ID: 1086461469

View in Genome Browser
Species Human (GRCh38)
Location 11:87009897-87009919
Sequence TGTGATTCATTGGGAAAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086461466_1086461469 4 Left 1086461466 11:87009870-87009892 CCAAGTAAGAAAATTGAGAAGAG No data
Right 1086461469 11:87009897-87009919 TGTGATTCATTGGGAAAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086461469 Original CRISPR TGTGATTCATTGGGAAAATC AGG Intergenic
No off target data available for this crispr