ID: 1086460781

View in Genome Browser
Species Human (GRCh38)
Location 11:87003556-87003578
Sequence CTTTGAAAGGCCAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126144
Summary {0: 6, 1: 208, 2: 3703, 3: 32368, 4: 89859}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086460781_1086460785 -8 Left 1086460781 11:87003556-87003578 CCTTCCACCTTGGCCTTTCAAAG 0: 6
1: 208
2: 3703
3: 32368
4: 89859
Right 1086460785 11:87003571-87003593 TTTCAAAGTACTGAGATTACAGG 0: 4
1: 167
2: 3921
3: 53162
4: 354773

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086460781 Original CRISPR CTTTGAAAGGCCAAGGTGGA AGG (reversed) Intergenic
Too many off-targets to display for this crispr