ID: 1086464197

View in Genome Browser
Species Human (GRCh38)
Location 11:87037247-87037269
Sequence CTGTAGACAGGATTGCTCCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086464193_1086464197 23 Left 1086464193 11:87037201-87037223 CCTCTACTGTGTGTGCTGTTTGG No data
Right 1086464197 11:87037247-87037269 CTGTAGACAGGATTGCTCCGTGG No data
1086464192_1086464197 26 Left 1086464192 11:87037198-87037220 CCGCCTCTACTGTGTGTGCTGTT No data
Right 1086464197 11:87037247-87037269 CTGTAGACAGGATTGCTCCGTGG No data
1086464195_1086464197 -10 Left 1086464195 11:87037234-87037256 CCTATCAAAGATGCTGTAGACAG No data
Right 1086464197 11:87037247-87037269 CTGTAGACAGGATTGCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086464197 Original CRISPR CTGTAGACAGGATTGCTCCG TGG Intergenic
No off target data available for this crispr