ID: 1086451146

View in Genome Browser
Species Human (GRCh38)
Location 11:86918216-86918238
Sequence GTAAATGCAGAGATGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 316}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086451146 Original CRISPR GTAAATGCAGAGATGAAGCT TGG Intronic
901948416 1:12722034-12722056 GAAAACGAAGAGATGAAGCCGGG + Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
902656794 1:17874625-17874647 GTAACTGAAGAGATGACGCAAGG + Intergenic
903310887 1:22454556-22454578 GGAAAGGGAGAGACGAAGCTGGG + Intronic
905002009 1:34679957-34679979 CAAAGTGCAGAGTTGAAGCTTGG - Intergenic
905921907 1:41725237-41725259 GGACATGCAGACATGCAGCTGGG + Intronic
906465001 1:46070549-46070571 GGAAATGCAGAAGTTAAGCTGGG + Intronic
908393266 1:63702740-63702762 GTAAATGCAGAGGCCAGGCTGGG + Intergenic
908971209 1:69833880-69833902 GTAAATGCAAGGAGGAAGATAGG + Intronic
909143474 1:71896910-71896932 ATAAATGAAAAAATGAAGCTTGG + Intronic
909626186 1:77718718-77718740 GAAAATGCAGAGATCCAGCCTGG + Intronic
911715060 1:101123521-101123543 GGAGATGCTGAGATGACGCTGGG - Intergenic
912549436 1:110475504-110475526 GAAGCTGCAGAGATGAGGCTGGG + Intergenic
912571405 1:110626733-110626755 GTAAGGGCTGAGATAAAGCTGGG - Intronic
917619125 1:176777551-176777573 GTAAATGAGGAGATAAATCTTGG - Intronic
917832066 1:178901876-178901898 TTTGATGCAGAGTTGAAGCTGGG + Intronic
919935791 1:202249842-202249864 GTAAGTCCAGAGTAGAAGCTGGG - Intronic
919974470 1:202601867-202601889 GTAAGAGCAGAGATGAGGCCAGG - Intronic
920979722 1:210821995-210822017 ATAAATGAAGAGATAGAGCTGGG - Intronic
923192609 1:231634347-231634369 GTAAATACAGAGATAAAACGGGG + Intronic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
1063042384 10:2356553-2356575 GGAACTGAAGAGATGAAACTGGG - Intergenic
1065695553 10:28376558-28376580 TTAAATGCAGGGATGGAGGTGGG - Intergenic
1066025551 10:31355769-31355791 GTAAATGTAGAGAAGAATGTAGG + Intronic
1066484346 10:35828802-35828824 GCAAAAGCTGAAATGAAGCTGGG + Intergenic
1066968395 10:42292529-42292551 GTAAATGGAGAGAGGAAGGGTGG - Intergenic
1067572133 10:47379459-47379481 GAAAATGAGGAGATGAAACTAGG + Intronic
1068071223 10:52198772-52198794 GTAAAGACAGAGATAAAGATTGG - Intronic
1068765440 10:60758173-60758195 GAAAATACAAAGATAAAGCTAGG + Intergenic
1069077984 10:64058401-64058423 GTAAAGGCAGAAATGAAATTAGG + Intergenic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1070994500 10:80764325-80764347 ATAAATGAAGATTTGAAGCTGGG - Intergenic
1071604925 10:86979423-86979445 ATAAATGCAGAAATATAGCTGGG + Intronic
1073455817 10:103636111-103636133 GAAAGAGTAGAGATGAAGCTGGG + Intronic
1074445102 10:113515079-113515101 GTACCTGCTGAGGTGAAGCTGGG + Intergenic
1076896486 10:133315325-133315347 TTCCAGGCAGAGATGAAGCTAGG - Intronic
1077099465 11:815703-815725 GTAAAAGCAGAGATTAGGGTGGG + Intergenic
1078286002 11:9956759-9956781 GGAAATGTAGAGATAAAGGTGGG + Intronic
1078664229 11:13311200-13311222 GGAAATGCAGGGCTGAAGCCTGG + Intronic
1079384446 11:19966465-19966487 GGAAATGAAGAAATGAGGCTAGG - Intronic
1079480765 11:20877278-20877300 GTAAATGAAGAGATTTATCTTGG - Intronic
1079810301 11:24990539-24990561 GTAAATGCAGAGATGAAGACTGG + Intronic
1081298199 11:41418097-41418119 GTTATGGCAGACATGAAGCTGGG - Intronic
1082224672 11:49690834-49690856 GTCAATCCATAGATGAAGCTTGG + Intergenic
1082232928 11:49791272-49791294 GCAAATCCAGAGATGTAGATGGG + Intergenic
1086451146 11:86918216-86918238 GTAAATGCAGAGATGAAGCTTGG + Intronic
1086624378 11:88928413-88928435 GTCAATCCATAGATGAAACTTGG - Intronic
1087020667 11:93599667-93599689 GCAAATGCTGAGATGAACTTAGG + Intergenic
1087913611 11:103781948-103781970 GTAAAAGAAGGTATGAAGCTAGG + Intergenic
1089050824 11:115544301-115544323 GTTAATGAAGAGATGGGGCTGGG - Intergenic
1089794551 11:120969760-120969782 GGAAATGGAGAGGTGAACCTGGG + Intronic
1090333804 11:125949961-125949983 GTGAATGAAGGAATGAAGCTGGG + Intergenic
1091214794 11:133894148-133894170 GCAAAAGCAGTGATGAATCTAGG + Intergenic
1091812398 12:3410367-3410389 GGAATTGCAGAGAGGAAGCTGGG - Intronic
1093242284 12:16691959-16691981 GGAAAGGAAGAGATGAACCTCGG + Intergenic
1096074470 12:48794064-48794086 ATAAATGAATAGATGAGGCTGGG + Intergenic
1096381798 12:51164677-51164699 ATAAAATCAGAAATGAAGCTGGG + Intronic
1097852477 12:64426493-64426515 GTACACACAGATATGAAGCTGGG + Intronic
1098821746 12:75239794-75239816 TTAAATGCAGAGATGAAGATAGG - Intergenic
1101140507 12:101790859-101790881 GGAAAAGCAGAGGTGAGGCTGGG - Intronic
1101319323 12:103659331-103659353 CCAAATGCAGAGAGGAGGCTGGG + Intronic
1101698478 12:107149456-107149478 GTAAATGCTGAGATGGAGAAGGG - Intergenic
1101985432 12:109442361-109442383 TTAAATGCAGGGGTGCAGCTGGG + Intronic
1102005540 12:109587143-109587165 AGGAATGGAGAGATGAAGCTTGG + Intronic
1102082146 12:110107094-110107116 GTAGGTGCAGAGATGGATCTTGG + Intergenic
1103038427 12:117675142-117675164 GTAAATGCAGAATTCCAGCTGGG - Intronic
1106332751 13:28754520-28754542 CTAAGGGCAAAGATGAAGCTGGG + Intergenic
1107966194 13:45600313-45600335 GGAAGTGCACAGATGAATCTGGG - Intronic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109446729 13:62448899-62448921 GTAAATTCAGTGATTAAGGTAGG - Intergenic
1110759340 13:79213803-79213825 GGAAAGGCTGAGATGAAGCTCGG - Intergenic
1111532238 13:89552944-89552966 CTAAATGCACAGATGCAACTTGG - Intergenic
1113980696 13:114272541-114272563 CTAAATGTAGAGATGCAGTTTGG - Intronic
1116025349 14:39507850-39507872 GTAAATTCAGAGCTTAATCTTGG - Intergenic
1117040420 14:51764091-51764113 CAAAATGCAGACATGATGCTGGG - Intergenic
1117416469 14:55501042-55501064 GTAGATGCTGAGATGGAGTTAGG + Intergenic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1118939037 14:70315703-70315725 GGAAAGGGAGAAATGAAGCTTGG + Intergenic
1120183206 14:81366655-81366677 GTAAATACAGAGATGCAGTGGGG - Intronic
1120249884 14:82050312-82050334 TTAAATGCAGAGTGGAAGATGGG + Intergenic
1121181931 14:91935506-91935528 GAAAATGCAGAGATAGAGGTGGG - Intronic
1121333874 14:93064886-93064908 GTAAATCCAGAGTTGTAACTTGG - Intronic
1122262430 14:100531035-100531057 ATAGATGCAGAGATGAACCTGGG - Intergenic
1123984306 15:25631191-25631213 GCCGATGCTGAGATGAAGCTGGG - Intergenic
1124637018 15:31371842-31371864 ATCAAGGCAGAGATGAAGGTGGG - Intronic
1126454031 15:48841750-48841772 GCAGATGCTAAGATGAAGCTTGG - Intronic
1127240983 15:57113975-57113997 GTAAATTTAGAGATGAAACCTGG + Intronic
1127825217 15:62696907-62696929 GGAAATGTGGAAATGAAGCTAGG - Intronic
1130848208 15:87767335-87767357 GTGAATTAAGAAATGAAGCTTGG - Intergenic
1131835759 15:96389000-96389022 GTAAATGGAGAGCTCCAGCTTGG + Intergenic
1132142209 15:99405426-99405448 GGAAATGCAAAGATGAGCCTAGG + Intergenic
1133868456 16:9665965-9665987 GGATATGCAGAGCTGAAGCTTGG - Intergenic
1137377693 16:47967643-47967665 GTAGATGCAAGGATGAAGCAAGG - Intergenic
1137380903 16:47998768-47998790 GTAAGAGCAGAGATGCAGCCAGG - Intergenic
1137649909 16:50110864-50110886 GAAAATGCTAAGATGACGCTTGG + Intergenic
1138761597 16:59550425-59550447 GGAAATGCACAGATGAGCCTAGG + Intergenic
1139431002 16:66911045-66911067 GGAGAGGCAGATATGAAGCTGGG - Intronic
1139542690 16:67630342-67630364 TTAAATGGAGAGATTAAGGTAGG - Intronic
1139743450 16:69055283-69055305 GGAAAAGCAGAGATAGAGCTGGG + Intronic
1140901776 16:79374404-79374426 ACAAAAGCAGAGATGAAGCTTGG - Intergenic
1141005742 16:80349957-80349979 GGACATGCAGAGATGAAGAAAGG - Intergenic
1141142215 16:81503979-81504001 ATAAATGGAGAGGTGAGGCTTGG + Intronic
1141472504 16:84248744-84248766 GGAAAGGCAGAGATCAAGGTTGG + Intergenic
1141778127 16:86138077-86138099 GTCTATGCAGAGATGCACCTAGG + Intergenic
1142489200 17:266964-266986 GTGAGGCCAGAGATGAAGCTTGG - Intronic
1143251099 17:5523678-5523700 GGCAATGCAGGGATGGAGCTGGG - Intronic
1143595289 17:7910362-7910384 GGAAATACAGAGATGGAGCCAGG - Intronic
1144362735 17:14510543-14510565 GGAAATGCTGAGATGAAACCAGG - Intergenic
1145302440 17:21650062-21650084 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1145347879 17:22053246-22053268 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1145415715 17:22712136-22712158 GAAAAGGCAGAGTTGAAGCTGGG - Intergenic
1146041531 17:29459202-29459224 ACAAGTTCAGAGATGAAGCTGGG + Intronic
1146287365 17:31582873-31582895 GAAAATGAAGAGATGAGGCCAGG + Intergenic
1149083798 17:52689908-52689930 GTAAATGAAGAGATGAGATTAGG + Intergenic
1150293816 17:63997535-63997557 GAAAATCCAGACAGGAAGCTGGG - Intergenic
1150432681 17:65131027-65131049 GGAAGTGCAGAGATAAAGGTTGG + Intergenic
1150973630 17:70058948-70058970 GTTAATGAACAAATGAAGCTGGG + Intronic
1153892177 18:9527618-9527640 GTAAATGGAGAGATAAATCATGG + Intronic
1153961874 18:10147126-10147148 GCAGATGCTGAGATGGAGCTTGG + Intergenic
1154297629 18:13164412-13164434 GCAATTGCTGAGATGGAGCTAGG + Intergenic
1155230802 18:23773092-23773114 GTAAATGCACACATGACCCTTGG + Intronic
1156648533 18:39197154-39197176 CTATAAGCACAGATGAAGCTTGG + Intergenic
1157952229 18:52052589-52052611 TCAAGTGCAGAGATGAAGGTAGG + Intergenic
1158407781 18:57175662-57175684 TTAAATGCAGAGCTGGAGCAAGG - Intergenic
1158885444 18:61822811-61822833 TCAAATGCAGAGATTAAACTAGG + Intronic
1159249450 18:65855020-65855042 GTAAATGCAGCTATGAAACCTGG + Intronic
1159408044 18:68032126-68032148 GAAAAGGCAGACATGAAGCAAGG - Intergenic
1160044874 18:75377172-75377194 TTAAATGCAGAGAAGCAGCCAGG - Intergenic
1163838496 19:19591293-19591315 GTAAATTCAGCCAGGAAGCTGGG - Intronic
1165748705 19:38246878-38246900 TTAAATGCAGAGAATACGCTAGG - Intronic
1167273198 19:48518171-48518193 GTGACTGCAGGAATGAAGCTGGG + Intergenic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
925273885 2:2635520-2635542 GTAAATGCAAAGATGACCCTGGG - Intergenic
925881815 2:8359097-8359119 TTAAAGTCAGAGGTGAAGCTGGG - Intergenic
925946038 2:8864761-8864783 GTAACTTGAGAGAGGAAGCTGGG - Intronic
926753040 2:16214249-16214271 GTAAAAGCAAAGATCAAGCCTGG - Intergenic
926794632 2:16608864-16608886 GTCAGTGAAGAGGTGAAGCTGGG + Intronic
927684788 2:25162791-25162813 CTTAGTGCAGAGATGGAGCTGGG - Intronic
928392996 2:30923565-30923587 GGAGATGCAGAGGTGAAGCTGGG + Intronic
929898394 2:45981123-45981145 GAAAATGCAACAATGAAGCTAGG + Intronic
930257367 2:49107802-49107824 TTAACAGCAGAGATGAAGTTTGG + Intronic
930406303 2:50960623-50960645 GTAAATCCTGAGAGGAAGCAAGG - Intronic
930997552 2:57738990-57739012 GTAATTAAAGAGATAAAGCTTGG + Intergenic
931096703 2:58948487-58948509 GTAAAAGCAGAGATGCACCCAGG - Intergenic
932417905 2:71584730-71584752 GTAGATGCAGGGGAGAAGCTGGG + Intronic
935315487 2:101829573-101829595 GAGAATGCAGAGGTGAAACTTGG + Exonic
935620677 2:105127006-105127028 GCAGATGCTGAGATGGAGCTTGG + Intergenic
938250365 2:129811120-129811142 GAAAAACCAGAGATGAAGTTAGG - Intergenic
938809325 2:134837786-134837808 TTAAATGCATGAATGAAGCTGGG + Intergenic
939466156 2:142560576-142560598 ATAAAGACAGAGATAAAGCTGGG + Intergenic
940239775 2:151550378-151550400 GTAATGGCAGAGGTGAAACTTGG - Intronic
941838757 2:170055529-170055551 TTAAATGCAGCGAAGAAGATAGG + Exonic
942064932 2:172261756-172261778 GTTAATGCAGAGATGATGTTTGG - Intergenic
942199358 2:173555255-173555277 GTTAATGCTGAGATGGAGCTAGG + Intergenic
943520146 2:188939083-188939105 ATACATGCAGATCTGAAGCTAGG + Intergenic
944024967 2:195153443-195153465 GTAGATGAGGAGATGAATCTGGG + Intergenic
944151407 2:196562583-196562605 GGAAATGCAGTGATAAGGCTGGG - Intronic
945594695 2:211777049-211777071 GTAAAGGCAGAGATGGAGGGAGG + Intronic
946831078 2:223728618-223728640 GTAAATCCCCAGATGAAGCATGG + Intergenic
947328849 2:229007002-229007024 GAAAATTCACAAATGAAGCTTGG + Intronic
947589123 2:231374982-231375004 GTATCTGGAGAGATAAAGCTAGG - Intergenic
947932480 2:233975245-233975267 GTAAATGCATTGATGAAGCACGG + Intronic
949055115 2:241923483-241923505 CCACATGCAGACATGAAGCTGGG + Intergenic
949055136 2:241923636-241923658 CCACATGCAGACATGAAGCTGGG + Intergenic
1169212747 20:3776971-3776993 GTAAATCCTGAGATCCAGCTGGG - Intergenic
1169237344 20:3941777-3941799 GAAAATAAAAAGATGAAGCTGGG + Intronic
1169683314 20:8241910-8241932 GTAAAGGCACAGATGAAGACAGG + Intronic
1171245296 20:23605980-23606002 GTAACTGCAGAGGTGAGGCCTGG - Intergenic
1171519024 20:25761489-25761511 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1171557899 20:26095016-26095038 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1172264686 20:33600787-33600809 GGAAGTTCAGAGATGAAGGTAGG - Intronic
1173078223 20:39841250-39841272 GTAACTAGAGAGATGAAGATAGG + Intergenic
1173921071 20:46745535-46745557 GAAACAGCAGAGATGAAGCAGGG + Intergenic
1174104359 20:48151755-48151777 GTAAATGCTGAGACTAAGATTGG - Intergenic
1174830923 20:53811574-53811596 GGAGATGGAGAGAAGAAGCTAGG + Intergenic
1176653172 21:9567892-9567914 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1176972709 21:15285418-15285440 GTAAATCCAGAAATGAAGCTGGG - Intergenic
1177006387 21:15677388-15677410 GTAAATGCAGAGAAAATGTTTGG - Intergenic
1177020887 21:15856094-15856116 CTAAATCCAGGGATGTAGCTGGG + Intronic
1177608145 21:23408607-23408629 GTAAATGGAGAACTGCAGCTTGG + Intergenic
1177882954 21:26715973-26715995 GAAATTGCAGAGATGAAGGAGGG + Intergenic
1178178911 21:30136838-30136860 GGAAATGAAGAAATAAAGCTAGG - Intergenic
1178901297 21:36601178-36601200 GGACATGCAGGGATGGAGCTGGG - Intergenic
1179305860 21:40153554-40153576 GTACAAGCACAGATGAAGCTAGG + Intronic
1181761058 22:25059142-25059164 TTCAGTGCAGAGTTGAAGCTAGG + Intronic
1181764456 22:25081080-25081102 GTAAATGCAAGGCAGAAGCTTGG + Intronic
1182673167 22:32015116-32015138 GAAAAAGCAGAGATGAGGCCGGG + Intergenic
1183238293 22:36636875-36636897 TGTAATGCAGAGAAGAAGCTGGG + Intronic
1184348564 22:43927959-43927981 GAAGATGCATAGAGGAAGCTCGG - Intronic
949963138 3:9331340-9331362 AAAGATGAAGAGATGAAGCTTGG + Intronic
950358328 3:12430465-12430487 GTAAATGCAGAGCTGACATTTGG - Intronic
950666406 3:14497933-14497955 GGAAATCCAGAGATGGAGGTGGG + Intronic
952171598 3:30812990-30813012 GAAAATGCAGTGAGGAAGCCTGG + Intronic
955304608 3:57817433-57817455 GTAAATGATGAGATGAGTCTAGG + Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
955927450 3:64022382-64022404 GAAGATGCAGAGAAGAATCTAGG - Exonic
955931537 3:64062366-64062388 GATAATACAGAAATGAAGCTGGG + Intergenic
956177202 3:66484171-66484193 GGAAATACACAGATGAAGCCTGG + Intronic
956811493 3:72867866-72867888 GCAAAGGCACGGATGAAGCTTGG + Intergenic
958153138 3:89717990-89718012 CTAAAATCAGAAATGAAGCTGGG - Intergenic
959820682 3:110731361-110731383 GTAGAGGAAGAGATGAAACTGGG - Intergenic
962417111 3:135193202-135193224 GTAAATGCAGAGAGCAGTCTGGG - Intronic
962720709 3:138172286-138172308 TTAAATAAAGGGATGAAGCTGGG + Intronic
963326731 3:143871416-143871438 GTAGAGGCAGGGATGCAGCTGGG - Intergenic
964004522 3:151811909-151811931 GTAATTTGGGAGATGAAGCTAGG - Intergenic
964155232 3:153577035-153577057 AGAAAAGCAGAGGTGAAGCTGGG - Intergenic
964274443 3:154994472-154994494 GTAAATGCAGCTATGAGGCTTGG + Intergenic
964793210 3:160471970-160471992 ATAAATGAAGAGAAGAATCTGGG - Intronic
964928709 3:161988935-161988957 GTAAATACAGAGGTAAAGATTGG - Intergenic
965079714 3:164020798-164020820 GTAATTTGGGAGATGAAGCTAGG + Intergenic
965659169 3:171022590-171022612 GAAAATGCAGGGATGAGACTGGG - Intronic
965816235 3:172639721-172639743 TTACATGCAGTGATAAAGCTAGG - Intronic
966193763 3:177294176-177294198 GGAAGAGCAGAGATGCAGCTGGG + Intergenic
967015660 3:185479352-185479374 GAAAAGGCAGAGCTGAGGCTTGG - Intronic
967430371 3:189377593-189377615 TTAAATCCATAGATGAAGTTGGG + Intergenic
970024288 4:11605417-11605439 ATAAGTGCAGAGAAGAAGCCAGG + Intergenic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970398878 4:15699040-15699062 GAAATTTCAGAGATGAAGTTGGG - Intronic
970937231 4:21587502-21587524 GTAAATGAAGAGTTAGAGCTTGG + Intronic
974453647 4:62098000-62098022 ATGAATTCAGAGAGGAAGCTGGG - Intergenic
975117048 4:70691438-70691460 AGAGATGCAGAGATGACGCTTGG + Intergenic
975557484 4:75678703-75678725 GTAAGTGATGAGATAAAGCTGGG - Intronic
975749392 4:77507443-77507465 GTAAATGCAGAAATGAAGTGTGG + Intergenic
976049701 4:80997444-80997466 GTGACTGCAGTTATGAAGCTGGG - Intergenic
976399289 4:84589310-84589332 CTAAATGCAGTGTTGAATCTCGG - Intronic
977993679 4:103476422-103476444 GGAAGTGCACAGATGAACCTAGG + Intergenic
982021110 4:151205488-151205510 GTAAAGGCAGAGCTGAAATTGGG - Intronic
984212049 4:176861782-176861804 TTAAATGCATATATGAAACTTGG - Intergenic
984329691 4:178298574-178298596 GTAGATGCAGAGATGAAGTGTGG - Intergenic
985353502 4:189092733-189092755 GTAAATGAAGAGGTGAAGTGAGG - Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
985854568 5:2414896-2414918 GGAAATCCAGAGCTGAAGATGGG - Intergenic
985913442 5:2900480-2900502 GGAGCTGCAGAGAAGAAGCTGGG - Intergenic
987841499 5:23227632-23227654 GTAACTGCAGTAATGAAGGTTGG + Intergenic
988792485 5:34621351-34621373 GAAAATACAGAAATGAGGCTGGG - Intergenic
989064918 5:37450559-37450581 GTAAATGGATAGTGGAAGCTAGG - Intronic
989604682 5:43232656-43232678 GTAAATGGAGAACTGCAGCTTGG + Intronic
989969687 5:50508019-50508041 GTAAATGCTGACATAAAGATGGG + Intergenic
990230362 5:53706354-53706376 TTAAATGCAGTAATGAAGTTGGG + Intergenic
990662030 5:58026698-58026720 GTAAAAGCAGAAATGACACTGGG + Intergenic
992118566 5:73566063-73566085 GTAATCGCAGAGAAGAACCTAGG - Intronic
992296277 5:75330104-75330126 CGAAATGCAGATATGAAGGTTGG + Intergenic
992371761 5:76151167-76151189 GGACTTGCAGAGATGGAGCTGGG + Intronic
992849461 5:80791819-80791841 ATAAATGCACAGAAGAAGGTTGG + Intronic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
994262083 5:97671379-97671401 ATAAATGCAGAAATGAGCCTTGG - Intergenic
994418726 5:99506369-99506391 GTAAATGGATAGTGGAAGCTAGG - Intergenic
995247995 5:109957665-109957687 CTAAATGTAGAGATTAATCTGGG + Intergenic
996642580 5:125774801-125774823 GGAAATGCAGAGATAAGGCAAGG - Intergenic
996876898 5:128250341-128250363 GTGAAGGAAGAGATGAAGATTGG + Intergenic
997847968 5:137305054-137305076 GTAAATTAATAGTTGAAGCTAGG - Intronic
997871977 5:137514328-137514350 GTGAATTCAGAGATGGACCTGGG - Intronic
998569499 5:143244643-143244665 GTTCATGGCGAGATGAAGCTGGG - Intergenic
998672910 5:144373953-144373975 GAAACTGCAGTGATGCAGCTAGG - Intronic
1000447682 5:161344302-161344324 GAAAATACAGAGATGGGGCTAGG + Intronic
1001330761 5:170760765-170760787 GAAAATGCACAGATGGACCTAGG - Intergenic
1001979645 5:176030252-176030274 GTAGATGCTGAGATGGAGTTAGG - Intronic
1002237772 5:177813511-177813533 GTAGATGCTGAGATGGAGTTAGG + Intergenic
1003129995 6:3387195-3387217 GTAACTGCAGAGGAGAAGCCTGG + Intronic
1004022566 6:11788502-11788524 GTAATTTGGGAGATGAAGCTAGG - Intronic
1005050829 6:21682539-21682561 CTAAATGCAGAGACAAAGCAAGG - Intergenic
1005565612 6:27090545-27090567 GTTCATGCATAGATGGAGCTGGG - Intergenic
1006173928 6:32110448-32110470 GCACATGGGGAGATGAAGCTAGG - Intronic
1006435651 6:34024886-34024908 GTCATTTCAGAGATGAAGGTGGG - Intronic
1006445856 6:34079448-34079470 CTGAATGCAACGATGAAGCTGGG - Intronic
1007089218 6:39171882-39171904 CTCAAGGCAGAGAAGAAGCTTGG - Intergenic
1008317103 6:50058155-50058177 TTAAATGCAGAGATGTAGATGGG + Intergenic
1008348573 6:50460106-50460128 GTAAATGAAGAGATAAAGAGGGG + Intergenic
1012233102 6:96783332-96783354 CTAATTGCAAAGAAGAAGCTAGG + Intergenic
1013431111 6:110055463-110055485 GCAAATGCAGAGAGGAAGAGAGG - Intergenic
1013970410 6:116011495-116011517 GAAAATGCAGAAAGGAAACTGGG + Intronic
1015528635 6:134198119-134198141 GTGGGAGCAGAGATGAAGCTAGG - Intronic
1016407869 6:143749419-143749441 GTAAATGCAAAGTTTTAGCTTGG + Intronic
1016749918 6:147621154-147621176 GTAAAAGCATACAGGAAGCTTGG - Intronic
1017205356 6:151799473-151799495 GTTAATGCAGAGATGATGTCTGG + Intronic
1017212491 6:151872180-151872202 GTAAATACAGTTCTGAAGCTTGG - Intronic
1017501668 6:155031425-155031447 GAAAATGAAGAGATGAGGCTGGG + Intronic
1017586928 6:155936802-155936824 TGAAATGCAGAGTTCAAGCTGGG - Intergenic
1018877032 6:167830560-167830582 TTAAATGCAGAAATTATGCTAGG + Intronic
1020520676 7:9182461-9182483 GTAAATACAAAGATGAAAGTAGG - Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020618150 7:10485735-10485757 GTAAATGCTGAGAAGAACATAGG - Intergenic
1021228021 7:18051263-18051285 AGCAATGCAGAGATGAAGCTTGG + Intergenic
1023525113 7:41093992-41094014 ATCAAAGCAGAGATAAAGCTGGG - Intergenic
1023878629 7:44306479-44306501 ATAAATACAGAGATGAAGACAGG + Intronic
1025279519 7:57616622-57616644 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1025305212 7:57848878-57848900 GAACAGGCAGAGTTGAAGCTGGG + Intergenic
1026652015 7:72223951-72223973 GTACACGCAGACATGAAGATGGG + Intronic
1028415662 7:90577973-90577995 GTAGAAGCAGAAATGAGGCTGGG + Intronic
1030158433 7:106481564-106481586 TTAAATGAAAATATGAAGCTGGG - Intergenic
1030591643 7:111489448-111489470 GTGAAGGCGGAGAGGAAGCTTGG - Intronic
1030817100 7:114051583-114051605 GTAAAAGCAGATTTGAAGTTAGG + Intronic
1031985253 7:128160296-128160318 ATAAATGCAGGGGTGAAGCAAGG + Intergenic
1034276801 7:149827402-149827424 GTGAATGCAGACATGCAGCATGG + Intergenic
1036251966 8:7170166-7170188 ATAAATGGAGAGAGGGAGCTCGG - Intergenic
1036365524 8:8117295-8117317 ATAAATGGAGAGAGGGAGCTCGG + Intergenic
1037282244 8:17255070-17255092 GGAAATACAGAGATGAATATGGG - Intronic
1038410865 8:27358704-27358726 GAAAAGGCAAAGATGAAGCATGG - Intronic
1039003773 8:33011021-33011043 GTAAATTCAGAGATGGGGGTGGG - Intergenic
1039331986 8:36547561-36547583 GTACATGAAGAAATGAAGCATGG - Intergenic
1039611493 8:38922870-38922892 GTAAATGCAGCGCTGGAGCCAGG + Intronic
1040518205 8:48151595-48151617 CTACATGGTGAGATGAAGCTAGG - Intergenic
1041289760 8:56297570-56297592 GCAAATGCACAGAAGGAGCTTGG + Intergenic
1041309908 8:56505771-56505793 GTAAAGCCAGAGATGTAGCAAGG - Intergenic
1041513959 8:58679429-58679451 GTAAATAGAGAGATGAGGCATGG + Intergenic
1042784665 8:72535202-72535224 GGAAATGCAGAGCTGGAGCTTGG + Intergenic
1043326289 8:79055907-79055929 GTGAATGCAGACATGAAACTTGG - Intergenic
1044431409 8:92111990-92112012 GAAAATACAGACATGAAGCCAGG - Intergenic
1045628463 8:104085918-104085940 GGAAATACAGATCTGAAGCTTGG + Intronic
1046449912 8:114375291-114375313 TTCAAAGCAGAGATGAAGATTGG + Intergenic
1047428544 8:124768938-124768960 ATAAATGGATAGATGTAGCTGGG + Intergenic
1047991196 8:130288466-130288488 GTAAATGCACAGCTGCAGGTAGG - Intronic
1050929661 9:11307575-11307597 CTGAATGCTAAGATGAAGCTGGG - Intergenic
1051737636 9:20217982-20218004 TTAAAGCCAGAAATGAAGCTGGG - Intergenic
1051746545 9:20300075-20300097 GTAAATACACAGATGATGGTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052994226 9:34541624-34541646 GTTAATGCATAGATGAATCAAGG - Intergenic
1053143870 9:35698964-35698986 GTAAAGTCAGAGATGAAGGTGGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1055332269 9:75196910-75196932 GTAAATGAATACCTGAAGCTGGG + Intergenic
1055370747 9:75596092-75596114 GTAAATGCAGATATATAGTTAGG + Intergenic
1055959929 9:81810633-81810655 GTAAATAAATAGATGGAGCTGGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1056915615 9:90743499-90743521 CAAAATGCAGACATGATGCTGGG - Intergenic
1057572225 9:96213354-96213376 ATATATGCAGACATGAAGCCAGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1058154800 9:101503166-101503188 TGGAATGCAGACATGAAGCTTGG + Intronic
1058745008 9:107981911-107981933 GAAAATGCATGGATGAGGCTGGG - Intergenic
1059456583 9:114403696-114403718 GCAAAGGCAGAGCTGAAACTGGG + Intronic
1060548084 9:124472243-124472265 GAAGATTCAGAGATGAAGATTGG - Intronic
1061224683 9:129274049-129274071 GTGCAGTCAGAGATGAAGCTGGG - Intergenic
1203630903 Un_KI270750v1:71432-71454 GAACAGGCAGAGTTGAAGCTGGG - Intergenic
1185644146 X:1605161-1605183 GTACAAGCAGAGGGGAAGCTGGG - Intergenic
1185892227 X:3832006-3832028 GTAGAGGCAGAGATGCTGCTGGG - Intronic
1185897334 X:3870425-3870447 GTAGAGGCAGAGATGCTGCTGGG - Intergenic
1185902453 X:3908857-3908879 GTAGAGGCAGAGATGCTGCTGGG - Intergenic
1185981136 X:4780143-4780165 GTGAATACACAGTTGAAGCTTGG + Intergenic
1186346973 X:8703664-8703686 TTAAAAGGAGAGATGAAGATTGG + Intronic
1189448434 X:41103662-41103684 ATAAATGCAGAAATGAAATTAGG - Intronic
1189911152 X:45811557-45811579 ATAAAGGCACAGATGTAGCTAGG - Intergenic
1190193358 X:48295642-48295664 GTAAATGCAGAGGAGAAAATCGG + Intergenic
1190659865 X:52644265-52644287 GTAAATGCAGAGGGGAAAATCGG + Exonic
1190676864 X:52790079-52790101 GTAAATGCAGAGGGGAAAATCGG - Intronic
1195385758 X:104312311-104312333 GTACATTCAGAAATGAAGCCAGG - Intergenic
1195765103 X:108287814-108287836 GTAGATGAGGAGATGCAGCTGGG - Intronic
1196216311 X:113056080-113056102 AAAAATGCAGAGATGAATGTAGG + Intergenic
1196502116 X:116396790-116396812 GTAAATGTGGACATGAAGATGGG - Intergenic
1198578041 X:138032457-138032479 GTATATGTAGACATGAAGATAGG + Intergenic
1198628018 X:138601412-138601434 TGAAATTCAGATATGAAGCTAGG + Intergenic
1199463940 X:148114955-148114977 GTGAATGTAGAGATCAACCTTGG + Intergenic