ID: 1086452649

View in Genome Browser
Species Human (GRCh38)
Location 11:86932400-86932422
Sequence GGCCGTGTCACTGATGGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 135}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086452649_1086452660 20 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452660 11:86932443-86932465 TGCTGGGGGCTGAGAGTGTGTGG 0: 1
1: 0
2: 5
3: 69
4: 766
1086452649_1086452656 5 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452656 11:86932428-86932450 GCCTCCAGAAGAGTTTGCTGGGG 0: 1
1: 0
2: 3
3: 14
4: 175
1086452649_1086452655 4 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452655 11:86932427-86932449 AGCCTCCAGAAGAGTTTGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 178
1086452649_1086452654 3 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452654 11:86932426-86932448 CAGCCTCCAGAAGAGTTTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 210
1086452649_1086452658 6 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184
1086452649_1086452661 21 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452661 11:86932444-86932466 GCTGGGGGCTGAGAGTGTGTGGG 0: 1
1: 0
2: 4
3: 57
4: 480

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086452649 Original CRISPR GGCCGTGTCACTGATGGTGA TGG (reversed) Intronic