ID: 1086455536

View in Genome Browser
Species Human (GRCh38)
Location 11:86955696-86955718
Sequence TCTCACCTGCAGAAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 1, 2: 3, 3: 27, 4: 279}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086455536 Original CRISPR TCTCACCTGCAGAAGGGGGC AGG (reversed) Intergenic
900155002 1:1200380-1200402 TCTCACCAGCAGCGGGGGCCTGG + Intergenic
902232985 1:15040076-15040098 TCCCACCTGTAAAATGGGGCTGG - Intronic
902835454 1:19044164-19044186 TCTCTCCTGCTGGAGGGGACAGG - Intergenic
902835592 1:19044798-19044820 TCTCTCCTGCTGGAGGGGACAGG + Intergenic
903300360 1:22374489-22374511 TCTCAACCCCAGGAGGGGGCAGG - Intergenic
903369441 1:22825781-22825803 TCCCACCTGCAGCAGGGTCCTGG - Intronic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904054589 1:27661829-27661851 TCTGATCTGCAGAAGGGGTAGGG - Intergenic
904585677 1:31579339-31579361 TCTCCCTTGCAAAAGGGGTCAGG - Intronic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
905907248 1:41627275-41627297 TCTCACTTGCAAAATGAGGCTGG - Intronic
906066458 1:42984630-42984652 TCTCACCTGCAGAATGGGGAGGG - Intergenic
908321591 1:62983869-62983891 TCTCATCTGTAGAATGGGGATGG + Intergenic
910010503 1:82455447-82455469 TGTCACCTGCAGAGAGAGGCTGG + Intergenic
910140175 1:84018460-84018482 TCCCACCTGGTGGAGGGGGCAGG + Intergenic
913092150 1:115483709-115483731 TCTCACCTAAAGAATGGGACTGG + Intergenic
915164554 1:153941368-153941390 TCTCACCTGCACTAGGATGCGGG + Exonic
915271434 1:154756452-154756474 ACTGAGCCGCAGAAGGGGGCAGG - Intronic
915307793 1:154990590-154990612 GCTCACCTGCAGTAGTGGGGAGG + Intronic
915954251 1:160209629-160209651 CCTCAGCTGGAAAAGGGGGCAGG - Intronic
916314116 1:163428436-163428458 TCTCAACTGGAGAAGGAGGAGGG + Intergenic
917742630 1:177975868-177975890 GCTCACCTGAAGCAAGGGGCTGG - Intronic
918458935 1:184755544-184755566 TCTCGTCTGCAAAAGGGGGATGG - Intergenic
919958254 1:202439662-202439684 TCCAACTTGGAGAAGGGGGCCGG - Intronic
920032291 1:203044699-203044721 TCTGCCCTGCAGCAGGGGGCAGG + Intronic
922230794 1:223683907-223683929 TCTCACCTGTAGAATGTGGCTGG - Intergenic
923413739 1:233734531-233734553 TCTGACCTGCACAAGGATGCAGG - Intergenic
923569131 1:235098702-235098724 GCCCACCTGCAGGAGTGGGCAGG + Intergenic
924614551 1:245601845-245601867 GCTCGCCTGCAGGACGGGGCTGG + Intronic
1064011965 10:11742655-11742677 TCCCGGCTGCAGAAGCGGGCGGG - Exonic
1066524523 10:36262000-36262022 TCTCACATGCAGAAGGCAGGAGG - Intergenic
1067532570 10:47085336-47085358 TCTCACAGGGTGAAGGGGGCAGG - Intergenic
1069771513 10:70903478-70903500 TCTGTCCACCAGAAGGGGGCAGG + Intergenic
1069885740 10:71622496-71622518 TCAGACTAGCAGAAGGGGGCGGG + Intronic
1069934463 10:71905765-71905787 GCTCACCTGGAGAAGGGCCCAGG - Intergenic
1070286356 10:75086707-75086729 TATCACCTGAAGAAGGGTGGAGG - Intergenic
1071394275 10:85206256-85206278 GCTCACCTGGACAAGGAGGCGGG + Intergenic
1073288120 10:102400504-102400526 TCTCACCTGACTAAGGGGGCAGG + Intronic
1074525685 10:114261169-114261191 TCTGACCTGCAGTAGGAGACAGG - Exonic
1075722324 10:124594431-124594453 CCACAGCTACAGAAGGGGGCTGG - Intronic
1075890176 10:125941992-125942014 TCTGGCCTTCAGATGGGGGCTGG + Intronic
1076346338 10:129781255-129781277 CCTCACCTGCAGAACAGGGATGG + Intergenic
1076403214 10:130196646-130196668 CCTCAGCTGCAGAAGGTTGCAGG + Intergenic
1076574415 10:131454174-131454196 GCTTGCCTGCAGCAGGGGGCAGG - Intergenic
1077997549 11:7466977-7466999 GGCCACCTGCAGAAGGTGGCTGG - Exonic
1080394106 11:31874199-31874221 CCTCACCTGGAAAATGGGGCTGG - Intronic
1083476143 11:62916868-62916890 TCTCACCTGGGGCAGGTGGCAGG + Intronic
1083958097 11:65997966-65997988 TATCACTTCCAGAAGGTGGCTGG - Exonic
1085284767 11:75352305-75352327 TCTCTCCAGTAGAAGGGGGTGGG - Intergenic
1086455536 11:86955696-86955718 TCTCACCTGCAGAAGGGGGCAGG - Intergenic
1086840726 11:91681014-91681036 TCTCATCTACAGAATGGGGGTGG - Intergenic
1087269406 11:96096453-96096475 TCTCATCTGCAAAAGCGGGGAGG - Intronic
1088368189 11:109060740-109060762 TCTCACCTGTAAAATGGGGTTGG + Intergenic
1088893264 11:114060461-114060483 CCTCCCCTGCAAAAGGGGGGTGG - Intronic
1092076058 12:5674507-5674529 TCTCACATACAGAAAGTGGCTGG + Intronic
1095160284 12:38906496-38906518 TCTGACCTGAAAATGGGGGCCGG + Intronic
1096077438 12:48814422-48814444 ACGCACCCGCAGAAAGGGGCGGG + Intronic
1096809071 12:54158300-54158322 TACCACCAGGAGAAGGGGGCTGG + Intergenic
1097763870 12:63500282-63500304 TCTCAACTGCAAGAAGGGGCCGG + Intergenic
1098066673 12:66625989-66626011 TCTCCCCTCCAGAAGTGGGCTGG - Intronic
1098613048 12:72485580-72485602 CCTCACCTGTAGAATGGGGAGGG - Intronic
1099975496 12:89541959-89541981 TCTCCCCTTCAGAAGTGAGCAGG - Intergenic
1100400085 12:94221778-94221800 TCTCACATACAGAAGGGGCAGGG + Intronic
1103929917 12:124444663-124444685 TCTCCCCTGCAGCCGGGGTCAGG - Intronic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1105286665 13:19009639-19009661 TGTCTCCTGCAGTAGGGGGTGGG + Intergenic
1106080410 13:26495951-26495973 TCCCACCTGCAGATGCTGGCAGG + Intergenic
1106141692 13:27017234-27017256 TCTAAACTGCAAAAGGGAGCAGG + Intergenic
1106190683 13:27450136-27450158 GCCCACCTGCAGAACGGGACCGG + Intronic
1108978353 13:56478781-56478803 TCCCTCCTGCAGGAAGGGGCTGG - Intergenic
1109178310 13:59182542-59182564 TCTCACTTGAAAAAAGGGGCAGG + Intergenic
1112818290 13:103299850-103299872 TCTAACATGCAAAAGGCGGCTGG + Intergenic
1113573918 13:111381572-111381594 TCTCACCATCTGAAAGGGGCAGG - Intergenic
1113848518 13:113405237-113405259 TGTCACCAGCAGTAGGGGGCAGG + Intergenic
1115385276 14:32789447-32789469 CCACACCTGTAGAAGGTGGCTGG - Intronic
1116317547 14:43417378-43417400 TTGCACCTGCAGTAGGTGGCCGG + Intergenic
1122577120 14:102749575-102749597 TCTCTGCTGCAGGAGAGGGCGGG - Intergenic
1122636070 14:103130260-103130282 GCTCGCCTGGACAAGGGGGCAGG - Intronic
1123159126 14:106260418-106260440 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123207871 14:106730794-106730816 TCACACCTGCAGGAGGGGCAGGG + Intergenic
1123586105 15:21762008-21762030 TCTCACATACAGAAGGTGGCTGG - Intergenic
1123622746 15:22204598-22204620 TCTCACATACAGAAGGTGGCTGG - Intergenic
1125597326 15:40895193-40895215 TCCCACCTCCAGAAGGGGCCTGG - Intronic
1125717512 15:41827637-41827659 TCAGACATGCAGAAGGGGACGGG - Exonic
1125754399 15:42053121-42053143 TCTCACCTGCACAGTGGGGTGGG - Intergenic
1125790985 15:42365534-42365556 TCTCACTTGCTGATGGTGGCTGG + Intronic
1126377784 15:48013296-48013318 TATAACATGCAAAAGGGGGCAGG - Intergenic
1127310097 15:57744853-57744875 CCACATCTGCAGAATGGGGCTGG - Intronic
1128862306 15:71084095-71084117 TCTCAACTGTAGAAGGAGGTGGG + Intergenic
1132282756 15:100634472-100634494 TTTCACCTGCAGAAGTGGCTCGG - Intronic
1132352145 15:101146523-101146545 ATTCACCAGCAGAAGGGAGCTGG + Intergenic
1132405808 15:101541368-101541390 TCTCCCCTCCAGGAGGGGCCAGG - Intergenic
1133028550 16:2998942-2998964 TCTGCACTGCGGAAGGGGGCTGG - Intergenic
1134448570 16:14349008-14349030 CCTCACCTGCAAAATGGGGCAGG - Intergenic
1138405795 16:56792986-56793008 TCTTACCTGTAAAATGGGGCAGG + Intronic
1140440497 16:74984350-74984372 TCTCACCTGTAGAAGGGAGATGG - Intronic
1141157777 16:81609365-81609387 TCTCCCCCGCCGAGGGGGGCTGG - Intronic
1141429678 16:83965220-83965242 GCTCACCTGGAAGAGGGGGCTGG - Exonic
1142203251 16:88770986-88771008 TCTCATCTGCAGGCGGGGCCTGG + Intronic
1143087565 17:4427549-4427571 TCTCACCTACAAAATGGGGATGG - Intergenic
1143354308 17:6314075-6314097 TCTCCCCTGCAGCAGGTGGGTGG - Intergenic
1143723447 17:8829787-8829809 GGTCACCTGCAGAAAGGAGCAGG + Exonic
1143980829 17:10868221-10868243 TCTCAGCTGCAGAAGTGACCTGG + Intergenic
1145000659 17:19302290-19302312 TCTCATCTGCAGAATGGGGACGG - Intronic
1145235533 17:21205447-21205469 TCTCCGCTGCAGGAGGAGGCAGG + Intronic
1145243412 17:21252694-21252716 TACCACCCGCAGAAGGGGACAGG + Intronic
1146277304 17:31523876-31523898 GCTTACCTGCAGCAGGGGGCCGG - Exonic
1146890041 17:36501000-36501022 TCTCCTCAGCAGGAGGGGGCAGG - Intronic
1147421987 17:40326535-40326557 TCTCACCCTCAGAAGGTGCCAGG - Intronic
1147629920 17:41923520-41923542 ACTCACCTGCAGCAGGTTGCAGG - Intronic
1147744433 17:42686643-42686665 TCTTATCTGCAGATGGGGTCAGG - Intronic
1148088438 17:45008283-45008305 CCTCACCTGCAGCTGGGGGACGG + Intergenic
1149315457 17:55434276-55434298 TCTCACCTGTAAAATGGGGGAGG + Intergenic
1149496149 17:57118965-57118987 TGTCACCTGAAGAAGGGGGGTGG - Exonic
1152827243 17:82474846-82474868 TCTCAGCTCCAGATGGGGACAGG + Intronic
1203163865 17_GL000205v2_random:76219-76241 TCCCACCTGCAGAAAGCGACAGG + Intergenic
1153293194 18:3521370-3521392 CCTGCCCTGCTGAAGGGGGCTGG - Intronic
1153480798 18:5544045-5544067 TGTCTCCTGCAACAGGGGGCGGG - Exonic
1155577073 18:27259587-27259609 ACACACCTGCAGGAGGTGGCTGG + Intergenic
1156462084 18:37326757-37326779 TCCCACCTGCGGCAGGGGGTGGG + Intronic
1157369816 18:47100408-47100430 TCTCACCAGCAGATGGAGCCTGG + Intronic
1158476678 18:57786271-57786293 TCTCACCTGCTCAAGGTGACAGG + Intronic
1158940439 18:62402385-62402407 GCTGACCTGCAGGAGGGAGCTGG - Intergenic
1160440274 18:78884268-78884290 GCTCACCTGGATCAGGGGGCTGG + Intergenic
1160798447 19:956282-956304 TCTCAGCTGCAAAAGTGAGCCGG - Intronic
1161358312 19:3831929-3831951 CCTCACCTGCAGATGGGCCCTGG + Intronic
1161895267 19:7075089-7075111 ACTCACCGGCAGTTGGGGGCAGG - Exonic
1162100007 19:8333803-8333825 TCGCACCTGCAGAGGAGGCCAGG + Exonic
1162923573 19:13918560-13918582 TCTCACCGGGTGGAGGGGGCAGG - Exonic
1163718581 19:18886800-18886822 ACTCGGCTGCAGAAGGGGCCAGG - Intronic
1164204798 19:23049178-23049200 TCACACCTGCAGAAAGGCCCAGG + Intergenic
1166340255 19:42133012-42133034 GCTCACCTGCAGATAGGCGCAGG - Intronic
1166566450 19:43768429-43768451 TCTCAGCAGAAGAAGGGGGCGGG + Intronic
1166774400 19:45303473-45303495 TCTCATCTGCAGAATGGGAGCGG + Exonic
1166863213 19:45821480-45821502 CCTCACCTGCAGCAGGCGGGAGG + Exonic
1167209248 19:48122784-48122806 ACTCAGTTGCAGCAGGGGGCTGG + Intronic
1167622109 19:50566354-50566376 TCCCAGCTGGAGAGGGGGGCGGG + Intronic
1168323066 19:55521775-55521797 TCTGGCCTGCAGAGAGGGGCTGG - Intergenic
925294581 2:2768702-2768724 TGTCACCTGGACAAGGGGACTGG + Intergenic
925324681 2:3008735-3008757 TCAGAGCTGCAGAACGGGGCTGG + Intergenic
925717382 2:6796840-6796862 TCCTGCCTGCAGGAGGGGGCAGG - Intergenic
925789586 2:7470477-7470499 AGTCACCTGCAGGAGGTGGCTGG + Intergenic
925925384 2:8666399-8666421 TCTCATCTTCCGAGGGGGGCAGG + Intergenic
926147120 2:10403404-10403426 TTTCAACTGCAGAATGGAGCTGG - Intronic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
929868341 2:45737089-45737111 TCTCCCCTGCAGCATGGGGTTGG + Intronic
931284238 2:60819174-60819196 CCTCATCTGCAGAACAGGGCTGG - Intergenic
932084356 2:68745168-68745190 TCTCATCTGAAAAATGGGGCCGG + Intronic
932232533 2:70094595-70094617 TCTCACTGGCAGGAGGTGGCAGG - Intergenic
932887569 2:75561018-75561040 GCTGGCTTGCAGAAGGGGGCGGG - Intronic
933645748 2:84811453-84811475 TCTCACCAGAAGATGGAGGCAGG - Intronic
936862103 2:117030415-117030437 ACACACCTGTAGAAGGTGGCTGG - Intergenic
938064428 2:128273401-128273423 TCACATCTGCAGAAAGGGGCAGG - Intronic
938776387 2:134544978-134545000 CCTCCCCTCCAGGAGGGGGCTGG - Intronic
941188238 2:162344085-162344107 GCTGGCCTGCGGAAGGGGGCGGG + Exonic
945967251 2:216201707-216201729 TCTCTTCTGCAGAAAGGGGTAGG - Intronic
947463706 2:230323784-230323806 CCCCACCTTCAGAAGGTGGCCGG + Intergenic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948639852 2:239368727-239368749 CCTCACCTGCAGAACAGGGAGGG - Intronic
949032775 2:241804849-241804871 TCTCACTTGCCAAAGGAGGCTGG + Intergenic
1170807430 20:19644773-19644795 TTTCCCCTGGAGAAGGGGGCAGG - Intronic
1171446492 20:25207857-25207879 TCTCAGCTGGATAAGGGAGCTGG + Intronic
1172280295 20:33703188-33703210 TTTCACCTTCAGCTGGGGGCAGG + Exonic
1172902606 20:38346103-38346125 TCTCACCCCCAGCAGAGGGCAGG - Intergenic
1173333636 20:42096130-42096152 TCTGAACTGCAGAAGTGGCCAGG - Intronic
1174169702 20:48608361-48608383 TCTCATCTGCAATAGGGGACTGG + Intergenic
1174520986 20:51130474-51130496 CCTCATCTGAAGAAGGGGGTCGG + Intergenic
1175470007 20:59220933-59220955 CCTCATCTGTAGAATGGGGCTGG + Intronic
1175817572 20:61891468-61891490 AGTCACCTGGAGAAGGGGGGAGG - Intronic
1175856464 20:62123122-62123144 TGGCACCTGCAGAGGTGGGCTGG - Intronic
1176020935 20:62962042-62962064 CCTCAGCAGCAGATGGGGGCTGG + Intronic
1176185914 20:63778973-63778995 CCTGACCTGCAGATGGCGGCAGG + Intronic
1176218816 20:63960453-63960475 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1176218868 20:63960665-63960687 AGGCACCTGCAGCAGGGGGCTGG + Intronic
1176218914 20:63960875-63960897 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1176218924 20:63960919-63960941 AAGCACCTGCAGCAGGGGGCTGG + Intronic
1176337745 21:5614735-5614757 TCCCACCTGCAGAAAGCGACAGG - Intergenic
1176339153 21:5677808-5677830 TCCCACCTGCAGAAAGCGACAGG - Intergenic
1176363271 21:6016524-6016546 CCTCACCTGCAGAGTGTGGCTGG - Intergenic
1176471407 21:7109961-7109983 TCCCACCTGCAGAAAGCGACAGG - Intergenic
1176494968 21:7491739-7491761 TCCCACCTGCAGAAAGCGACAGG - Intergenic
1176505674 21:7646648-7646670 TCCCACCTGCAGAAAGCGACAGG + Intergenic
1176977123 21:15334876-15334898 ACACACCTGTAGGAGGGGGCTGG + Intergenic
1177650106 21:23949362-23949384 TCTCATCTGCAGAATGGGCATGG + Intergenic
1178130029 21:29561869-29561891 ACTCACCAGCAGAAGAGGGCTGG + Intronic
1178977699 21:37233720-37233742 TCCCACCTGTAGCAGGGAGCAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179760247 21:43522021-43522043 CCTCACCTGCAGAGTGTGGCTGG + Intergenic
1180988034 22:19917159-19917181 AGCCACCTGCAGAAGGAGGCTGG - Intronic
1181549124 22:23626674-23626696 CCTCACCTGCAGTAGGAGGCTGG - Intronic
1181799541 22:25335489-25335511 CCTCACCTGCAGTAGGAGGCTGG + Intergenic
1183176106 22:36225846-36225868 CATCAGCTGTAGAAGGGGGCTGG - Intergenic
1183697553 22:39431711-39431733 TCTCACCTGCAGAACAGAGATGG - Exonic
1184032391 22:41902736-41902758 TCTCACCTGCAGAATGGGGAGGG + Intronic
1184286322 22:43473694-43473716 TCTCAGATGGAGTAGGGGGCAGG + Intronic
1184358610 22:43999522-43999544 TCCTACCTGCAGCAGGAGGCTGG + Exonic
1185101240 22:48842001-48842023 TCTCACGTGGAGACGGGCGCAGG - Intronic
949894611 3:8759969-8759991 TCTCACCTGGAGGAGGCGGGAGG - Intronic
954375091 3:50189891-50189913 TCTAATCTGCAGAAGTGGCCAGG - Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955146555 3:56325788-56325810 TCTCATCTGTAGAAAGGGGATGG - Intronic
956499590 3:69868266-69868288 TCTCAGCTGCAAAATGGGGGTGG - Intronic
956754171 3:72368877-72368899 TCCCAACTGCAGAAGAGGGAAGG - Intergenic
958182974 3:90083810-90083832 TCTCAGCTGAATAAGGGGACTGG - Intergenic
958455433 3:94325344-94325366 TCTCACCTGCAAAATGGAGATGG + Intergenic
959863737 3:111243137-111243159 CCTCACCTGGAGATGGGAGCAGG + Intronic
961394843 3:126579379-126579401 TCTGGCCTGCAGAAAGGAGCAGG - Intronic
962279383 3:134038746-134038768 TCTCACCTGGGAAAGGGAGCGGG + Intronic
963003012 3:140700812-140700834 TCTGACATGCAGAAGGGCCCAGG + Intronic
963048868 3:141125335-141125357 GCTCACCAGCACAAGGTGGCAGG + Intronic
965603108 3:170473858-170473880 TCTCATCTGCAAAACGGGGTTGG + Intronic
967129259 3:186455436-186455458 TCTCACCTGCAAAAGAAAGCGGG - Intergenic
968176812 3:196557642-196557664 TTTCAGATGCAGAAAGGGGCAGG + Intronic
968609093 4:1549066-1549088 TCTCACCCGCAGAGCGGGGAGGG - Intergenic
968613790 4:1568486-1568508 TCTCAGCTGGAGAATGGGGCAGG + Intergenic
968733333 4:2282154-2282176 TGGCAGCTGCAGAAGGTGGCTGG - Intronic
968876312 4:3269597-3269619 TCTCACCTGCGAAAGGGGAGCGG + Intronic
968927842 4:3559209-3559231 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
969319342 4:6402422-6402444 TCTCACCTGCAAAATGGGCATGG + Intronic
969540196 4:7784019-7784041 TCCCACCTGAAGAAGGGCTCAGG + Intronic
969571338 4:8010424-8010446 TCTTACCTGCAGCGGGCGGCGGG + Intronic
969704391 4:8784069-8784091 TCTCAACTGGAAAAGGGGGCAGG - Intergenic
972642208 4:40935313-40935335 TATCACCTGAAGACGAGGGCAGG + Intronic
973981425 4:56311281-56311303 TTTCATCTGCACAAGGGGCCAGG + Intronic
977722361 4:100254449-100254471 TGACACCTGCAGAAGGAGGAAGG + Intergenic
980292118 4:130857135-130857157 GCTCACCTGACGAAGTGGGCTGG - Intergenic
982874863 4:160634634-160634656 TCTCGACTGCAGAAGGAGGTGGG + Intergenic
983631304 4:169852362-169852384 CCACACCAGCAGAAGGGGCCAGG + Intergenic
984605008 4:181775109-181775131 TGTCAACTGCAGAAAGAGGCCGG + Intergenic
984914309 4:184707370-184707392 TCTCAGTTGCTGCAGGGGGCAGG - Intronic
985999755 5:3621089-3621111 TCTCTGCTGCAGAAAGGGGAGGG - Intergenic
991977070 5:72193921-72193943 TCTGTCCTGAAGAAGGGGACTGG + Exonic
994449969 5:99929536-99929558 TCTCCTGGGCAGAAGGGGGCAGG - Intergenic
997871995 5:137514503-137514525 TGACACCTGGGGAAGGGGGCTGG - Intronic
997934098 5:138095788-138095810 TCTCACGTGCTGATAGGGGCAGG - Intergenic
998349456 5:141491474-141491496 GCTCACCTGCAGGTTGGGGCTGG - Exonic
1001232557 5:170001196-170001218 TCTGCCCTGCAGAGGAGGGCAGG + Intronic
1003324405 6:5081888-5081910 ACTGACCTCCAGAAAGGGGCAGG + Intergenic
1003328806 6:5112582-5112604 TCTCACCCGCACAAGGTGCCTGG - Intronic
1003849734 6:10209441-10209463 TCTCACCTGTAAAATGGGGCTGG - Intronic
1006131857 6:31874454-31874476 TCTCACCTGGAGCAGAGGGGAGG + Exonic
1006225853 6:32535530-32535552 TCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1006387313 6:33738575-33738597 TCTCATCTGTAAAACGGGGCTGG - Intronic
1007072745 6:39048902-39048924 TCTCACCTGGGGGCGGGGGCCGG - Exonic
1007107959 6:39296272-39296294 CCTCACCTGTAAAAGGGGGCTGG - Intergenic
1011370574 6:86633183-86633205 ACTCACCTGTAGGAGGTGGCTGG + Intergenic
1013698420 6:112731756-112731778 TCTCACCAGCACAAGGGAGGTGG + Intergenic
1015234620 6:130956323-130956345 TTTCAGCTGCAGGAGGTGGCTGG + Exonic
1016003581 6:139067077-139067099 TCTCACCAGGAGATGGAGGCAGG - Intergenic
1019081065 6:169430058-169430080 TCTGAGCTGCAGAAGGGCACAGG + Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019292997 7:259317-259339 TCTCACCTGCACAAGGGATGAGG - Intronic
1019488835 7:1301661-1301683 TCCCACCAGCAGACGGGAGCTGG - Intergenic
1019561405 7:1660510-1660532 TGTCACCTGTAAAAGGGGGAAGG + Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1019736424 7:2652226-2652248 TCTCACCTGCTGGAAGGGGTTGG - Exonic
1023056121 7:36291433-36291455 TCGTACCTGCAGAAGGGAGATGG + Intronic
1023255436 7:38308123-38308145 TCTCACCTGGAAAAGTGGACAGG - Intergenic
1025020779 7:55477520-55477542 CCTCACCTGCAGCAGGGGGTTGG - Intronic
1025750431 7:64289205-64289227 TCACACCTGCAGAAAGGTCCAGG + Intergenic
1027250844 7:76397827-76397849 CCTCACCTGGGGATGGGGGCGGG + Exonic
1028367534 7:90050993-90051015 TCTCAACTTCAGATGGGGGAGGG + Intergenic
1028639911 7:93030163-93030185 TATCAGCTGCAGCAGGGTGCTGG - Intergenic
1028674411 7:93442455-93442477 TGTAAACTGCAGAAAGGGGCTGG - Intronic
1029595093 7:101533469-101533491 TCCCACCTCCAGAATGGGGCTGG + Intronic
1029662850 7:101974690-101974712 TATCAGCTGAGGAAGGGGGCGGG + Intronic
1030086062 7:105816690-105816712 TCTCACCTCCAGCTGGGAGCTGG + Intronic
1032468934 7:132164278-132164300 TCTCACCTCCAGGAGTGTGCTGG - Exonic
1033245403 7:139713247-139713269 TCTCACCCACAGAGGGGGGCAGG + Intronic
1037841788 8:22250211-22250233 TCTTACCTGCAGGAAGGAGCAGG - Exonic
1037889304 8:22615074-22615096 GCTAACCAGCAGAAAGGGGCAGG - Intronic
1037917592 8:22781860-22781882 TGTCACCTGCAGAAGATGCCTGG - Intronic
1038021535 8:23555368-23555390 TCCAACCTGGAGAAGGTGGCTGG - Intronic
1039240278 8:35548657-35548679 TCTCACCAGCGGAAGGTTGCTGG + Intronic
1043301823 8:78744001-78744023 ACGCACCTGCAGGAGGTGGCTGG + Intronic
1043396560 8:79843050-79843072 ACACACCTGCAGGAGGTGGCTGG - Intergenic
1043525694 8:81094285-81094307 TCACACATTCAGATGGGGGCAGG + Intronic
1045321135 8:101081985-101082007 CCTCTCCTGCAGAAGTGGGTAGG - Intergenic
1045417149 8:101978690-101978712 TCTAACATGCATGAGGGGGCAGG + Intronic
1048342089 8:133548039-133548061 TGGCACCTGCTGATGGGGGCAGG + Intronic
1049196746 8:141320051-141320073 GGTCACTTGAAGAAGGGGGCAGG + Intergenic
1049221527 8:141430853-141430875 TCTCACCTGCCCCAGGGAGCTGG - Intronic
1049223764 8:141440048-141440070 CCTCATCTGTAGAATGGGGCAGG - Intergenic
1049277617 8:141727819-141727841 TGTCAGCAGCAGAAAGGGGCCGG + Intergenic
1049731712 8:144181574-144181596 TCTCACCTGTGGATGAGGGCAGG + Intronic
1050388107 9:5111539-5111561 TCTGCCATGTAGAAGGGGGCGGG - Intronic
1051118800 9:13729149-13729171 TCTCACATGCACAAGGGGAGAGG - Intergenic
1053802693 9:41774290-41774312 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054190999 9:61985636-61985658 CCTCACCAGAAGAAGGGGGAGGG + Intergenic
1054462292 9:65471930-65471952 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1054647370 9:67602081-67602103 CCTCACCAGAAGAAGGGGGAGGG - Intergenic
1055530292 9:77177288-77177310 GCTGATCTGCAGGAGGGGGCGGG + Intergenic
1056718777 9:89055686-89055708 TCTCCCAAGCAGGAGGGGGCTGG + Intronic
1059467356 9:114477508-114477530 TCTAACTTGCAGAAGGGGGCAGG - Intronic
1060173325 9:121479279-121479301 TCCCTTCTGCAGAAGGAGGCAGG + Intergenic
1060895694 9:127215741-127215763 CCTCAGCAGCAGATGGGGGCGGG + Intronic
1061817904 9:133207326-133207348 TGTCATCTACAGATGGGGGCAGG - Exonic
1062242495 9:135547859-135547881 TGTCATCTACAGATGGGGGCAGG + Exonic
1062360765 9:136186875-136186897 TCTCACCTGCAGTGTGGGGTCGG - Intergenic
1062426828 9:136510005-136510027 CCACACCTGCGGGAGGGGGCCGG + Intronic
1062569768 9:137179695-137179717 ACAGACCTGGAGAAGGGGGCAGG + Intronic
1203423921 Un_GL000195v1:20181-20203 TCCCACCTGCAGAAAGCGACAGG + Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186617577 X:11205351-11205373 TTACAACTGGAGAAGGGGGCAGG - Intronic
1189236283 X:39489661-39489683 ACTCACCTGATGAAGGAGGCAGG + Intergenic
1190843665 X:54170472-54170494 TTTCATCTGCAGAAATGGGCTGG - Intronic
1191763788 X:64673538-64673560 TGTCACTTGCAGAATGGAGCTGG + Intergenic
1192948463 X:75990590-75990612 ACTCACCTGCAGCAGTGTGCAGG + Intergenic
1193642975 X:84034495-84034517 TCTCTCATGCAGAAGGGAGTTGG - Intergenic
1193799156 X:85914313-85914335 TCTTACCTGCAGGATTGGGCCGG + Intronic
1198420651 X:136468315-136468337 TCTCACCTGTAAAATGGGGATGG - Intergenic