ID: 1086452647

View in Genome Browser
Species Human (GRCh38)
Location 11:86932387-86932409
Sequence ATGGTGATGGCCCCTGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 561
Summary {0: 1, 1: 0, 2: 8, 3: 114, 4: 438}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086452647_1086452658 19 Left 1086452647 11:86932387-86932409 CCTGAAGCAGGGGCCATCACCAT 0: 1
1: 0
2: 8
3: 114
4: 438
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184
1086452647_1086452655 17 Left 1086452647 11:86932387-86932409 CCTGAAGCAGGGGCCATCACCAT 0: 1
1: 0
2: 8
3: 114
4: 438
Right 1086452655 11:86932427-86932449 AGCCTCCAGAAGAGTTTGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 178
1086452647_1086452656 18 Left 1086452647 11:86932387-86932409 CCTGAAGCAGGGGCCATCACCAT 0: 1
1: 0
2: 8
3: 114
4: 438
Right 1086452656 11:86932428-86932450 GCCTCCAGAAGAGTTTGCTGGGG 0: 1
1: 0
2: 3
3: 14
4: 175
1086452647_1086452654 16 Left 1086452647 11:86932387-86932409 CCTGAAGCAGGGGCCATCACCAT 0: 1
1: 0
2: 8
3: 114
4: 438
Right 1086452654 11:86932426-86932448 CAGCCTCCAGAAGAGTTTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086452647 Original CRISPR ATGGTGATGGCCCCTGCTTC AGG (reversed) Intronic