ID: 1086452650

View in Genome Browser
Species Human (GRCh38)
Location 11:86932406-86932428
Sequence CTGGGTGGCCGTGTCACTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086452650_1086452654 -3 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452654 11:86932426-86932448 CAGCCTCCAGAAGAGTTTGCTGG 0: 1
1: 0
2: 1
3: 28
4: 210
1086452650_1086452656 -1 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452656 11:86932428-86932450 GCCTCCAGAAGAGTTTGCTGGGG 0: 1
1: 0
2: 3
3: 14
4: 175
1086452650_1086452658 0 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184
1086452650_1086452661 15 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452661 11:86932444-86932466 GCTGGGGGCTGAGAGTGTGTGGG 0: 1
1: 0
2: 4
3: 57
4: 480
1086452650_1086452655 -2 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452655 11:86932427-86932449 AGCCTCCAGAAGAGTTTGCTGGG 0: 1
1: 0
2: 3
3: 18
4: 178
1086452650_1086452662 25 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452662 11:86932454-86932476 GAGAGTGTGTGGGAAATACATGG 0: 1
1: 0
2: 2
3: 14
4: 303
1086452650_1086452665 28 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452665 11:86932457-86932479 AGTGTGTGGGAAATACATGGGGG 0: 1
1: 1
2: 0
3: 21
4: 233
1086452650_1086452660 14 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452660 11:86932443-86932465 TGCTGGGGGCTGAGAGTGTGTGG 0: 1
1: 0
2: 5
3: 69
4: 766
1086452650_1086452664 27 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452664 11:86932456-86932478 GAGTGTGTGGGAAATACATGGGG 0: 1
1: 0
2: 0
3: 15
4: 224
1086452650_1086452663 26 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452663 11:86932455-86932477 AGAGTGTGTGGGAAATACATGGG 0: 1
1: 0
2: 4
3: 16
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086452650 Original CRISPR CTGGGTGGCCGTGTCACTGA TGG (reversed) Intronic