAACAGACCCTGGGTGCTGG - Intronic
1083314175 11:61804065-61804087 CATGGACTGAGCCATGGTCCTGG - Intronic
1084689773 11:70718363-70718385 AAGGAACTGCGCCTCGGTGGAGG + Intronic
1086088243 11:82978624-82978646 CATGAACTGAAACTTGGTGTGGG + Exonic
1086451027 11:86916938-86916960 CATGAACTGAGCCTCGGTGCTGG - Intronic
1089846605 11:121463745-121463767 CATGAACTGGGCCTCTCTTCCGG + Intronic
1090464426 11:126921268-126921290 CATGGACTGAGCCACATTGCCGG + Intronic
1103624354 12:122206871-122206893 CATGAAATGGGCCTGGGGGCAGG - Exonic
1113546277 13:111153651-111153673 CAGGAAGTGAGCCCCGGCGCCGG - Intronic
1115807314 14:37065469-37065491 CATGAACTGAGCTTTGATGTTGG - Intronic
1121530529 14:94649636-94649658 CATGACCTGGGCCTCTGTGAGGG + Intergenic
1121754972 14:96394570-96394592 CATGACCTGGCCCTCTGTGCTGG - Intronic
1125315722 15:38429113-38429135 CAGGAACTGAACATCGGTTCTGG - Intergenic
1127667412 15:61162289-61162311 CATGATCTGGTCCTCGGTCCTGG + Intronic
1131623185 15:94089230-94089252 CCTCAGCTGAGCCTTGGTGCTGG + Intergenic
1133995588 16:10745510-10745532 ACTGAACTGAGCCTCAGTGGAGG + Intronic
1136296789 16:29308550-29308572 CATTAAATGAGCCTCAGTGCTGG + Intergenic
1136682377 16:31975876-31975898 CATGAACTCAGCCGCTGTCCTGG + Intergenic
1136782635 16:32917044-32917066 CATGAACTCAGCCGCTGTCCTGG + Intergenic
1136887159 16:33936806-33936828 CATGAACTCAGCCGCTGTCCTGG - Intergenic
1142058409 16:88014868-88014890 CATTAAATGAGCCTCAGTGCTGG + Intronic
1203085293 16_KI270728v1_random:1181032-1181054 CATGAACTCAGCCGCTGTCCTGG + Intergenic
1143353517 17:6307261-6307283 CTTGGACTGAGCCTCGCTACTGG + Intergenic
1147142897 17:38469214-38469236 CATGAACTCAGCCCCTGTCCTGG + Exonic
1152407530 17:80106244-80106266 CACGCACTGACCCTCCGTGCCGG + Intergenic
1154979310 18:21489352-21489374 CATAAACTGTTCCTTGGTGCTGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160734833 19:657772-657794 CGTGACCAGAGCCTCGGTTCCGG - Intronic
1161030113 19:2054109-2054131 CATGGGCTGAGCCTTGGTTCAGG - Intergenic
1162774914 19:12973630-12973652 CATGAACTGAGCATCGTGGATGG + Exonic
1164426364 19:28145491-28145513 CATGACCCGAGCCTCTGTCCAGG - Intergenic
1164531611 19:29052646-29052668 CATCAACAGAGCCTCCTTGCAGG - Intergenic
1166253344 19:41586005-41586027 CATGAGCTGGGCCTCTGTTCAGG + Intronic
1168328970 19:55555051-55555073 CCTGAGCTGAGGCTGGGTGCTGG + Intergenic
929048362 2:37813071-37813093 CATGTCCTGTGCCTCAGTGCTGG - Intergenic
934300448 2:91773326-91773348 CATGAGCTGAGCCCCCGTTCAGG - Intergenic
937182703 2:120010912-120010934 CATAAACTGAGGCTGGGTGATGG - Intergenic
940857108 2:158738101-158738123 AATGAACTCAGCCTCTGTGTGGG + Intergenic
1172487370 20:35306475-35306497 CATGAACTGGGCCAGGGAGCGGG - Intronic
1172862291 20:38064106-38064128 CATGGACTGAGCCACTGAGCAGG + Intronic
1173946333 20:46953744-46953766 CATGATCTTAGCATCTGTGCTGG - Intronic
1179510776 21:41871800-41871822 CACGTCCTGAGCCTGGGTGCTGG - Intronic
1179604374 21:42503989-42504011 CCTGAACTGAGACTCTGTTCTGG - Intronic
1182418179 22:30234898-30234920 CATGAACTTAGCCTTGAAGCTGG + Intergenic
1185207943 22:49550956-49550978 GCTGAACTCAGCCTCGGTGTTGG - Intronic
960526290 3:118714899-118714921 CATGGACTGAGCCACACTGCTGG - Intergenic
961452784 3:127009871-127009893 CATGAGCTCAGCTTCGGTGGGGG - Intronic
966828676 3:183987465-183987487 CATGAACTGACAGTCGGTGCAGG - Intronic
968459455 4:717083-717105 TGAGAACTGAGCGTCGGTGCTGG + Intronic
968459460 4:717126-717148 TGAGAACTGAGCGTCGGTGCTGG + Intronic
968459472 4:717212-717234 TGAGAACTGAGCGTCGGTGCTGG + Intronic
968459477 4:717255-717277 TGAGAACTGAGCGTCGGTGCTGG + Intronic
969629315 4:8326375-8326397 CCTGAACTGAGCTTCTCTGCAGG + Intergenic
976082246 4:81368486-81368508 CATGAACAGGGCCTAGGTACTGG - Intergenic
982169265 4:152645293-152645315 CATGAATTGAACCCCAGTGCTGG - Intronic
985808443 5:2065799-2065821 CTGGAACTGAGCCTGGGTGTGGG - Intergenic
991174041 5:63665161-63665183 CATGAACTGTGTATAGGTGCAGG - Intergenic
1002053367 5:176584507-176584529 CATGATCCGAGGCTTGGTGCTGG + Exonic
1013734037 6:113205084-113205106 CATGAGCTGACCCTGGATGCAGG - Intergenic
1019713094 7:2526237-2526259 CATGAAGTGACCCCCGCTGCGGG - Exonic
1023661094 7:42471643-42471665 CTTGGACTGAGCCATGGTGCTGG + Intergenic
1027682059 7:81233507-81233529 CAATAGCTGAGCCTGGGTGCTGG - Intergenic
1029089208 7:98035079-98035101 CTTGGACTGAGCCACGCTGCTGG - Intergenic
1029870031 7:103680844-103680866 AAAGGACTGAGCCTTGGTGCTGG + Intronic
1041831895 8:62163792-62163814 CTTGAACTGAGCCACGCTACTGG - Intergenic
1047445577 8:124916172-124916194 TTTGAACTGAGCATGGGTGCTGG - Intergenic
1053481586 9:38420299-38420321 CATGAACTGAGGCTCAGAGGTGG - Intronic
1055837023 9:80455704-80455726 AATGAACTGAGCCTCAGAGAAGG + Intergenic
1186747347 X:12583579-12583601 CACCAGCTGAGCCTCAGTGCTGG + Intronic
1192225144 X:69222545-69222567 CATGGACTGAGCCTCAGGGCAGG - Intergenic