ID: 1086455346

View in Genome Browser
Species Human (GRCh38)
Location 11:86955042-86955064
Sequence CCGGGCGCCCCCGGGACGCT CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086455334_1086455346 -1 Left 1086455334 11:86955020-86955042 CCCCAGACTGAGACCGACGCCCC 0: 1
1: 0
2: 2
3: 3
4: 80
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157
1086455330_1086455346 29 Left 1086455330 11:86954990-86955012 CCCCAGGAGCAGCAGCAACTGCA 0: 1
1: 2
2: 16
3: 121
4: 647
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157
1086455335_1086455346 -2 Left 1086455335 11:86955021-86955043 CCCAGACTGAGACCGACGCCCCC 0: 1
1: 0
2: 1
3: 7
4: 67
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157
1086455331_1086455346 28 Left 1086455331 11:86954991-86955013 CCCAGGAGCAGCAGCAACTGCAG 0: 1
1: 1
2: 20
3: 129
4: 742
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157
1086455332_1086455346 27 Left 1086455332 11:86954992-86955014 CCAGGAGCAGCAGCAACTGCAGG 0: 1
1: 0
2: 15
3: 121
4: 944
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157
1086455336_1086455346 -3 Left 1086455336 11:86955022-86955044 CCAGACTGAGACCGACGCCCCCG 0: 1
1: 0
2: 0
3: 5
4: 47
Right 1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG 0: 1
1: 0
2: 0
3: 11
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086455346 Original CRISPR CCGGGCGCCCCCGGGACGCT CGG Exonic
900349650 1:2228461-2228483 CCGCGCGCCCCCCGGGCTCTAGG - Intergenic
900349737 1:2228675-2228697 GCGGGCGCCGCCGGGGCGCGCGG + Exonic
901526124 1:9824213-9824235 CCGGGCCCCTCCCGGCCGCTCGG - Exonic
902067543 1:13700452-13700474 CCCGGGGCCCCCGGCACGCCCGG - Intronic
902916760 1:19644336-19644358 GGGGGCGGCCCCGCGACGCTCGG - Intronic
902918169 1:19651216-19651238 CCGGGCTCCCCCTGGAAGCGTGG - Intronic
903034920 1:20486857-20486879 CCGGGCTCGCCCGGGATGCCTGG + Intergenic
905889523 1:41510702-41510724 CCGGCCGCCCCAGGGACGCCGGG - Exonic
906495785 1:46303054-46303076 CCCCGCGCCCCCCGGCCGCTGGG + Intronic
906532836 1:46533245-46533267 CCGAGCGCCCACGGGGCGCGAGG + Intergenic
913592485 1:120342127-120342149 CCGGCCGTCCCCGGCACCCTCGG - Intergenic
913650865 1:120913003-120913025 CCGGCCGTCCCCGGCACCCTCGG + Intergenic
914170248 1:145216064-145216086 CCGGCCGTCCCCGGCACCCTCGG - Intergenic
914525365 1:148460030-148460052 CCGGCCGTCCCCGGCACCCTCGG - Intergenic
914598309 1:149175800-149175822 CCGGCCGTCCCCGGCACCCTCGG + Intergenic
914641036 1:149607098-149607120 CCGGCCGTCCCCGGCACCCTCGG + Intergenic
920720051 1:208378848-208378870 CCAGGTGCCCCCTGGACACTGGG - Intergenic
922307580 1:224357296-224357318 CCGGGCGCCGCGGGGACGAGCGG - Intronic
922749728 1:228064792-228064814 CCTGGCCTCCCCAGGACGCTGGG + Intergenic
924811850 1:247409919-247409941 TCGGGGGCCCCTGGGACTCTTGG + Intergenic
1063112052 10:3046252-3046274 CTGGGAGCCCCCGGGAGGCCAGG - Intergenic
1063133518 10:3197565-3197587 CCGGGCGCTGCCGAGACTCTGGG + Intergenic
1063449961 10:6144768-6144790 CCGGGCGCCCTCGGGCTGCTGGG - Intergenic
1063593187 10:7411252-7411274 GCGGGCACCCCCAGGACCCTGGG + Intronic
1064167784 10:13001572-13001594 CCGGGCCCTCCCGGGGCGCACGG + Exonic
1064552847 10:16520740-16520762 CCGGGCCCGCCCGGGGCGCCCGG - Exonic
1073063169 10:100744196-100744218 CCGGGCGCCCCGCGGAAGCGCGG - Intronic
1077602028 11:3580881-3580903 CCCTGCGCCCCCGGGACCCCCGG + Intergenic
1078617552 11:12879819-12879841 CCCGGCGCCCCTGGGAAGGTCGG - Exonic
1081831987 11:46121726-46121748 CCCGCGGCTCCCGGGACGCTCGG + Intergenic
1083232609 11:61332819-61332841 CCGGCCGCCCCCGGGGCGGCGGG + Intronic
1084010944 11:66347877-66347899 CCGGGCGCGCCCTGAACGCGCGG + Intergenic
1086455346 11:86955042-86955064 CCGGGCGCCCCCGGGACGCTCGG + Exonic
1090948523 11:131452246-131452268 CCGGGAGGCCACGGGGCGCTCGG - Intronic
1098779253 12:74664174-74664196 CCGGGAGCCGCCAGGACCCTCGG - Intergenic
1102046335 12:109832511-109832533 CCTGGTGCCCCCGGGGTGCTTGG - Intronic
1102854122 12:116278018-116278040 ACGGGCGCGCCCGGGACCCACGG - Intergenic
1112570402 13:100588656-100588678 CCTGGCGCCCGCGGGAACCTGGG - Intronic
1113457951 13:110462292-110462314 CCGGGCACACCTGGGACGCCGGG - Exonic
1113464420 13:110503843-110503865 CCAGGTGCCCCCGGGACTGTGGG + Exonic
1113711284 13:112466931-112466953 CCGGGCTCCCCGGGGTCTCTCGG + Intergenic
1114069896 14:19098174-19098196 CCGGTGGAGCCCGGGACGCTGGG + Intergenic
1114092365 14:19301828-19301850 CCGGTGGAGCCCGGGACGCTGGG - Intergenic
1118206402 14:63727726-63727748 GCGGTCGCTCCCGGGAGGCTGGG + Exonic
1119046324 14:71321134-71321156 GCGGACGCGCCCGGGACGCGCGG + Intronic
1121595242 14:95157296-95157318 CCGGGCGGCTCCGGGAGGCCTGG - Intronic
1122263739 14:100537340-100537362 CCCGGCCCACCCGGGACGATGGG + Exonic
1122623318 14:103071852-103071874 TCGGGCGGCCCAGGGAAGCTGGG - Intergenic
1122907488 14:104808459-104808481 CCTGGCGCCCCAGGGAGGCTGGG - Intergenic
1126736528 15:51737198-51737220 CCGTGCGTCCCCGGGCGGCTCGG - Intronic
1127084090 15:55408459-55408481 CCGGGCGGCTGCGGGAAGCTGGG + Intronic
1127414935 15:58749217-58749239 CCTGGCGGCCCCGGGAGGCGGGG - Intronic
1128053370 15:64682415-64682437 CAGGGCTCCCCAGGGACACTGGG + Exonic
1130023716 15:80252168-80252190 CCGGGCTCGCCCGCGCCGCTGGG - Intergenic
1133063412 16:3189575-3189597 CCAGCCGCCCCCAGGATGCTAGG + Intergenic
1133272033 16:4614978-4615000 CCGGGCGCCCCGGGGGAGCGGGG + Intronic
1133370123 16:5240379-5240401 CTGGGGGCCCCCAGGACGCGGGG - Intergenic
1135382879 16:22008585-22008607 CCGGGCGCCAGCGGGACCCCCGG + Intronic
1136458434 16:30395431-30395453 GTGGCCGCCCCCGGGACGCCTGG + Exonic
1139470217 16:67174408-67174430 CGGCGCGCCCGCGGTACGCTGGG - Exonic
1139637125 16:68264544-68264566 CCCGGCGCCGCCAGGATGCTCGG - Exonic
1141231428 16:82170714-82170736 CCGCGCTCCCCCGGGACTCCGGG - Intergenic
1142136954 16:88455884-88455906 CCCGGCGCCCCCAGCCCGCTGGG + Intronic
1144816578 17:18039530-18039552 CCGGCCGCCACCGGGACCCAGGG - Exonic
1146371085 17:32265989-32266011 CCGGGCGTCCCGGGGTCGCGAGG + Intergenic
1146371084 17:32265989-32266011 CCTCGCGACCCCGGGACGCCCGG - Intergenic
1147150351 17:38510508-38510530 CCGGGCGGCTCCGGGGCGCGGGG - Exonic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1148786856 17:50149809-50149831 CCGGGCTCCCCAGGGCCGCAGGG - Exonic
1150108281 17:62478202-62478224 CCGGGCGCCTCCGGGAAGTCCGG + Intronic
1151586582 17:75012522-75012544 CCGGCCGCCTCCGGGAGGCCTGG - Intergenic
1152283963 17:79401834-79401856 CCGCGCTCCCTCGGGAGGCTGGG - Intronic
1153227549 18:2909902-2909924 CCCTGAGCCCACGGGACGCTGGG - Intronic
1155007342 18:21741040-21741062 CCGGGCGCTCGCCGGACGCCGGG + Intronic
1155519805 18:26656796-26656818 CTGGGCGCCCCCGCGGCGCTGGG + Intronic
1157544531 18:48538886-48538908 CAGGGTGGCCCCAGGACGCTCGG - Intergenic
1158643180 18:59220313-59220335 CCGCTCGCCCCCGGGGCGCCAGG - Exonic
1160204797 18:76823145-76823167 CCGGCTGCCCCGGGGACGTTGGG + Intronic
1160500860 18:79400575-79400597 CCGGGCGCGCCGGGGACTCCTGG - Intronic
1160786373 19:901789-901811 ACAGGCGCCCCCTGGACTCTTGG - Intronic
1160909219 19:1467206-1467228 CCCGGCGCCCCCGCCGCGCTCGG - Exonic
1160983713 19:1828000-1828022 GCGGGAGCCCCGGGGCCGCTTGG + Exonic
1160995918 19:1881855-1881877 CTGGGCACCCCCGGGAGGCGGGG + Intronic
1161560309 19:4969313-4969335 GCGGGCGCGCCCGGGACTCGAGG + Intronic
1161560343 19:4969411-4969433 GCGGGCGCCCCCGGGCCGGGCGG - Intronic
1161614180 19:5260878-5260900 CGGGGGGCCCCAGGGAAGCTGGG + Intronic
1162321024 19:9970629-9970651 CCCGGCGCCCCCGGGCCCCCCGG - Exonic
1165058607 19:33194386-33194408 CGGGGCGGCCCGGGGACGCCGGG + Intronic
1165242796 19:34481519-34481541 CCGGGCGCCCCGCAGACCCTGGG + Intergenic
1165621439 19:37251883-37251905 CCGGGAGCCCGGCGGACGCTGGG + Intergenic
1166983902 19:46648766-46648788 CCTGGGGCCCCTGGGACGCCGGG - Exonic
1167313790 19:48752567-48752589 CCGGCCGCCCCTGGAACGCCAGG + Exonic
1167738824 19:51312032-51312054 CGGGGAGGCCCCGGGACGCCGGG + Intronic
1168336289 19:55599418-55599440 CGGGGCGGCCCCGGGAGGCCGGG + Intronic
927168771 2:20350955-20350977 CAGGGCGCCCCCGGCCCGCGCGG - Intronic
927208387 2:20624208-20624230 CCAGGGGCCCCCGGGGCCCTCGG + Intronic
930711920 2:54557999-54558021 CCGCGCGGGCCCGGGACCCTTGG + Intronic
934277951 2:91588980-91589002 CCGGGCGCCCCAGAAACGCTGGG - Intergenic
935301723 2:101698329-101698351 CCGCGCGACCCCCGGGCGCTGGG + Intronic
935777695 2:106487404-106487426 CGGGGCGCGCCCGGGACACCTGG - Intergenic
936561464 2:113542388-113542410 CCCGGCGCACCCCGGACACTGGG + Intergenic
938727525 2:134120868-134120890 CGGGGCGCCCCCGGGCCTCCTGG - Intronic
944154166 2:196593334-196593356 CCGGGCGCTGCGGGGCCGCTCGG - Intronic
944428064 2:199604108-199604130 CCGGGGGCTCCCGGGAGGCGCGG - Intergenic
1171349538 20:24492142-24492164 CCAGGCACCGCAGGGACGCTGGG + Intronic
1171427501 20:25057976-25057998 CAGGGCGGCCTCGGGACCCTCGG - Exonic
1172146741 20:32762708-32762730 CCCGGGGCCCCGGGGAGGCTCGG + Intronic
1173663591 20:44750632-44750654 TCGGGCGCCCCCGGGGGGCGCGG - Exonic
1174386413 20:50190633-50190655 CGGGGGGCCCCCGGGACGCAGGG - Intergenic
1176131735 20:63499219-63499241 GCGGGCGCCACGGGGACGCGAGG + Exonic
1178673788 21:34614550-34614572 CCGCGCGCCCCGGGGGTGCTAGG + Intronic
1180172347 21:46066113-46066135 CCGGAGGCCCCCGGGACCCAGGG + Intergenic
1180488363 22:15820738-15820760 CCGGTGGAGCCCGGGACGCTGGG + Intergenic
1181811409 22:25405573-25405595 GGGGGCGCCGCCGGGAGGCTCGG + Intergenic
1183301450 22:37061003-37061025 CCGGGGGCCCCGGGGCTGCTGGG + Intronic
1183578216 22:38706022-38706044 CTGGCCGCCCCCGGGGAGCTGGG - Exonic
1184140705 22:42576143-42576165 CCAGGCGCCCACCGGACGATGGG - Intergenic
1185205486 22:49535726-49535748 AAGGGCGCCCCCGGGAGGGTAGG + Intronic
949480905 3:4493216-4493238 CCGGGCGCCCAGGGGATTCTGGG + Intergenic
950681486 3:14588336-14588358 CCGGCCTCCCCTGGGACCCTGGG + Intergenic
953027363 3:39152958-39152980 CCGGGCGCCCCCGGCCGGCGGGG - Intronic
954437528 3:50503850-50503872 GGGGGCGCACCCGGGGCGCTCGG - Intronic
954912353 3:54121215-54121237 CCGGGAGCCCCGGCGACGTTAGG + Intergenic
954912804 3:54122737-54122759 CCGAGGCCCCCCGGGACGCGCGG - Exonic
957072807 3:75579682-75579704 CTGGGGGCCCCCAGGACGCGGGG + Intergenic
961271448 3:125692567-125692589 GCGGGCGCCCCCGCGATGCGGGG + Intergenic
961599969 3:128052703-128052725 CCGGCCGCACCCCGGACGCGTGG - Intronic
961873110 3:130002510-130002532 CTGGGGGCCCCCAGGACGCGGGG + Intergenic
961937373 3:130599772-130599794 CCAGGCCCCCCCGGGACACCAGG + Exonic
968911828 4:3480259-3480281 CCGGGCGGCCCCCAGAGGCTGGG - Intronic
969032787 4:4227356-4227378 CCGGGCGCCCCGGAAACGCTGGG + Intergenic
969361055 4:6664112-6664134 GCGGGTGCGCCCGGGACCCTGGG + Intergenic
969737536 4:9001332-9001354 CTGGGGGCCCCCAGGACGCGGGG - Intergenic
971195892 4:24471641-24471663 TCGGGGGGCCCAGGGACGCTGGG - Intergenic
979495735 4:121380650-121380672 CTGTGCGCTCCCGGGACGCGGGG + Exonic
980930152 4:139177045-139177067 CCCGGCTCCCTCCGGACGCTCGG - Exonic
987132460 5:14871995-14872017 GCTGGCGCCTCCGGGGCGCTGGG + Intergenic
993503322 5:88685106-88685128 ACCGGCTCCCCTGGGACGCTGGG - Intergenic
997512938 5:134465836-134465858 CCGGGCGCCTCTGGGAAGCTGGG + Intergenic
999768435 5:154757016-154757038 CCGGCGGCCCGCGGGCCGCTCGG + Intronic
1002790700 6:435629-435651 CGGGGCTCCTCCGGGAGGCTCGG + Intergenic
1006083526 6:31580993-31581015 CCGGGCGCCCCCTGGCGGCGGGG - Exonic
1008673235 6:53794595-53794617 CCTGGCGCCCCCGGCGCGCAAGG + Intronic
1012912681 6:105136408-105136430 CCAGGCGCTCTCGGGACGCGGGG + Intronic
1014116715 6:117675329-117675351 GCGGGCGCCCCCTGGTCGCGTGG - Intergenic
1019032386 6:169024395-169024417 CCGGGCAGCCCCGAGACGCCGGG - Intergenic
1019427187 7:983289-983311 CCGGGGGCCACCGGGCAGCTGGG - Exonic
1020017287 7:4838430-4838452 CTGGGAGCCCCTGGGACTCTAGG - Intronic
1029079238 7:97959256-97959278 ACGGGCGCCCCCGCGACGCGGGG - Intergenic
1032011785 7:128351956-128351978 CGGGGCGCCCCTGGGAGGGTCGG - Exonic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1037803925 8:22049168-22049190 CCGGGCGGCCCGCGGACGCCAGG + Intronic
1039907511 8:41797691-41797713 CCGGGCGCTCCCGGCACGGGCGG + Intronic
1041107535 8:54457914-54457936 GCGGGCGCCCCTGGGCCGCGGGG - Exonic
1041108820 8:54467003-54467025 GCGGGCGCCCCCGGGCCGCGGGG - Intergenic
1041689996 8:60679100-60679122 CCCGGCGCCCCCGGGAGGGGCGG + Intronic
1047381843 8:124371994-124372016 CCGGGCGGCCCCAGGCGGCTGGG - Exonic
1049891222 9:72952-72974 CCCGGCGCACCCCGGACACTGGG - Intergenic
1053732655 9:41073990-41074012 CCCGGCGCACCCCGGACACTGGG - Intergenic
1057704112 9:97385780-97385802 CTGGGCCCCCCAGGGACCCTGGG - Intergenic
1058908173 9:109498112-109498134 CCGCGCGCCCCAGGGACGGGTGG + Intronic
1059633895 9:116154237-116154259 CCGGGCCCGGCGGGGACGCTCGG - Exonic
1060952265 9:127612017-127612039 CCGCGCGCGCCCGGGGCGCAGGG - Intergenic
1061208348 9:129177063-129177085 CGGGGCGCCCCCGGGGGGCTCGG + Exonic
1061242721 9:129383681-129383703 CCGGGCGCGCCCGGGAAGGCCGG + Intergenic
1062621364 9:137423782-137423804 CAGGGCGACCCCGTGACGGTCGG - Intronic
1185450775 X:280184-280206 CCCCGCGGCCCCGGGACCCTGGG + Intronic
1192315723 X:70049937-70049959 CCTGGAGCCACTGGGACGCTGGG - Exonic
1200121886 X:153794975-153794997 CCGGGCGCACCATGGAGGCTCGG - Intronic