ID: 1086454393

View in Genome Browser
Species Human (GRCh38)
Location 11:86947040-86947062
Sequence CTAAAAATACAGAAGTAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 47258
Summary {0: 3, 1: 211, 2: 8927, 3: 22915, 4: 15202}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086454387_1086454393 7 Left 1086454387 11:86947010-86947032 CCTGGCCAACACAGTGAAACCCC 0: 1798
1: 23902
2: 126584
3: 203942
4: 210471
Right 1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG 0: 3
1: 211
2: 8927
3: 22915
4: 15202
1086454388_1086454393 2 Left 1086454388 11:86947015-86947037 CCAACACAGTGAAACCCCGTCTC 0: 941
1: 8626
2: 53354
3: 138542
4: 139207
Right 1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG 0: 3
1: 211
2: 8927
3: 22915
4: 15202
1086454386_1086454393 11 Left 1086454386 11:86947006-86947028 CCAGCCTGGCCAACACAGTGAAA 0: 2356
1: 16652
2: 134043
3: 260834
4: 290277
Right 1086454393 11:86947040-86947062 CTAAAAATACAGAAGTAGCTGGG 0: 3
1: 211
2: 8927
3: 22915
4: 15202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086454393 Original CRISPR CTAAAAATACAGAAGTAGCT GGG Exonic
Too many off-targets to display for this crispr