ID: 1086452658

View in Genome Browser
Species Human (GRCh38)
Location 11:86932429-86932451
Sequence CCTCCAGAAGAGTTTGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 1, 2: 3, 3: 22, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086452650_1086452658 0 Left 1086452650 11:86932406-86932428 CCATCAGTGACACGGCCACCCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184
1086452649_1086452658 6 Left 1086452649 11:86932400-86932422 CCATCACCATCAGTGACACGGCC 0: 1
1: 0
2: 0
3: 14
4: 135
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184
1086452647_1086452658 19 Left 1086452647 11:86932387-86932409 CCTGAAGCAGGGGCCATCACCAT 0: 1
1: 0
2: 8
3: 114
4: 438
Right 1086452658 11:86932429-86932451 CCTCCAGAAGAGTTTGCTGGGGG 0: 1
1: 1
2: 3
3: 22
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086452658 Original CRISPR CCTCCAGAAGAGTTTGCTGG GGG Intronic