ID: 1086464458

View in Genome Browser
Species Human (GRCh38)
Location 11:87038371-87038393
Sequence CCTGCAAGGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1285
Summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 1169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086464458 Original CRISPR CCTGCAAGGGAGAAGGAGGA GGG Intronic
900096945 1:943676-943698 CCTGGAAGGGGGAGGGAGGGAGG - Exonic
900658611 1:3772308-3772330 CCAGCAGGGGTGAAGGAGGTCGG + Intergenic
900708200 1:4093921-4093943 GCTGGAAAGAAGAAGGAGGAGGG - Intergenic
900720166 1:4170849-4170871 CCAGGAAGGGACAAGGAGGCAGG - Intergenic
900735989 1:4299876-4299898 TCTGGAAGAGGGAAGGAGGAAGG - Intergenic
900749185 1:4383607-4383629 CCAGCAAGGTAGAATGAGGGAGG - Intergenic
900762790 1:4484013-4484035 GATGCAAGGGTGAAGGAGGGAGG + Intergenic
901198810 1:7455191-7455213 CCTGCACTAGAGAAGCAGGAGGG - Intronic
901478755 1:9509412-9509434 CCAGCACGGGAGAAAGATGAAGG - Intergenic
901631168 1:10648894-10648916 GCTGCATGTGTGAAGGAGGATGG + Intronic
901920467 1:12532651-12532673 CCAGCACGGGAGAAAGATGAAGG + Intergenic
901927984 1:12579073-12579095 CCTGCGAGGGAGAGGGCCGAGGG + Intronic
902206420 1:14871393-14871415 GCAGCAAGGGAGCTGGAGGATGG + Intronic
902399651 1:16150963-16150985 ACTGAAAGGGAGAAGGGAGAGGG + Exonic
902781993 1:18710994-18711016 CCAGGAAGGGAGGAGAAGGAAGG - Intronic
903315093 1:22497066-22497088 CCAGCATGGGAGAAAGATGAAGG + Intronic
903359648 1:22768868-22768890 ACAGCAAGGCAAAAGGAGGAGGG - Intronic
903360576 1:22774431-22774453 GCTGCCAGGAAGAAGGAAGAAGG + Intronic
903576494 1:24342672-24342694 CCTGCAGGGGAGAAGGAGAGAGG - Exonic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
903957644 1:27036155-27036177 TCTGCCAGGGAGTAGGAAGAGGG - Intergenic
904130564 1:28272559-28272581 CCTGGAAGGGACAAGGGGGGAGG - Exonic
904467041 1:30714327-30714349 TCTGCAGGGGACAAGGAGGAGGG + Exonic
904943006 1:34177840-34177862 CCAGAAAGAGAGGAGGAGGATGG + Exonic
905284207 1:36868733-36868755 TCACCAAGGGAGAAAGAGGAAGG - Intronic
905456602 1:38092427-38092449 CCTGTCAAGGAGAAGGAAGAAGG - Intergenic
905508941 1:38503204-38503226 CCTACAAGGGAGGAGGCAGAAGG - Intergenic
905659969 1:39714325-39714347 ACTGCAAGGCTGAAGGAGGAAGG + Intronic
905675511 1:39821976-39821998 CCAGCAAGTGAGGAGCAGGACGG + Intergenic
905764982 1:40592871-40592893 CCAGCATGGGAGAAAGATGAAGG - Intergenic
905811630 1:40917375-40917397 CGTACAAGGGGGCAGGAGGAGGG - Intergenic
905828837 1:41048021-41048043 CCTGCTAGGGAGGAGGGGCAGGG + Intronic
906214935 1:44033213-44033235 GCTGGAAGGGAGAAGGAGGGAGG - Intergenic
906363179 1:45181466-45181488 CCTGAAAGGGACAGGGAGAATGG + Intronic
906397092 1:45475826-45475848 CCAGCATGGGAGAAAGATGAAGG - Intronic
906635748 1:47409374-47409396 CCTGGAAATGAGAAGCAGGAAGG + Intergenic
906744749 1:48213834-48213856 CCTATAAGGGTGAAGGAGAAGGG + Intergenic
906826095 1:48982132-48982154 AGTACAAGGGAGAAGGAGTAAGG + Intronic
906901816 1:49843920-49843942 CCTGCCAGGAAGCAGGAGGAAGG + Intronic
907267746 1:53272970-53272992 CCTGAAAGGGGGAAGGGGAAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907489138 1:54797928-54797950 CCAGGAAAGGAGGAGGAGGAGGG - Intronic
907571926 1:55491665-55491687 CCAGCATGGGAGAAAGATGAAGG + Intergenic
907597678 1:55734710-55734732 CCAGCATGGGAGAAAGAGGTAGG - Intergenic
907611027 1:55871329-55871351 CCAGCACGGGAGAAAGATGAAGG - Intergenic
907780879 1:57564806-57564828 CCTGAAAGTGACAAGGAGAATGG + Intronic
907864332 1:58384807-58384829 CCAGCATGGGAGAAAGATGAAGG + Intronic
908452493 1:64269704-64269726 CCTGTAAGGGAGCAGCAGGGAGG - Intergenic
908671831 1:66556534-66556556 CTTGCAATGGAGCTGGAGGAGGG + Intronic
909190132 1:72540403-72540425 CCAGCAAGGGAGAAAGGTGAAGG + Intergenic
909592934 1:77371863-77371885 CCATCATGGGAGAAGGAAGAGGG + Intronic
910443962 1:87281950-87281972 CCAGCATGGGAGAAAGATGAAGG - Intergenic
910465273 1:87492596-87492618 CATGGAAGCCAGAAGGAGGATGG + Intergenic
910508476 1:87977314-87977336 GCTGCCAGGGGAAAGGAGGATGG - Intergenic
911191831 1:94956070-94956092 CCTCCAAGGGAGAAGCAGCAAGG + Intergenic
911291857 1:96066054-96066076 CCAGCATGGGAGAAAGATGAAGG - Intergenic
911680557 1:100710635-100710657 CCTGCAAAGCAGAAGAAGGCAGG - Intergenic
911725890 1:101240238-101240260 GCTGCAAGCCAGAGGGAGGAAGG + Exonic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912248568 1:107987664-107987686 CCAGCAAGGGAGAAAGATGAAGG + Intergenic
912510533 1:110186911-110186933 CCAGAAAGTGAGTAGGAGGAAGG + Intronic
912705494 1:111908829-111908851 TGTGAAAGGGAGAAGGAGGGGGG + Intronic
913172464 1:116245121-116245143 CTTGCATGGGTGAAAGAGGACGG - Intergenic
913323711 1:117607775-117607797 CCTGCAGTGGAAAAGGGGGAGGG + Intronic
913575944 1:120175174-120175196 ACTGCTAAGGAGAAGGAAGAGGG - Intronic
914339165 1:146743573-146743595 GCTGCAATGGAGATGGAGAAAGG - Intergenic
914360099 1:146927668-146927690 CATGGAAGCCAGAAGGAGGATGG + Intergenic
914493648 1:148172228-148172250 CATGGAAGCCAGAAGGAGGATGG - Intergenic
914558258 1:148790745-148790767 ACTGCTAAGGAGAAGGAAGAGGG - Intergenic
914614577 1:149339485-149339507 ACTGCTAAGGAGAAGGAAGAGGG + Intergenic
914726562 1:150332622-150332644 CCTGAATGGGAGAAGTAAGAAGG + Intronic
914908785 1:151768243-151768265 CCTGGATGGGAGAATGGGGAGGG + Intronic
915274014 1:154775717-154775739 GCTGCACTGGGGAAGGAGGAGGG - Intronic
915317345 1:155036535-155036557 CCTGCAATGGAGAAGGGGCGTGG + Intronic
915326323 1:155082817-155082839 ACTGCTAGGGAGAAGGAGGGAGG + Intronic
915502688 1:156330226-156330248 CCTGGAAGGATGAAAGAGGAGGG - Intronic
915886930 1:159731964-159731986 CCTGAAAGTGAAAAGGAGAATGG + Intergenic
916142231 1:161710005-161710027 CCTGCAAGGGGGAGGAAGAAAGG + Intronic
916335528 1:163666792-163666814 GCAGCCAGGTAGAAGGAGGAAGG - Intergenic
916639473 1:166711642-166711664 CCTGCAAGGGGAATGGAGGAAGG - Intergenic
916738719 1:167630221-167630243 CCTGCGCGAGAGAACGAGGAAGG - Exonic
916919563 1:169449692-169449714 CCAGCATGGGAGAAAGATGAAGG + Intronic
917005116 1:170406502-170406524 CCTGCATGGGAGAAAGACGTAGG - Intergenic
917288497 1:173446699-173446721 CCAGCAGGGGAGAAAGATGAAGG - Intergenic
917307094 1:173638180-173638202 ACCGAAAGGGAAAAGGAGGAAGG + Intronic
917391674 1:174544204-174544226 CCTGAAAGTGACAAGGAGAATGG - Intronic
917427285 1:174928083-174928105 CCTGCAAGGCTGGAGAAGGAAGG - Intronic
918236308 1:182583696-182583718 CCAGCACGGGAGAAAGATGAAGG - Intronic
918407040 1:184221804-184221826 CCAGCACGGGAGAAAGAAGATGG - Intergenic
918414180 1:184289745-184289767 CCAGCATGGGAGAAAGAGGTAGG - Intergenic
918469545 1:184857300-184857322 ACAGCAAAGGAGAAGAAGGAAGG - Intronic
918714889 1:187773233-187773255 CCAGCATGGGAGAAAGATGAAGG + Intergenic
919125109 1:193383694-193383716 CCAGCATGGGAGAAAGATGAAGG + Intergenic
919785442 1:201255259-201255281 CCCGCAGGGGCGGAGGAGGAGGG - Intergenic
919829857 1:201532722-201532744 CCTGCAAGGGAGAAAGAATGGGG - Intergenic
920226603 1:204443597-204443619 CCTGCAAGGCAGAGGGAGTCAGG + Exonic
921410764 1:214834466-214834488 CCAGCACGGGAGAAAGAGGTAGG + Intergenic
921579151 1:216874857-216874879 CCAGCATGGGAGAAAGATGAAGG - Intronic
921826973 1:219683015-219683037 TCTGCAAGTAGGAAGGAGGAAGG + Intergenic
922049772 1:221977940-221977962 CCAGTAAGGGTGAAGGAGAATGG + Intergenic
922388067 1:225108151-225108173 CCAGCAAGGGAGAAAGATAAAGG - Intronic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
922538446 1:226400984-226401006 GCAGCAAGAGAGAGGGAGGAAGG - Intronic
922581261 1:226699976-226699998 CCAGCAAGGGAGAAAGATGTAGG + Intronic
922651403 1:227342162-227342184 CCAGCATGGGAGAAAGATGAAGG + Intergenic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922880900 1:228979582-228979604 CCTGCAGGGGAAGTGGAGGAAGG + Intergenic
923195357 1:231661350-231661372 CCTGAAAGGGACAGGGAGAATGG - Intronic
923405572 1:233655690-233655712 CTCACAAGGCAGAAGGAGGAAGG - Intronic
923777870 1:236996133-236996155 CCAGCAAGGAAGCAGGAGGGAGG + Intergenic
923825413 1:237494370-237494392 CCAGCACGGGAGAAAGATGAAGG + Intronic
923907371 1:238400203-238400225 CCAGCACGGGAGAAAGATGAAGG + Intergenic
924469505 1:244328906-244328928 CCTATAATGGAAAAGGAGGAAGG - Intergenic
924502178 1:244647996-244648018 ACTGGAAGGCAGGAGGAGGAGGG + Intergenic
1062869227 10:885108-885130 GCTTCAAGGGAGAAGGGGCAAGG - Intronic
1063071357 10:2669700-2669722 CAAGCAAGAGAGAAAGAGGAAGG + Intergenic
1063382450 10:5594341-5594363 TCTGCAAGGCAGAGGGAGGGAGG - Intergenic
1063582465 10:7321094-7321116 TCTGCAAGGGAAGAGGAGGAAGG + Intronic
1063721679 10:8588658-8588680 CCGGCAAAGGAGAAAGAGGCAGG + Intergenic
1063878931 10:10510893-10510915 GCTTGAAGGGAGAAGGAGCAAGG + Intergenic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064593505 10:16919716-16919738 CCTGCAAGGGACACTGAGGGTGG - Intronic
1064664006 10:17631476-17631498 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065117827 10:22499279-22499301 CCTTCAAGGAGGAAGGAGGTTGG - Intergenic
1065226849 10:23552332-23552354 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1065907806 10:30273643-30273665 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1066074601 10:31860496-31860518 CCTGCAAGAGGTATGGAGGAAGG + Intronic
1066752122 10:38668689-38668711 CCAGCATGGGAGAAAGATGAGGG + Intergenic
1066964911 10:42254364-42254386 CCAGCATGGGAGAAAGATGAGGG - Intergenic
1067010446 10:42707571-42707593 CCTGCAAGGGACGTTGAGGATGG - Intergenic
1067270994 10:44791220-44791242 AGAGCAAGGGGGAAGGAGGAGGG - Intergenic
1067282904 10:44886402-44886424 CCTGCAGGAGAGAAGGGGGAGGG - Intergenic
1068359795 10:55962518-55962540 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1069168880 10:65200123-65200145 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1069360308 10:67633862-67633884 CCTGAAAGAGACAGGGAGGATGG + Intronic
1069709744 10:70480592-70480614 CCTGCCAGGGACAATGAGGGAGG - Intronic
1069957655 10:72061686-72061708 CCAGCAAGGGGGATGGAGGCAGG + Exonic
1070026548 10:72637499-72637521 TATGAAAGGGAGAAGGAAGACGG + Intergenic
1070284026 10:75070765-75070787 CATGCAAGAGAGTAGGAGAAAGG + Intergenic
1070319118 10:75341846-75341868 CCTGGGTGGGAGCAGGAGGAGGG - Intergenic
1070407737 10:76112120-76112142 CGAGCAAGGGAGCAGGAGGAGGG + Intronic
1070520025 10:77244507-77244529 TGTGGAAGGGAGAAGGAGGAAGG + Intronic
1070523767 10:77277164-77277186 CCTTCAAGGGAGGAGAAGAAGGG + Intronic
1070612561 10:77943641-77943663 CCTGTAAGAGAGATGGAGGGAGG - Intergenic
1071268262 10:83983614-83983636 GCTGGAATGGAGAAGGAGGAGGG - Intergenic
1071373103 10:84973475-84973497 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1071519646 10:86321524-86321546 CTTGCAAGGCAGAAGGTTGATGG + Intronic
1072045043 10:91645693-91645715 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1073096729 10:100984472-100984494 CCTGCCTGGGAGAAAGAGAAAGG - Exonic
1073193124 10:101666443-101666465 TGTGGAAGGGAGTAGGAGGAGGG + Intronic
1073280815 10:102352673-102352695 TGAGCAAGGGAGAAGGAGGAGGG + Intronic
1073417055 10:103392929-103392951 CCTCCATGGGAGAAGGGAGAAGG + Intronic
1073431587 10:103490950-103490972 CCTGGAAGGGAAGAGGAAGAAGG - Intergenic
1073512353 10:104050691-104050713 CCTACAAGGGACAACCAGGAAGG + Intronic
1073733201 10:106315641-106315663 CTTCCCAGGGAGAGGGAGGACGG + Intergenic
1074283569 10:112076816-112076838 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075420989 10:122300023-122300045 TCTGTAAGGGAGAAGGAGCCTGG - Intronic
1075904131 10:126065848-126065870 CCTGGAAGGGAGTCGGGGGAAGG - Intronic
1075973598 10:126675385-126675407 CCTTCATGGGAGAAGGGGTATGG + Intergenic
1076425450 10:130364277-130364299 CCTGCTCTGGAGAAGGAGCAAGG - Intergenic
1076931954 10:133537309-133537331 CCTGCCAGGGAGCAGGATGGGGG + Intronic
1077414812 11:2420119-2420141 ACCGCCAGGGAGAAGGGGGAGGG - Intronic
1077531199 11:3096090-3096112 TCTGCAAGGGAAAAACAGGAGGG + Intronic
1078008498 11:7550865-7550887 CCAGCACGGGAGAAGGATGTAGG - Intronic
1078030931 11:7750258-7750280 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1078067771 11:8089461-8089483 CCCACATGGTAGAAGGAGGAAGG - Intronic
1078169489 11:8918391-8918413 TCTGCAAGGTAGGAGGAAGAGGG + Intronic
1078223796 11:9373893-9373915 GCTGCACGGGAGAATGAGGCAGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078757769 11:14227505-14227527 CCTGACAGAGAGCAGGAGGAGGG - Intronic
1078883286 11:15474718-15474740 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1078901519 11:15647074-15647096 CCTGTAAGGGAAAAGGATCATGG + Intergenic
1078925205 11:15868601-15868623 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1078938178 11:15971193-15971215 ACTGTAAGGGAGGAGAAGGAGGG - Exonic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079762058 11:24341285-24341307 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1080239649 11:30112065-30112087 CCTGGAAGGGGAAGGGAGGAGGG - Intergenic
1080249707 11:30219231-30219253 ACTGGAAGGAAGAAGAAGGAAGG + Intergenic
1080280087 11:30546904-30546926 TCTGCAAGGGATAAAGAGGTAGG - Intronic
1080400036 11:31925818-31925840 CCGCCAAGAGAGAATGAGGAAGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1081166207 11:39811502-39811524 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
1082945240 11:58751159-58751181 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1083516068 11:63260437-63260459 CCTGAAAGAGAAAAGGAGAATGG - Intronic
1083529971 11:63411186-63411208 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1083532013 11:63431820-63431842 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1083683831 11:64364250-64364272 CCAGGTAGGGAGCAGGAGGAAGG + Intronic
1083729144 11:64643538-64643560 GCTGGAAGGGAGAGGGAGGGAGG + Intronic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1084685379 11:70691320-70691342 AAGGCAAGGGAGAATGAGGAGGG + Intronic
1084948742 11:72653148-72653170 CCAGCAAGAGAGAGGGAGGGTGG + Intronic
1085003540 11:73062820-73062842 TCTGAAAGGGACAAGGAGAATGG + Intronic
1085171077 11:74450483-74450505 CCTGCGGGGGAGAATTAGGAGGG + Intergenic
1085309207 11:75506303-75506325 CCAGGGAGGAAGAAGGAGGAGGG + Intronic
1085685213 11:78615412-78615434 CCAGCACAGGAGAAAGAGGAAGG + Intergenic
1086141301 11:83503599-83503621 CCAGCATGGGAGAAGGATGTGGG + Intronic
1086278201 11:85157118-85157140 CCAGCATGGGAGAAGGATGTAGG - Intronic
1086278932 11:85163049-85163071 CCAGCATGGGAGAAGGATGTAGG - Intronic
1086279904 11:85173004-85173026 CCTGAAAGAGACAAGGAGAATGG + Intronic
1086282859 11:85210845-85210867 AATGGAAGGGAGAAGGAAGAAGG - Intronic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086513237 11:87583565-87583587 TGTGCAAGGGAGAAGGAGGAAGG - Intergenic
1086800628 11:91170459-91170481 CCTGAAAGAGATAAGGAGAATGG + Intergenic
1087378092 11:97369024-97369046 CCTGTAAGAGATAAGGAGAAGGG + Intergenic
1087878936 11:103392214-103392236 ACTGCAAGGCAGCAGGAGGCTGG - Intronic
1088205797 11:107390963-107390985 CCAGCATGGGAGAAAGATGAAGG - Intronic
1088212636 11:107473494-107473516 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088681190 11:112243196-112243218 CCTGTCAGGGGGCAGGAGGAGGG + Intronic
1088723199 11:112612447-112612469 CCTGCAAGGAGGGAGGAGGGAGG + Intergenic
1088809517 11:113381747-113381769 CCTAAAAGAGAAAAGGAGGAAGG + Intronic
1089226308 11:116925331-116925353 CTTGCAAGAGGGAAGCAGGAGGG + Intronic
1089271187 11:117302482-117302504 CCTGCAAGTGGAGAGGAGGATGG - Intronic
1089295441 11:117464610-117464632 CGTGCCAGGAAGAAGGAGGAAGG + Intronic
1089512462 11:119008617-119008639 CTTGCAGGTGAGATGGAGGAAGG - Intronic
1089656566 11:119951421-119951443 CCTGCAGGGAAGCAGAAGGAGGG - Intergenic
1090348972 11:126094795-126094817 CCAGCATGGGAGAAGGATGAAGG - Intergenic
1090577585 11:128124066-128124088 TCAGCATGGGAGAAGGATGAAGG + Intergenic
1091118962 11:133040803-133040825 CCAGGATGGGAGAAGGAGAAAGG + Intronic
1091281518 11:134384278-134384300 CCTGCAGCGGGGGAGGAGGAGGG - Intronic
1091584591 12:1808905-1808927 CATGAAAGGGAGAAGGGGGAGGG + Intronic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1091868137 12:3860595-3860617 TCTGAAAGGGAGAAAAAGGAAGG - Intronic
1092134439 12:6136775-6136797 TCAGCAAGGGTGCAGGAGGAAGG - Intergenic
1092155584 12:6279633-6279655 GGTGCAAGGGAGAAGGAAGCAGG + Intergenic
1092192348 12:6530054-6530076 CCAGCTGGGGATAAGGAGGACGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092566605 12:9672670-9672692 CCTGAAAGAGACAGGGAGGATGG - Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1092878884 12:12872450-12872472 GCTGCAAGGGAAATGGAGCAAGG + Intergenic
1093673928 12:21911779-21911801 TATGCAAGGGAGAAGGATGATGG + Intronic
1093968543 12:25352769-25352791 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1094206774 12:27848723-27848745 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1094400496 12:30057103-30057125 CCTCCAAGGTTGAAGGAGAATGG - Intergenic
1095502974 12:42860695-42860717 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1095854960 12:46850079-46850101 CCTGCAAGTGACGAGGAGAATGG + Intergenic
1096249433 12:50019179-50019201 CCTGCAAGTGATAAGGGGGTGGG - Intronic
1096553216 12:52387960-52387982 CCAGCATGGGAGCAGCAGGATGG - Intergenic
1096565277 12:52473111-52473133 CCTGCTAGGGAGACCTAGGAGGG - Intronic
1096567297 12:52492562-52492584 CCTGCCAGGGAGACCTAGGAGGG - Intronic
1096604526 12:52755097-52755119 ACTGCAGGGGAGAGGCAGGAAGG - Intergenic
1096694203 12:53338515-53338537 ACTGAAGGGGAAAAGGAGGAAGG + Intronic
1096806270 12:54143041-54143063 CAAGGAAGGAAGAAGGAGGATGG + Intergenic
1097240610 12:57572526-57572548 TGGGCAAGGGAGCAGGAGGATGG + Intronic
1097249889 12:57626687-57626709 CCTGGCAGGGACAAGGAGGCAGG + Exonic
1097340083 12:58427398-58427420 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1097417250 12:59327922-59327944 CCGCCAAGGGTGAAGGAGAAGGG + Intergenic
1097718904 12:62999334-62999356 GGTGAAAGAGAGAAGGAGGAGGG + Intergenic
1097736389 12:63186263-63186285 ACTGGAAAGGAGATGGAGGATGG + Intergenic
1098060038 12:66552190-66552212 CCTGAAAGGGAAATGGAGAAAGG + Intronic
1098348588 12:69532503-69532525 CTTGCATGGCAGAAGGTGGAGGG + Intronic
1098737700 12:74127591-74127613 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1098971244 12:76859028-76859050 CCTACAAAGGAAAGGGAGGAAGG + Exonic
1099030992 12:77525296-77525318 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1099375212 12:81890506-81890528 CCGGCATGGGAGAAGGATGTAGG - Intergenic
1099744821 12:86688954-86688976 CCTGAAAGTGACAAGGAGAATGG - Intronic
1099779256 12:87172952-87172974 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1099978180 12:89568480-89568502 CCTGCCAGGGAGGAGGCTGAGGG - Intergenic
1100148168 12:91702532-91702554 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1100677108 12:96879774-96879796 ACTGCACGGGAGAAAGGGGAAGG - Intergenic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101123643 12:101609058-101609080 TCTGAAAAGGAGAAGGAGAAGGG + Intronic
1101408918 12:104453332-104453354 CCTGGGAAAGAGAAGGAGGAAGG - Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101695688 12:107123842-107123864 CCAGCATGGGAGAAGGATGTAGG - Intergenic
1101730640 12:107424396-107424418 TCTCCAAGGGAGAAGGAATATGG - Intronic
1101755022 12:107614586-107614608 TCTGCTAGGTAGAAGGAAGAAGG + Intronic
1102079405 12:110085902-110085924 CCTGAGAGGGAGAAAGTGGAAGG + Intergenic
1102417097 12:112773363-112773385 CCTGTAATGGAAAAGGAGGGGGG - Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1103035992 12:117656751-117656773 CCAGCAAGGGAGAAAGATGTAGG - Intronic
1103148616 12:118617471-118617493 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1103396870 12:120614039-120614061 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1103463492 12:121123523-121123545 CCTGAGAGGGAGAAAGTGGAAGG - Intergenic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1104241565 12:126994699-126994721 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104297669 12:127532140-127532162 TCTGCAAGCAAGGAGGAGGAAGG + Intergenic
1104563492 12:129859693-129859715 CCAGCATGGGAGAAAGATGAAGG - Intronic
1105239214 13:18595557-18595579 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1105289785 13:19045421-19045443 CCAGCATGGGAGAAGGATGAAGG + Intergenic
1105518746 13:21113113-21113135 CCTGCAAAAGAGCAGGAGAAGGG - Intergenic
1105670231 13:22605433-22605455 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
1105712545 13:23026457-23026479 CCTGCATGGCAGGAGCAGGAGGG - Intergenic
1105820634 13:24077906-24077928 CCTGCAAGAGAGAAGGATGTGGG - Intronic
1106423441 13:29603110-29603132 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1106820799 13:33462692-33462714 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1107824917 13:44320119-44320141 GCTGCATGGGAGAATGAGGAGGG - Intergenic
1107996317 13:45864648-45864670 CCTGCAAAGGAAGAGGATGAAGG + Intergenic
1108117607 13:47146615-47146637 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1108346432 13:49551153-49551175 GCAGGGAGGGAGAAGGAGGAAGG + Intronic
1108454528 13:50599575-50599597 TCTGCAAGAGAGAAGGAGGAAGG - Intronic
1109074191 13:57812325-57812347 GGTGAAAGGGAAAAGGAGGATGG + Intergenic
1109415740 13:62037147-62037169 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1109462890 13:62687011-62687033 CCGGCATGGGAGAAAGATGAAGG - Intergenic
1109536108 13:63722013-63722035 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1109539992 13:63764273-63764295 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1109712369 13:66178276-66178298 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1110152291 13:72270095-72270117 CCTGAAAGGGACAGGGAGAATGG - Intergenic
1110825552 13:79967578-79967600 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1111225138 13:85260934-85260956 TCTTAAAGGGAGAAGGAAGAGGG + Intergenic
1111305802 13:86410899-86410921 CCTGAAAGAGAGAGGGAGAATGG + Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112036736 13:95503817-95503839 GCTGCTAGGGAGAAGGGGGAGGG + Intronic
1112203491 13:97301511-97301533 CCATCAAGGGACAAGGAGGAAGG + Intronic
1112206110 13:97324843-97324865 CCTGCATGGGAGAAACATGAAGG + Intronic
1112310128 13:98310842-98310864 TCTGCAAGGGGGCAGGAGGAAGG - Intronic
1112338859 13:98536701-98536723 CCTGCAGGGGACTAGGAGGCCGG - Intronic
1112832506 13:103471066-103471088 CCAGCATGGGAGAAAGAAGAAGG + Intergenic
1112855635 13:103766989-103767011 CCAGCACGGGAGAAAGAGGTAGG + Intergenic
1113367008 13:109685471-109685493 CCAGCAGGGGAGAGGGTGGAAGG + Intergenic
1113538854 13:111091091-111091113 GCTACCAGGGAGAATGAGGAAGG + Intergenic
1113554065 13:111216894-111216916 TCTGAAAGGCAGAAAGAGGAAGG - Intronic
1113883158 13:113640098-113640120 ACTGCAAGGCAGGAGGCGGATGG - Exonic
1113910413 13:113838756-113838778 CCAGCACTGGAGCAGGAGGAAGG + Intronic
1114267130 14:21079433-21079455 CTTCCAAGGGAGAGGGAGGTGGG - Intronic
1114746318 14:25151708-25151730 GCTGCAGGGGAGAAGGAGGAGGG + Intergenic
1115014252 14:28590767-28590789 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1115347986 14:32363599-32363621 CCAGCATGGGAGAAAGATGAAGG + Intronic
1116067418 14:40001768-40001790 CCTGCAAGTGAAATGGATGAGGG + Intergenic
1116122690 14:40741003-40741025 CCCGCATGGGAGAAAGATGAAGG + Intergenic
1116221462 14:42094159-42094181 CCAGCAAGGGAGAAAAATGAAGG - Intergenic
1116271598 14:42776629-42776651 CCAGGAAGGAAGAAGGAGGATGG - Intergenic
1116428038 14:44813689-44813711 CCTGAGAGGAAGAAAGAGGAGGG + Intergenic
1116478318 14:45367030-45367052 TCTTCAAGGGAGAAGGGAGAAGG - Intergenic
1116661940 14:47721428-47721450 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1116901437 14:50365849-50365871 CCAGCACGGGAGAAAGATGAAGG - Intronic
1117115252 14:52504102-52504124 CCTGAAAGTGAGGGGGAGGATGG + Intronic
1117341896 14:54798720-54798742 TGTGGAAGGGAGAGGGAGGAGGG + Intergenic
1117453632 14:55876237-55876259 CTTGCAAGGGAGAACGGGGAAGG + Intergenic
1118466366 14:66034758-66034780 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1118746932 14:68781043-68781065 CCAGCAAGGGAGGAGGAAGGAGG - Intergenic
1119038252 14:71248795-71248817 CTTTCAAAGGAGGAGGAGGAGGG - Intergenic
1119109277 14:71956556-71956578 CCAGCAAGGGAGAAAGATGTAGG + Intronic
1119321121 14:73731080-73731102 CCTAGCAGGGAGAAGTAGGAGGG - Intronic
1119474658 14:74920141-74920163 CCAGCCAGGAAGGAGGAGGAAGG + Intronic
1119532810 14:75374778-75374800 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1119534930 14:75395373-75395395 CCTGCACGGGAGTATGAGGTTGG + Intergenic
1119792995 14:77369911-77369933 CCTGTAAGGGAGGCGGAGGCGGG + Intronic
1119934613 14:78580165-78580187 CCTGCCACAGAGAAGGAGCAAGG + Intronic
1120187185 14:81405993-81406015 CCAGCATGGGAGAAAGATGAAGG - Intronic
1120242663 14:81967208-81967230 TCTTCAAGGGAGAAGGATGAGGG - Intergenic
1120404704 14:84080182-84080204 CATGCAAGGAAGTAGGATGATGG - Intergenic
1120560560 14:85987309-85987331 CCAGCAAGGTGGGAGGAGGAGGG - Intergenic
1120565186 14:86046945-86046967 CCTGAAAGTGATAAGGAGAATGG - Intergenic
1120751900 14:88205383-88205405 CATGCAAGGGTGAAGGAACATGG - Intronic
1120822108 14:88921562-88921584 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1120940790 14:89947110-89947132 AGTGCAAAGGAGAAGGAAGATGG + Intronic
1121197107 14:92083921-92083943 CCAGCATGGGAGAAAGATGAAGG - Intronic
1121427918 14:93865938-93865960 CCTGGAAGGGAGATGGAGGCGGG - Intergenic
1121508136 14:94492032-94492054 CCAGCAAAGGAGATTGAGGAGGG + Intronic
1122296061 14:100706310-100706332 CCTGCACAGGAGAAGCAGGGCGG + Intergenic
1122299303 14:100722986-100723008 CCTCCAAGAGAGAAGGAGGGTGG - Intergenic
1122546011 14:102523285-102523307 AGGGGAAGGGAGAAGGAGGAAGG + Intergenic
1122878048 14:104677850-104677872 CCTCCTTGGGAGGAGGAGGAAGG - Intergenic
1122894591 14:104750245-104750267 CCTGCACGGCAGGAGGAGAAAGG + Intergenic
1123492037 15:20788527-20788549 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1123548541 15:21357617-21357639 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1124609425 15:31198161-31198183 TCTACGAGGGAGGAGGAGGAGGG - Intergenic
1124711535 15:32016663-32016685 CCAGCACAGGAGAAGGATGAAGG - Intergenic
1124830954 15:33148686-33148708 CCTGCAAGGCTGAAGGCGCAAGG - Intronic
1125135533 15:36336961-36336983 CCAGCAGGGGAGAAAGAGGTAGG - Intergenic
1125286263 15:38095852-38095874 GATTCAAGGGAGAAGGAGGAAGG - Intergenic
1125492014 15:40155463-40155485 CCTGCAGGTGAGAAGGGGGTGGG - Intergenic
1125500693 15:40238909-40238931 GCTGAAGGGGAGGAGGAGGAAGG - Intronic
1127267428 15:57373637-57373659 CACCCAAGGGAGAAAGAGGAGGG - Intergenic
1127439106 15:58988136-58988158 CCTGGAGGGGAGAAAGAGGAAGG + Intronic
1128708144 15:69852227-69852249 CCTGCAAGGAACAATGAGAAGGG + Intergenic
1128708868 15:69857241-69857263 CCTGCATGGGAAAAGAGGGATGG - Intergenic
1129139320 15:73582860-73582882 CCAGCACGGGAGAAGGATGTAGG - Intronic
1129201403 15:74003577-74003599 TCTGAAAGTGAGAAGGAAGAGGG - Intronic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1129425966 15:75463142-75463164 CCTTGAAGTGAGAATGAGGAAGG - Intergenic
1129504501 15:76070257-76070279 CCAGTTAGGAAGAAGGAGGAAGG + Intronic
1129772491 15:78211734-78211756 CTGGCAAGGTAGAAGGAGTAAGG - Intronic
1129959678 15:79672702-79672724 GCTGCATGGGGGAAGGAAGATGG - Intergenic
1130391439 15:83459129-83459151 CCAGCACGGGAGAAAGATGAAGG + Intronic
1130714155 15:86315101-86315123 CTTGCAATGAACAAGGAGGATGG - Intronic
1130728393 15:86465012-86465034 CCTGAAAGTGACAAGGAGAATGG - Intronic
1130768572 15:86900011-86900033 CCAGCACGGGAGAAAGATGAAGG - Intronic
1131260158 15:90883906-90883928 CCTGCCTGGGGGTAGGAGGATGG + Intronic
1131373298 15:91902556-91902578 CCTACATGGGAGTAGGAGGGAGG + Intronic
1131404157 15:92150173-92150195 CCAGCAAGGGAGAAAGATGTAGG + Intronic
1131600138 15:93838789-93838811 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1131740885 15:95390171-95390193 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1132022368 15:98373653-98373675 CCTGCTAGGGTGAAGGAGTGTGG + Intergenic
1132330695 15:101010428-101010450 CCTGCGATGGAGAAGAAGGAAGG - Exonic
1202956875 15_KI270727v1_random:84848-84870 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1133171645 16:3985757-3985779 ACTGCAAGGGAGGTGGAGGGAGG - Intronic
1133239168 16:4404409-4404431 CCTGCAGGGGAGGAGGTGGGAGG - Intronic
1133694635 16:8250224-8250246 TCTGCAATGCAGAAGGTGGAGGG + Intergenic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1134104315 16:11475086-11475108 GCTGCAAGGGAAAAGGAGCAGGG - Intronic
1134255278 16:12605270-12605292 CCTGCAAGTGACAGGGAGAATGG + Intergenic
1134749179 16:16612293-16612315 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1134821913 16:17253799-17253821 GTTGCAAGGGAGAAGAAGGCAGG - Intronic
1134830434 16:17318468-17318490 CCTGCAGGAGGAAAGGAGGAAGG - Intronic
1134996290 16:18741350-18741372 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1135110509 16:19687225-19687247 CCAGCAATGGAGAAGAGGGAAGG - Intronic
1135222302 16:20623651-20623673 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135313397 16:21422861-21422883 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135366321 16:21855139-21855161 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135445494 16:22516025-22516047 CCTGCATGGGAGACTGTGGAGGG + Intronic
1135518981 16:23158958-23158980 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1135937858 16:26796326-26796348 CCAGCAGGGCAGCAGGAGGAAGG + Intergenic
1135939591 16:26809742-26809764 AATGCAAGGGAGAAGGAGGAAGG + Intergenic
1136011398 16:27365650-27365672 CCTGCAAAGGAGAGGGAGCTGGG + Intergenic
1136134208 16:28244924-28244946 CCTGTAAAGGGGATGGAGGAAGG - Intergenic
1136152544 16:28360581-28360603 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136194205 16:28640601-28640623 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136210538 16:28754700-28754722 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136323508 16:29503366-29503388 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136438193 16:30243335-30243357 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136508696 16:30722762-30722784 CCAGCAAGGGCTAAGTAGGAAGG - Intronic
1136730601 16:32408352-32408374 CCAGCATGGGAGAAAGATGAGGG - Intergenic
1138293864 16:55870337-55870359 AGAGGAAGGGAGAAGGAGGAAGG + Intronic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138451378 16:57095106-57095128 TCTGCAAGGGGGAAGGAGCTGGG - Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1138907064 16:61349636-61349658 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1138955213 16:61963244-61963266 CATGGAAGGGACATGGAGGAAGG - Intronic
1139021319 16:62753403-62753425 CCAGGAAGGGGGAAAGAGGAGGG - Intergenic
1139665043 16:68449080-68449102 CCAGCAAAGGTGAGGGAGGACGG + Intergenic
1139670885 16:68491959-68491981 CCTGCACCGGAGAAGCAAGAGGG - Intergenic
1139804696 16:69554735-69554757 CATGCTAGGCAGGAGGAGGAAGG - Intergenic
1139857747 16:69993965-69993987 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1139962795 16:70727677-70727699 AGTGCAATGGAGAAGCAGGAGGG + Intronic
1139995113 16:70973779-70973801 GCTGCAATGGAGATGGAGAAAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140219978 16:73036633-73036655 CCGGCAGGAGAGAGGGAGGAGGG + Intronic
1140332356 16:74070271-74070293 CCTGCAAGGGATGGGAAGGAAGG + Intergenic
1140480329 16:75258955-75258977 CCTGGGAAGGAGGAGGAGGAGGG + Intronic
1141151141 16:81565427-81565449 CCAGGAGGGGAGCAGGAGGATGG - Intronic
1141249585 16:82343004-82343026 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1141733551 16:85838020-85838042 ACTACCAGGGAGAGGGAGGAGGG + Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141987011 16:87586646-87586668 TCTGCCAGGAGGAAGGAGGATGG + Intergenic
1202995800 16_KI270728v1_random:108963-108985 CCAGCATGGGAGAAAGATGAGGG + Intergenic
1203022487 16_KI270728v1_random:421305-421327 CCAGCATGGGAGAAAGATGAGGG + Intergenic
1142874536 17:2843636-2843658 CCTGCAAGGTAGTGGGAGGCAGG - Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1142986923 17:3700997-3701019 CCTGTGAGGGAGGAGAAGGAGGG - Intergenic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1143120096 17:4600983-4601005 CCTGTAAGGGAGCTGGAGGATGG - Intronic
1143646717 17:8235037-8235059 CCTGCAAGTGAGGAGGCTGAGGG - Exonic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1143997229 17:11017354-11017376 CCTGCAGGGGAGAAACAGAAGGG - Intergenic
1144010738 17:11146401-11146423 CCTGCTAGAGCTAAGGAGGAAGG - Intergenic
1144191804 17:12853236-12853258 CCAGCACGGGAGAAGGATGGAGG + Intronic
1144513392 17:15896961-15896983 CCTGCAAGGGAGAGAGAGCTTGG + Intergenic
1144950660 17:18991908-18991930 CCTGCCAGGGTGTGGGAGGATGG + Intronic
1145218988 17:21073179-21073201 CCAGGAAGAGAGAAGGGGGAAGG + Intergenic
1145986649 17:29051532-29051554 GCTGCAATGGAGAAGGACCACGG + Intronic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1147123499 17:38350603-38350625 GATGCAAGGGAAAAGGAGGAAGG - Intergenic
1147311054 17:39596483-39596505 CCTGAAAGGGAGGATGTGGAGGG - Intergenic
1147316888 17:39625315-39625337 CCTGAAAGGAAGAAGGGGTATGG - Intergenic
1147652808 17:42071892-42071914 CCTGGAAGCCAGAAGGAGGAGGG + Intergenic
1147883643 17:43670050-43670072 GCTGAAAGAGAGAAGGAGGGAGG + Intergenic
1148000658 17:44385335-44385357 CCTGCAGGAGACAAGGAGGAGGG + Exonic
1148119152 17:45197569-45197591 CCTGTAGAGGAGGAGGAGGAGGG + Intergenic
1148645878 17:49219518-49219540 CCTGCGAGGGAGCGGGAGGTAGG - Exonic
1148848657 17:50543488-50543510 CCTGAAAGGGGGATGGAGGCTGG - Exonic
1148966163 17:51437856-51437878 CCTGGGAGGGAGATGGAGAAGGG + Intergenic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149430383 17:56592776-56592798 CCGGCCAAGGAGGAGGAGGATGG + Intergenic
1150484301 17:65533226-65533248 CCTGCAGGGGAGAAGGCAGCGGG + Intronic
1150681687 17:67289800-67289822 CCTGGAAGGGAGCAGCAGGCTGG + Intergenic
1150941860 17:69701468-69701490 CCAGCAAGGGAGAAAGATGAGGG + Intergenic
1151134084 17:71928244-71928266 CCAGCATGGGAGAAAGAGGTGGG - Intergenic
1151184945 17:72357005-72357027 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1151404368 17:73877198-73877220 GCTGCAAGGGAGAGGAAGGCAGG - Intergenic
1151870314 17:76832339-76832361 CCAGCACGGGAGAAAGAAGAAGG + Intergenic
1152005784 17:77679806-77679828 CCTGCAAGGGACATGGCTGATGG - Intergenic
1152033900 17:77859943-77859965 CCAACAAGACAGAAGGAGGAAGG - Intergenic
1152112968 17:78367319-78367341 CCGGCAAGGGGGAGGGAGGAAGG - Intergenic
1152357360 17:79813592-79813614 CCTGCAATGCAGCAGGGGGAGGG - Intergenic
1152418083 17:80175877-80175899 CCTGCCAGGAAGCAGGAGGAGGG - Intronic
1152499319 17:80697533-80697555 CTTGTAAGGGAGGAGGAGGGCGG + Intronic
1152610661 17:81313712-81313734 GCTGCCAGCGAGAGGGAGGAGGG + Exonic
1152812451 17:82388454-82388476 CCATCAAGAGAGAAGGTGGAGGG + Intergenic
1152820550 17:82435667-82435689 CCTGCAAGGAAGGAGCAGGACGG - Exonic
1153333315 18:3896853-3896875 TCTTCAAGGGAGAAGGGGGAAGG - Intronic
1153702789 18:7712902-7712924 CCTGAAAGTGACAAGGAGAATGG + Intronic
1154119191 18:11637218-11637240 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1155512936 18:26595517-26595539 TCTGCCAGCAAGAAGGAGGAAGG - Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155579840 18:27291007-27291029 ACTGCCAGGGAATAGGAGGAGGG + Intergenic
1155933007 18:31726102-31726124 TATGCAAGGGAGCAGCAGGAGGG - Intergenic
1156169864 18:34469676-34469698 CCAGCAAGGGAGAAAGATGAAGG - Intergenic
1156269050 18:35514332-35514354 CATCAAAGGGAGATGGAGGATGG - Intergenic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1156537344 18:37877036-37877058 CCAGCACGGGAAAAGGAGGTAGG - Intergenic
1156604799 18:38653756-38653778 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1157015955 18:43713052-43713074 TCTTCAAGGAAGAAGGAAGAAGG + Intergenic
1157021453 18:43787787-43787809 CCTGCACAGGAGAAAGATGAAGG + Intergenic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157394341 18:47329325-47329347 CCAGCACGGGAGAAAGAGGAAGG + Intergenic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1157654930 18:49375885-49375907 CCAGCATGGGAGAAAGATGAAGG - Intronic
1157786581 18:50488971-50488993 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1158011674 18:52735677-52735699 CCAGCATGGGAGAAGGATGGAGG + Intronic
1158206990 18:55004383-55004405 CCTGCAAGAATAAAGGAGGATGG + Intergenic
1158220937 18:55149986-55150008 TGTGGATGGGAGAAGGAGGAGGG + Intergenic
1158862070 18:61602488-61602510 GCTTCAAGGGAGAAGGGTGAGGG - Intergenic
1159011322 18:63061600-63061622 GCTGCAAAGGAGAATGAGAAGGG - Intergenic
1159136390 18:64341833-64341855 CCAGCAAAGGAGAAAGATGAAGG + Intergenic
1159151597 18:64530100-64530122 CCAGCACGGGAGAAAGACGAAGG + Intergenic
1159177101 18:64851749-64851771 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1159438288 18:68446069-68446091 CCAGCAGGGGAGAAAGATGAAGG - Intergenic
1159455032 18:68650658-68650680 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
1159627698 18:70714011-70714033 CCTGTAAAGGAGATGGAGGGAGG + Intergenic
1159674619 18:71266134-71266156 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1159841032 18:73399239-73399261 ACTACAAGGGAAAAGGATGAAGG + Intergenic
1160231310 18:77051703-77051725 CCTTCCAGGGAGAAGAAGAAAGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160294364 18:77623887-77623909 CGTGGAAGGGGGAAGGGGGAAGG - Intergenic
1160796382 19:947606-947628 CCGTCACGGGAGAATGAGGAGGG + Intronic
1161010377 19:1956973-1956995 CCTGGAAGAGAGAAGGAGGGAGG + Intronic
1161025460 19:2034801-2034823 CCTGCATGGGAGAAGGCGTGAGG - Intronic
1161342441 19:3750708-3750730 CCAGGGAGGGAGAAGGAGGACGG - Exonic
1161362559 19:3859187-3859209 CCAGCATGGGAGAAAGATGAAGG - Intronic
1161377849 19:3949423-3949445 CCTGCAAGGGTCAAGGAGGGAGG - Intergenic
1162017290 19:7852451-7852473 CCTTCGTGGGGGAAGGAGGATGG - Intronic
1162286045 19:9739708-9739730 CCCGCATGGGAGAAAGAGGTAGG + Intergenic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162788605 19:13051654-13051676 CCAAGAAGGGAGGAGGAGGAGGG - Intronic
1162925096 19:13926893-13926915 GCTGCAAGGGAGTAGGGGTAGGG - Intronic
1163324316 19:16593288-16593310 CCAGCAAGGGAGAGGCAGGGAGG + Intronic
1163819377 19:19487397-19487419 CCTGCAAGGCAGGGGGAGGGAGG + Intronic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164032420 19:21419522-21419544 CCAGCACGGGAGAAAGATGAAGG + Intronic
1164459429 19:28434581-28434603 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1164525152 19:29008140-29008162 GCTGCAAGGGAGACTGAGGTGGG - Intergenic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164861661 19:31566537-31566559 CCTGACAGGGGGAAAGAGGAGGG + Intergenic
1165020357 19:32919424-32919446 CCTACAGGTGAGGAGGAGGAAGG + Intronic
1165073604 19:33269110-33269132 CCTGGGAGGGAGCAGGAGGAAGG - Intergenic
1167048998 19:47067485-47067507 CCCCCAACGGAGGAGGAGGAAGG - Exonic
1167168201 19:47813642-47813664 CCCACAAGGGACAACGAGGAGGG - Intronic
1167254405 19:48418651-48418673 CCAGCGAGGGAGAAGGAGGGAGG + Intronic
1167303838 19:48695871-48695893 CCGGCAATGGGGAGGGAGGAGGG + Intergenic
1167621508 19:50563441-50563463 CCAGCAAGGGTGATGGTGGAGGG + Intronic
1167635931 19:50655769-50655791 CCTGCAAGGCAGGAGGAAGCAGG - Intronic
1168238018 19:55075840-55075862 CCTGGGAGGGAGCAGGAGGAGGG + Intronic
1168290236 19:55354063-55354085 CCTCCAGGGGAGAGGGAGGCGGG - Exonic
1168543521 19:57231720-57231742 ACTGAAAGAGAGGAGGAGGAGGG - Exonic
1168647018 19:58065975-58065997 CCTGCCATGAAGGAGGAGGAGGG + Intronic
925234902 2:2269537-2269559 AATGCAAGGCAGAAGTAGGATGG - Intronic
925472506 2:4177362-4177384 CCAGCATGGGAGAAAGATGAAGG - Intergenic
925487611 2:4353326-4353348 CCAGCATGGGAGAAAGATGAAGG - Intergenic
925528894 2:4837816-4837838 CCAGCACGGGAGAAAGATGAAGG + Intergenic
925686941 2:6482486-6482508 CCATCCAGGGAGAAGGAGGTTGG - Intergenic
925827115 2:7860220-7860242 CCTACAAGGGTGGAGGAGAAAGG - Intergenic
925847117 2:8044222-8044244 AGAGGAAGGGAGAAGGAGGAAGG - Intergenic
925898198 2:8489141-8489163 GCTGCATGTGAGAAGGAGGGAGG + Intergenic
926647227 2:15302885-15302907 CCAGCATGGGAGAAAGATGAAGG - Intronic
926832788 2:16981678-16981700 CCAGCATGGGAGAATGATGAAGG - Intergenic
926943819 2:18166795-18166817 CCTGAAAGTGACAAGGAGAATGG - Intronic
927479974 2:23445446-23445468 CATGCAATGGACAAAGAGGATGG - Intronic
928136789 2:28693795-28693817 CATCCAAGGGGGAAGGAGGATGG - Intergenic
928265205 2:29805491-29805513 CCTGTCTGGGAGCAGGAGGAAGG - Intronic
928299498 2:30112853-30112875 CCAGCACGGGAGAAAGATGAGGG - Intergenic
928927507 2:36594479-36594501 GCAGCAAGGGAAAATGAGGAAGG + Intronic
928932556 2:36639011-36639033 CCTACAAGAGGGTAGGAGGAGGG + Intronic
929029147 2:37634769-37634791 CAAGCACAGGAGAAGGAGGATGG + Intergenic
929059874 2:37913345-37913367 CCAGCATGGGAGAAAGAGGAAGG - Intergenic
929404662 2:41628073-41628095 CCAGCTAGGGAGAAAGATGAAGG - Intergenic
929425971 2:41845107-41845129 CCAGCGTGGGAGAAGGATGAAGG - Intergenic
929507539 2:42540017-42540039 CCAGCCAGAGAGAGGGAGGAAGG - Intronic
929787931 2:45005371-45005393 TCGCCAAGAGAGAAGGAGGAGGG + Exonic
929938821 2:46314961-46314983 GATGCCAGGGAGAAGGAGGCAGG + Intronic
929961900 2:46503249-46503271 TCTGGAAGGTAGAAGGAGGCAGG + Intronic
930141334 2:47954003-47954025 CTTAGAAGGGAGCAGGAGGAAGG + Intergenic
930349403 2:50230773-50230795 CTTCCAAGGGAAAAGGATGAAGG + Intronic
930510251 2:52335439-52335461 CCTTCAAGGGAAAAGGGTGAGGG + Intergenic
930631399 2:53758370-53758392 CCTACAAGGGAAAAGGACAAAGG + Intronic
930922368 2:56771985-56772007 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931108428 2:59083468-59083490 CCTGCAAGGTAAAGGGAAGATGG - Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931214457 2:60228175-60228197 CCTGCAGAGGAGAAGGACCACGG - Intergenic
931285766 2:60830338-60830360 CATGCCAGGCAGAAGGAGGAAGG + Intergenic
931478979 2:62621014-62621036 CCTGAAAGTGACAAGGAGAATGG - Intergenic
931560582 2:63556381-63556403 CCTGAAAGAGATAAGGAGAATGG + Intronic
931971381 2:67590440-67590462 CCTGAAAGTGACAAGGAGAATGG + Intergenic
932398534 2:71464412-71464434 CCTGAAAGGGAGATGAAAGAGGG + Intronic
932449984 2:71803336-71803358 CCTGCATGGGAAGAGGTGGATGG + Intergenic
932468418 2:71938710-71938732 GCTGCAAGGAAGAGGGAGAAGGG - Intergenic
932504898 2:72219267-72219289 GGAGCAAGGGGGAAGGAGGAGGG + Intronic
932920274 2:75905941-75905963 CCAGCACGGGAGAAAGATGAAGG - Intergenic
933067792 2:77819696-77819718 CCAGCATGGGAGAAAGATGAAGG - Intergenic
933152265 2:78929972-78929994 ACTGGAAGGGGGAAAGAGGAAGG + Intergenic
933291932 2:80447680-80447702 CCAGCGTGGGAGAAGGATGAAGG - Intronic
933446246 2:82383341-82383363 CCAGCAAGGGAGAAAGATGAAGG + Intergenic
934056212 2:88253395-88253417 ACTGGAAGGGAGAGAGAGGAAGG - Intergenic
934088884 2:88533755-88533777 CCAGCACGGGAGAAGGATGTAGG - Intergenic
934151203 2:89149310-89149332 CCAGCACGGGAGAAAGATGAAGG - Intergenic
934216057 2:90032597-90032619 CCAGCATGGGAGAAAGATGAAGG + Intergenic
934315114 2:91910830-91910852 CCAGCATGGGAGAAAGATGAGGG + Intergenic
934542992 2:95191832-95191854 CTTGCAGGTGAGATGGAGGAAGG + Intergenic
934622683 2:95824811-95824833 CCTGAAAGAGACAAGGAGAATGG - Intergenic
934811092 2:97277292-97277314 CCTGAAAGAGACAAGGAGAATGG + Intergenic
934826600 2:97430647-97430669 CCTGAAAGAGACAAGGAGAATGG - Intergenic
934871974 2:97874256-97874278 CCTGAAAGTGACAAGGAGAATGG + Intronic
935038790 2:99405385-99405407 CCTGCATGGAAGGAGGCGGAAGG - Intronic
935155275 2:100478982-100479004 CATCCAAGGGAAAAGGTGGAGGG - Intronic
935564741 2:104593735-104593757 CCTGCACGGGAGAAAGATGTAGG + Intergenic
936232137 2:110712287-110712309 CCTCCTAGTGAGAAGGGGGAAGG - Intergenic
936241791 2:110794184-110794206 CCTGCACGGCAGGAGAAGGATGG - Intronic
936261711 2:110965764-110965786 CCTGGAAGGGGGAAGGAAGAAGG + Intronic
936830077 2:116633376-116633398 TCAGCAAGAGTGAAGGAGGATGG - Intergenic
937526275 2:122773593-122773615 CCTGAAAGTGAGAAGAAGAATGG + Intergenic
937581755 2:123496497-123496519 CCAGCATGGGAGAAAGAGGTAGG + Intergenic
938097968 2:128475614-128475636 CTTGGCAGGGAGCAGGAGGAGGG + Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938221942 2:129576573-129576595 CTTGCAGAGGAGGAGGAGGAGGG - Intergenic
938266803 2:129933712-129933734 CTTGCAAGAGAGAAGGAGCCAGG - Intergenic
938769429 2:134488406-134488428 CCAGCACGGGAGAAAGATGAAGG - Intronic
938882089 2:135600938-135600960 GCTGCAGGGGAGAGTGAGGAAGG - Intronic
938942135 2:136178630-136178652 TCTTCAAGGGAGAAGGGAGAGGG + Intergenic
938989300 2:136611634-136611656 CCAGCAAGAGAGATGGGGGAGGG + Intergenic
939640683 2:144637279-144637301 CCTGAAAGGGACAGGGAGAATGG - Intergenic
939707187 2:145469706-145469728 CCAGCATCGGAGAAAGAGGAAGG - Intergenic
939950589 2:148468238-148468260 TCAGGAAGGGAGAGGGAGGATGG - Intronic
940088964 2:149895129-149895151 CCGGAAAGGCATAAGGAGGAAGG - Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940439391 2:153696264-153696286 CCAGCATGGGAGAAAGATGAAGG + Intergenic
940490247 2:154350371-154350393 CCAGCATGGGAGAAAGATGAAGG - Intronic
940550426 2:155148432-155148454 CCTGCATGGGAGAAAGATGCAGG + Intergenic
941036338 2:160572980-160573002 CCAGCATGGGAGAAAGATGAAGG - Intergenic
941081088 2:161061433-161061455 CCAGCATGGGAGAAAGATGAAGG - Intergenic
941108897 2:161395541-161395563 CTTGAAAGGGACAAGGAGTAAGG + Intronic
941158654 2:162009685-162009707 CCTGCAATGGAGAAAGATAAGGG + Intronic
941622981 2:167799337-167799359 CTTGCAAGGGGGAGGGTGGAGGG - Intergenic
941876341 2:170437370-170437392 GCTTCAAGGGAGAAGGGGGTGGG - Intronic
941988163 2:171528484-171528506 CCAGCAAAGGAGACTGAGGATGG - Intronic
942744242 2:179213531-179213553 CCTGAAAGTGAGAAGGAGAATGG + Intronic
942822131 2:180126423-180126445 ACAACAAGTGAGAAGGAGGAGGG - Intergenic
943076817 2:183205886-183205908 CCAGCATGGGAGAAAGATGAAGG - Intergenic
943130811 2:183850914-183850936 CCTGAAAGTGACAAGGAGAATGG + Intergenic
943644632 2:190396676-190396698 GCTGCAAGGGAGAAGGGAGCTGG + Intergenic
943922685 2:193729593-193729615 CCAGCATGGGAGAAAGATGAAGG - Intergenic
944076898 2:195743078-195743100 CCAGCATGGGAGAAAGATGAAGG - Intronic
944745411 2:202650766-202650788 CCAGCACGGGAGAAAGATGAAGG + Intronic
945485274 2:210388056-210388078 GCTGCAAGGGAGAAAGAGAAGGG + Intergenic
945545165 2:211140652-211140674 CCAGCATGGGAGAAAGAGGTAGG - Intergenic
946162005 2:217841164-217841186 CTGGAAAGGGAGAAGGGGGAAGG + Intronic
946305340 2:218853859-218853881 GCTGCAAAGGAGATAGAGGAGGG - Intergenic
946533798 2:220605337-220605359 CCAGCATGGGAGAAAGATGAAGG + Intergenic
946556201 2:220860451-220860473 CCAGCATGGGAGAAAGATGAAGG - Intergenic
947314988 2:228847208-228847230 CCAGCACGGGAGAAAGATGAAGG - Intergenic
947820913 2:233068873-233068895 CCTGGAAGCCAGCAGGAGGAAGG + Intronic
947855423 2:233320608-233320630 ACTGCAAGGGAGATGAAGGCAGG - Exonic
947857164 2:233331831-233331853 CCTCGAAGGGAGAAAGAGGAAGG - Intronic
947984416 2:234436678-234436700 TATGCAAGGGAGAAGGAGCAGGG - Intergenic
948062938 2:235055123-235055145 GTTGGAAGGGAGCAGGAGGAAGG + Exonic
948145563 2:235705550-235705572 CCTGTAGTGGAGTAGGAGGAAGG + Intronic
948227023 2:236319115-236319137 GCTGCGATGAAGAAGGAGGAGGG - Intergenic
948348535 2:237319582-237319604 CCAGCACGGGAGAAAGACGAAGG - Intergenic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948615318 2:239194789-239194811 CCAGCAACTGAGGAGGAGGAGGG + Intronic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
948995445 2:241576064-241576086 CTGGCAGGGGAGGAGGAGGAGGG - Intergenic
1169264133 20:4157407-4157429 CCTGCAGAGGAGAAGAAAGAGGG + Intronic
1169505532 20:6207819-6207841 CTTGCAGGGGAGAGGGAGCATGG + Intergenic
1170698947 20:18685858-18685880 ACTGCAGGGGAGAAGGAAGAGGG - Intronic
1171724838 20:28606902-28606924 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171753225 20:29076148-29076170 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1171789029 20:29501412-29501434 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1171858499 20:30373086-30373108 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1171974924 20:31588154-31588176 CCTTCTGGGGAGAAGCAGGAGGG - Intergenic
1172223765 20:33290843-33290865 CCAGCAAAGGAGACTGAGGAAGG + Intronic
1172354670 20:34271236-34271258 TCTGAAAAGGAGAAGGAGGTGGG - Intergenic
1172698303 20:36837107-36837129 CCAGGAAGGGGGAAAGAGGAAGG - Intronic
1172779018 20:37424817-37424839 GCAGCAAGGAAGAAGAAGGAAGG + Intergenic
1172962145 20:38806676-38806698 TCTACATGGGGGAAGGAGGAGGG - Intronic
1173174537 20:40754534-40754556 GCTGCAAGGGAGTGGGAGGAGGG - Intergenic
1174794570 20:53511325-53511347 CCAGCACAGGAGAAGGATGAAGG - Intergenic
1175262191 20:57681639-57681661 CCAGCAGGGGAGGAGGTGGAGGG - Intronic
1175509137 20:59510370-59510392 TATGCAGGGGAGAAGGATGATGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176123687 20:63465651-63465673 GATGCAAGGTCGAAGGAGGAGGG - Intronic
1176158850 20:63638340-63638362 TCTGCAAGGGAGAAGATGGCAGG - Intergenic
1176236153 20:64054458-64054480 CTGGCAGGGGAGAAGGAGGCTGG - Intronic
1176446586 21:6827306-6827328 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176547980 21:8209532-8209554 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1176555873 21:8253743-8253765 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1176566911 21:8392567-8392589 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1176574810 21:8436777-8436799 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1176611425 21:8988074-8988096 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1176824756 21:13692336-13692358 CCTGCCTTGGAGAAGAAGGAAGG + Intergenic
1176926334 21:14753841-14753863 CCTTCAAGAGGGAAGGAGAAAGG + Intergenic
1176930274 21:14801614-14801636 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1177325858 21:19587811-19587833 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1177533041 21:22388261-22388283 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1177538301 21:22458499-22458521 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1178053815 21:28776785-28776807 CCAGCACGGGAGAAGGATGAAGG + Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178159419 21:29894426-29894448 CCAGCATGGGAGAAGGATGAAGG + Intronic
1178350784 21:31872287-31872309 CTTGTGAGGGAGAAGGAGGAGGG - Intergenic
1178496374 21:33089790-33089812 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1178792960 21:35717134-35717156 TTTGCAAAGGAGAAGGATGATGG - Intronic
1179149369 21:38796852-38796874 CCTGGAAGGGAGAGAGAGGGAGG - Intergenic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1179812996 21:43884283-43884305 TCAGCAGGAGAGAAGGAGGAGGG - Intronic
1180199534 21:46216035-46216057 CCTGCCATGGGGAAGAAGGAGGG - Intronic
1180298396 22:10965593-10965615 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1180410021 22:12598208-12598230 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1180541874 22:16456714-16456736 CCAGCATGGGAGAAAGATGAGGG + Intergenic
1181696393 22:24594892-24594914 GCTGCAGGGGAAGAGGAGGAGGG - Intronic
1182057900 22:27374568-27374590 CCTGAAAGTGATAAGGAGAATGG + Intergenic
1182376248 22:29850530-29850552 CTTGCATGGCAGAAGGAAGAAGG + Intergenic
1182747388 22:32616185-32616207 CCTGCATGGGGGCAGGAGGTGGG + Intronic
1182836256 22:33343986-33344008 CCAGCACGGGAGAAAGAGGTGGG + Intronic
1182926703 22:34131841-34131863 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1183029859 22:35095473-35095495 CTGGCAATGGAGAAGGAGGTTGG + Intergenic
1183349983 22:37329691-37329713 CGTGCAGGGAAGAAGGAAGAGGG + Intergenic
1183637028 22:39070371-39070393 CCTGGGAAGGAGGAGGAGGAAGG - Intronic
1184220110 22:43094554-43094576 GCTGCAAGGGGGAGGGAGGAGGG - Intergenic
1184245306 22:43232817-43232839 CCGACAAGGGAGCAGGAGCATGG - Intronic
1184266736 22:43351276-43351298 ACTGCAGGACAGAAGGAGGATGG - Intergenic
1184369507 22:44073743-44073765 TCTGAAAGGGAGAAGCAGGTAGG + Intronic
1184533531 22:45071547-45071569 GCAGCAAGGGAGAAGGTGGGAGG + Intergenic
1184938784 22:47745298-47745320 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1184992367 22:48179512-48179534 TCTGCAATGGAGAAGGACAATGG - Intergenic
1185168334 22:49276089-49276111 CCAGCACGGGAGAAGGATGTAGG + Intergenic
1185222583 22:49636433-49636455 CCTGCAAAGGCGACGGGGGAGGG + Intronic
1203252859 22_KI270733v1_random:125832-125854 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1203260914 22_KI270733v1_random:170914-170936 CCCGCAAGCGAGGAGGACGACGG - Intergenic
949126091 3:446614-446636 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
949214281 3:1546583-1546605 CAAGCAAGGGAGAATGAGGAGGG + Intergenic
949412656 3:3782726-3782748 CCAGCATGGGAGAAAGATGAAGG + Intronic
949788833 3:7770819-7770841 CCAGCATGGGAGAAAGATGATGG + Intergenic
949812473 3:8020743-8020765 CCAGTAGGGAAGAAGGAGGAGGG + Intergenic
950092397 3:10305142-10305164 ACTGTTAGGGAGGAGGAGGACGG - Exonic
950209059 3:11104529-11104551 CCAGCACGGGAGAAAGATGAAGG - Intergenic
950392227 3:12705653-12705675 CCTGCAAAGGAGACAGAGAAGGG + Intergenic
950533428 3:13566306-13566328 CGTACAAGAGAGAAGCAGGAGGG - Intronic
950749961 3:15120646-15120668 CCAGCAAACGAGGAGGAGGAAGG - Intergenic
950840599 3:15964815-15964837 CATCCAAGGAAGAAAGAGGAAGG - Intergenic
950921592 3:16700368-16700390 CCTGTAAGAGGGAAGCAGGAGGG - Intergenic
951269700 3:20608784-20608806 CATCCATAGGAGAAGGAGGAAGG + Intergenic
951653573 3:24980379-24980401 CCTGAAAGTGAGAGGGAGAATGG - Intergenic
951778514 3:26337296-26337318 CCAGCATGGGAGAAAGATGAAGG - Intergenic
951858538 3:27225160-27225182 CCAGCATGGGAGAAAGATGAAGG + Intronic
951964601 3:28368768-28368790 CCTGAAAGTGACAAGGAGAATGG - Intronic
952104323 3:30051645-30051667 CCTGAAAGTGACAAGGAGAATGG + Intergenic
952307766 3:32160673-32160695 CCTGGAAGGGCAATGGAGGATGG - Intronic
952570724 3:34712712-34712734 CCAGCATGGGAGAAAGATGAAGG - Intergenic
952707150 3:36391032-36391054 CCTGCCAGAGAGAGGGAAGATGG - Intronic
952714494 3:36465764-36465786 CCAGCATGGGAGAAAGAGGTAGG + Intronic
952962975 3:38604358-38604380 TGGGCAAGGGAGAAGGAGGCAGG + Intronic
953023420 3:39130400-39130422 CCAGCAGGGAAGGAGGAGGACGG + Intronic
953344276 3:42161867-42161889 CCTGGAAGGGATCAGGAGAAAGG + Intronic
953381015 3:42473064-42473086 CCTGCAATGGTGTAGGAGGCAGG + Intergenic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954130980 3:48560864-48560886 CCTGCAAGGGAGAGGGGGCTGGG - Intronic
954445711 3:50545832-50545854 CCTCAAAGGGGGCAGGAGGAGGG - Intergenic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954655363 3:52191137-52191159 CCTGATATGGAGAAGGAGCATGG - Intergenic
954871614 3:53771533-53771555 CCTGCTGGGGAGAATGAGGTTGG + Intronic
954978526 3:54722019-54722041 CCTGAAAGTGACAAGGAGAATGG - Intronic
955048976 3:55390240-55390262 CCTGAAAGTGACAAGGAGAATGG + Intergenic
955237908 3:57156121-57156143 ACTGCAACGGGGAAGAAGGATGG + Intronic
955320329 3:57969937-57969959 CCTGGAAGGCAGGATGAGGAGGG - Intergenic
955377636 3:58411375-58411397 GCTGCAAAGGAGAGGAAGGAGGG + Intronic
956157752 3:66316726-66316748 CCTGAAAGAGACAAGGAGAATGG - Intronic
956366569 3:68509846-68509868 CCTGAAAGGGAGAATGAAAAGGG + Intronic
956690720 3:71875616-71875638 CCTGCTAAGGGGAGGGAGGAGGG + Intergenic
956818202 3:72928354-72928376 ACTGGAAGGGGGAAGGAGGGAGG - Intronic
956933699 3:74075674-74075696 AATGCAAGTGAGATGGAGGAAGG + Intergenic
957009338 3:74986122-74986144 CCTGACAGGGCTAAGGAGGAGGG - Intergenic
957069905 3:75559461-75559483 CTTGCAGGTGAGATGGAGGAAGG + Intergenic
957101689 3:75836368-75836390 CCTGAAAGTGACAAGGAGAATGG - Intergenic
957287076 3:78230761-78230783 GCTTCAGAGGAGAAGGAGGATGG + Intergenic
957509603 3:81170126-81170148 GCTTCAAGGGAGAGGGAGAAGGG + Intergenic
957835128 3:85577449-85577471 GCTGCATGGCAGAAGGAGGAAGG - Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958166496 3:89884060-89884082 CCTGAAAGTGAGAGGGAGAATGG - Intergenic
958407630 3:93768334-93768356 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
958444727 3:94201573-94201595 CCTCCAAGACAGAAGGAGTAAGG - Intergenic
958553674 3:95646579-95646601 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
958642299 3:96820591-96820613 ATTGCAAGGGATAAGGAAGATGG + Intronic
958650349 3:96929833-96929855 CCTGAAAGAGACAAGGAGAATGG - Intronic
958810916 3:98859152-98859174 ACTGCAAGGCAGCAGGAGGCTGG + Intronic
959071017 3:101702049-101702071 CCAGCTTGGGGGAAGGAGGAGGG + Intergenic
959089687 3:101888769-101888791 CCTTCAAGGCAGAAGCAGAAGGG + Intergenic
959310175 3:104726059-104726081 CCAGCACGGGAGAAAGATGAAGG + Intergenic
961014513 3:123457290-123457312 CCTGGGAGCTAGAAGGAGGAGGG + Intergenic
961352457 3:126312613-126312635 CCTGCATGGATGAAGCAGGAGGG - Intergenic
961733406 3:128984428-128984450 CCAGCATGGGAGAAAGATGAAGG - Intronic
961774265 3:129272725-129272747 CCTGCAGGGGACAAGCAGGCAGG - Intronic
961812578 3:129530400-129530422 CCGAGAAGGGAGAGGGAGGAAGG + Intronic
961961300 3:130858049-130858071 CCAGCATGGGAGAAAGATGAAGG + Intronic
962075792 3:132080602-132080624 CCAGCATGGGAGAAAGATGAAGG - Intronic
962699354 3:137981361-137981383 CCTGAAAGTGACAAGGAGAATGG + Intergenic
962736517 3:138329949-138329971 CCAGCCAGGGAGAGGCAGGAGGG + Intergenic
962859808 3:139389378-139389400 CCAGGAAGGGAGAAGGCGGTGGG - Intronic
962932567 3:140051544-140051566 GCTGCAAGGGGCCAGGAGGAGGG + Intronic
963941621 3:151101627-151101649 GCTGGAAGGGAGGAGGAGGGGGG + Intronic
963998403 3:151738602-151738624 CCTGAAAGTGACAAGGAGAATGG - Intronic
964148352 3:153493636-153493658 CCAGCAAGGGAGAAAGATGTAGG + Intronic
964264306 3:154876501-154876523 CCTGAAAGTGACAAGGAGAAGGG + Intergenic
964391105 3:156199425-156199447 CCTGAAAGTGATAAGGAGAATGG - Intronic
964710422 3:159665937-159665959 ACTGGAAGGCAGGAGGAGGAAGG - Intronic
965071103 3:163916445-163916467 CCAGCATGGGAGAAAGATGAAGG - Intergenic
965186295 3:165468627-165468649 TCTGCAAAGGAGAAAAAGGAAGG - Intergenic
965621782 3:170649751-170649773 CCTGAAAGTGACAAGGAGAATGG - Intronic
965727715 3:171736662-171736684 CCTCCAAAAGACAAGGAGGAAGG + Intronic
966040812 3:175485617-175485639 CCAGCAGGGGAGAAAGATGAAGG + Intronic
966148639 3:176841375-176841397 CCAGCAGGGGAGAAAGATGAAGG - Intergenic
966248484 3:177835163-177835185 CCTGTCAGGGAGAAGGATGTGGG + Intergenic
966278980 3:178208140-178208162 CCTCTAAGGGTGAAGGAGAAGGG - Intergenic
966279080 3:178208492-178208514 CCTATAAGGGTGAAGGAGAAGGG - Intergenic
966487335 3:180485910-180485932 CCTGAAAGTGACAAGGAGAATGG + Intergenic
966494262 3:180561469-180561491 CCTGAAAGTGACAAGGAGAATGG + Intergenic
966861564 3:184233554-184233576 GCTGGAAGGGAGCATGAGGAGGG - Exonic
967745219 3:193047541-193047563 CCAGCATGGGAGAAAGATGAAGG - Intergenic
968063501 3:195745166-195745188 CCAGCACGGGAGAAAGATGAAGG - Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968528340 4:1076271-1076293 GCAGCAAGGGTGGAGGAGGAAGG + Intronic
968813616 4:2810864-2810886 CCTGCAAGGAGGAAAGAGAATGG + Intronic
969030798 4:4211651-4211673 CCTGCTAGGGAGACTGAGGCAGG + Intronic
969244538 4:5923965-5923987 CCAGCATGGGAGAAAGATGAAGG - Intronic
969397548 4:6932448-6932470 CCAGCAAGGGAGAAGGATGCAGG + Intronic
969467436 4:7366140-7366162 CCTGCCAAGGAGGAGGAGGGTGG - Intronic
969637347 4:8377008-8377030 CATGGAAGGTGGAAGGAGGAAGG - Intronic
969863459 4:10055837-10055859 GCTGCAAGAGAGAATGAAGAAGG - Intergenic
970007760 4:11427624-11427646 TCTGCAAAGGAGGAGGAAGAGGG + Intronic
970213096 4:13731306-13731328 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
970387728 4:15572942-15572964 CCAGCATGGGAGAAAGATGAAGG + Intronic
970588417 4:17536867-17536889 ATTTCAAGGGAGTAGGAGGAAGG + Intergenic
970629667 4:17926400-17926422 CCAGCACAGGAGAAAGAGGAAGG - Intronic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970917606 4:21353680-21353702 CCTGAAAGTGACAAGGAGAATGG + Intronic
971276463 4:25202473-25202495 CCTGAAAGTGAGAGGGAGGTTGG + Intronic
971437385 4:26641962-26641984 CCTGAAAGTGACAAGGAGAATGG + Intronic
971512392 4:27443258-27443280 CCGGCATGGGAGAAAGATGAAGG - Intergenic
971532302 4:27704407-27704429 CCAGCATGGGAGAAAGATGAGGG + Intergenic
971656032 4:29346429-29346451 GCTGTAAGGGAGATGGATGATGG - Intergenic
971857695 4:32063186-32063208 CCAGCAAAGGAGAAAGATGAAGG - Intergenic
972276908 4:37565952-37565974 CCAGCACGGGAGAAGGATGTAGG - Intronic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
972891961 4:43568218-43568240 CCAGCATAGGAGAAAGAGGAAGG + Intergenic
973347206 4:49069375-49069397 CCTGAAAGTGACAAGGAGAATGG + Intergenic
974370715 4:61013157-61013179 CCTGAAAGTGAGAGGGAGAATGG + Intergenic
974467055 4:62271174-62271196 CCAGCACGGGAGAAAGATGAAGG - Intergenic
974508887 4:62811093-62811115 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
975099902 4:70500980-70501002 CCAGCATGGAAGAAAGAGGAAGG + Intergenic
975104278 4:70550128-70550150 CCTGAAAGTGACAAGGAGAATGG + Intergenic
975322360 4:73023191-73023213 CCTAAAATGGAGAAGGAGGGAGG - Intergenic
975513853 4:75222851-75222873 CCTGAAAGGGACAGGGAGAATGG + Intergenic
976011729 4:80496895-80496917 CGTGCAAGAGAGATGGAGGTAGG + Intronic
976153863 4:82121299-82121321 CAGGCAGGCGAGAAGGAGGAAGG + Intergenic
976759524 4:88533181-88533203 CCAGCATGGGAGAAAGATGAAGG + Intronic
977372999 4:96164004-96164026 GCTTCAAGGGAGAAGGACAAGGG + Intergenic
977387514 4:96361547-96361569 CCTGCATGGGAGAAAGATGTAGG - Intergenic
977561179 4:98535641-98535663 CCTGAAAGTGACAAGGAGAATGG - Intronic
977947358 4:102928920-102928942 CCAGCATGGGAGAAAGATGAGGG + Intronic
978079383 4:104573527-104573549 CCAGCATGGGAGAAAGATGAAGG + Intergenic
978241678 4:106524285-106524307 CCAGCATGGGAGAAAGATGAAGG - Intergenic
978255348 4:106686109-106686131 CCAGCATGGGAGAAAGATGAAGG + Intergenic
979398147 4:120214471-120214493 TATGCAGGGGAGAAGGGGGATGG + Intergenic
979531621 4:121774453-121774475 CCAGCAAGGCAGAAGGTGGAAGG - Intergenic
979631057 4:122903677-122903699 ACTGCAAGGCTGGAGGAGGAAGG + Intronic
979883112 4:125987489-125987511 CCAGCATGGGAGAAGGATCAAGG - Intergenic
979887076 4:126041211-126041233 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
979968656 4:127107364-127107386 CCTGAAAGAGATAAGGAGGATGG + Intergenic
980740267 4:136941151-136941173 CCAGCATGGGAGAAAGATGAAGG - Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981171696 4:141632736-141632758 CCAGCACGGGAGAAAGATGAAGG - Intergenic
981229763 4:142338975-142338997 CCAGGAGGGGAGAAGGAGGTCGG + Intronic
981571934 4:146160842-146160864 CCAGCACGGGAGAAAGAGGTAGG - Intergenic
981651916 4:147069903-147069925 ACTGCAAGGAAGAAGGAGCAGGG - Intergenic
982108501 4:152032044-152032066 CCAGCATGGGAGAAAGAGGAAGG + Intergenic
982415271 4:155123935-155123957 CCAGAAAGGGAGAGGGAGGCAGG - Intergenic
982794378 4:159628334-159628356 CCTGAAAGTGACAAGGAGAATGG - Intergenic
982857746 4:160406709-160406731 CCTGCAAAGGAGAAAGTGTAGGG + Intergenic
982904505 4:161050498-161050520 CCAGCATGGGAGAAAGATGAAGG + Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
983415175 4:167443335-167443357 CCAGCAAGGGAGAAAGATGGAGG - Intergenic
983844072 4:172494743-172494765 CCAGCATGGGAGAAAGATGAAGG + Intronic
984224562 4:177018744-177018766 CCTGAAAGTGACAAGGAGAATGG + Intergenic
984702230 4:182825777-182825799 GGGGAAAGGGAGAAGGAGGAGGG - Intergenic
985436635 4:189936807-189936829 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
985669286 5:1198199-1198221 CCAGCAAGGGAGAATGAGCGTGG - Intergenic
985955874 5:3266026-3266048 CTTGCAAGGGTGAAGGAGTGAGG + Intergenic
986147316 5:5090676-5090698 CCAGCATGGGAGAAAGATGAAGG + Intergenic
986181101 5:5393592-5393614 CCAGCATGGGAGAAAGACGAAGG + Intergenic
986192522 5:5510248-5510270 CCTGCCAGGGTGGAGGGGGAAGG - Intergenic
986212872 5:5690599-5690621 TCTTCGAGGGAGAAGGAGAAAGG + Intergenic
986648857 5:9944676-9944698 GCTGCAGGGTAGAAGGAGGTGGG + Intergenic
986922891 5:12709216-12709238 TCTGGAAGAGAGAAGGAGGATGG + Intergenic
987381064 5:17286667-17286689 CCTGAAAGGATGAAGGAGCAAGG - Intergenic
987428791 5:17805556-17805578 CCTTCAAGAAAGAAGGAAGAAGG - Intergenic
987707028 5:21470918-21470940 CCAGCATGGGAGAAAGATGAAGG - Intergenic
987994041 5:25251789-25251811 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
988195346 5:27997761-27997783 CCAGCATGGGAGAAAGAGGTAGG - Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988671162 5:33383551-33383573 ACTTCAAGGGAGAAGAGGGAGGG - Intergenic
988796084 5:34655141-34655163 CCTAGTAGGGAGAGGGAGGAAGG + Intergenic
989200977 5:38763493-38763515 CCAGCACGGGAGAAAGATGAAGG - Intergenic
990088093 5:52003908-52003930 TCTTCAAGGGAGAAGAAAGAAGG - Intergenic
990107611 5:52284070-52284092 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
990327719 5:54694609-54694631 CATTCCAGGCAGAAGGAGGAGGG + Intergenic
991006975 5:61837808-61837830 ACTGCAAAGGAGCAGCAGGAGGG - Intergenic
991150283 5:63359974-63359996 CCTGAAAGTGACAAGGAGAATGG - Intergenic
991227659 5:64291752-64291774 CCTGAAAGAGACAAGGAGAATGG - Intronic
991258997 5:64646490-64646512 CATGCAAAGCAGCAGGAGGAGGG + Intergenic
991951313 5:71949111-71949133 ACAGCAAGGGAGAAGGAGGTTGG + Intergenic
992402983 5:76428297-76428319 CTGGGAAGGGAGAAGGAGTAGGG + Intronic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
993152920 5:84183721-84183743 CCTGTAAGTGTGAAGGAGCATGG - Intronic
993891841 5:93483983-93484005 CCTGCAAGTGATGAGGAGAATGG + Intergenic
994642926 5:102432879-102432901 CCTGAAAGAGATAGGGAGGATGG - Intronic
995119387 5:108519750-108519772 CCAGCATGGGAGAAAGATGAAGG + Intergenic
995428171 5:112047269-112047291 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
995562555 5:113398675-113398697 ACTACATGGGAGAGGGAGGAAGG + Intronic
995647503 5:114329448-114329470 CCAGCATGGGAGAAAGATGAAGG - Intergenic
996165425 5:120216316-120216338 TCAGCATGGGAGAAAGAGGAAGG + Intergenic
996420557 5:123257738-123257760 CCTGAAAGTGACAAGGAGAATGG - Intergenic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997476262 5:134144350-134144372 CCTTCAAGGGATAAGGCTGAAGG - Intronic
997624811 5:135324459-135324481 CCTGCAGGGGTGAGGGAGGATGG + Intronic
998466949 5:142354183-142354205 CCTAGAAGGGAGAGTGAGGAGGG + Intergenic
998570492 5:143252434-143252456 CCTTCATGGGAGTAGGAGGTGGG - Intergenic
998587039 5:143438131-143438153 CCTGAAAGAGATAAGGAGTAAGG - Intergenic
998910953 5:146959705-146959727 CAGGCAAGGGAAGAGGAGGATGG + Intronic
999065415 5:148680340-148680362 CCTGCAAAGGAGAAAGTTGAAGG - Intergenic
999435404 5:151559574-151559596 GCTGGAAGAGAGGAGGAGGATGG - Intronic
1000312822 5:160061833-160061855 CCTGCAAGGGAAAATGGGGCTGG + Intronic
1000492366 5:161930190-161930212 CCTGCATGGGAGAAAGATGTAGG - Intergenic
1001197161 5:169684174-169684196 ACTGAAAGGCAGAAGGAAGAAGG - Exonic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001295469 5:170495890-170495912 CCAGGAAGAGGGAAGGAGGAAGG - Intronic
1001439922 5:171734819-171734841 CAAGCAAGTGAGAAGGTGGAAGG - Intergenic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1001820401 5:174705644-174705666 CCTCCAGGGAAGAAGGAGGCTGG + Intergenic
1001970327 5:175950145-175950167 CTTGAAAGGTGGAAGGAGGAGGG - Intronic
1002161220 5:177315023-177315045 CTTGCAGGGGAGAAGGGGAAAGG - Intergenic
1002538001 5:179888777-179888799 CCTGGCAGGGAGACGGACGAGGG + Intronic
1002563496 5:180097771-180097793 CCTGCAAAAGAGGAGGAGGCAGG + Intergenic
1002661475 5:180793359-180793381 CCTCCAGGTGGGAAGGAGGAGGG + Intronic
1003009493 6:2413438-2413460 CATTCAAGGGAGAAAGATGAGGG - Intergenic
1003518482 6:6837173-6837195 GCAGGAAGGAAGAAGGAGGAAGG + Intergenic
1003758159 6:9145710-9145732 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1003973610 6:11322525-11322547 CCTGCAAGGATGAGAGAGGAAGG + Intronic
1004256592 6:14070039-14070061 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1005014881 6:21366248-21366270 CCTCTAAGGGTGAAGGAGAAGGG + Intergenic
1005510789 6:26509918-26509940 CAGGCAAGGGAGAAACAGGAGGG - Exonic
1005811566 6:29519881-29519903 CCTGCAAGGCAGAGGGAGAGAGG - Intergenic
1006511898 6:34526022-34526044 CCAGGGAGGGGGAAGGAGGAGGG + Intronic
1006811963 6:36825840-36825862 GCTGAAAGTGATAAGGAGGAGGG + Intronic
1006919002 6:37615381-37615403 TTTGCAAGGGAGTGGGAGGAGGG - Intergenic
1007192360 6:40030460-40030482 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1007346688 6:41236464-41236486 CCTGCAGGGAAGAAGGAGAAAGG - Exonic
1007391863 6:41553947-41553969 CCTGCATGGAAGATGGGGGAAGG + Intronic
1007589251 6:43011659-43011681 TCTGCAGGGGAGAGAGAGGAGGG - Exonic
1007697868 6:43744948-43744970 CATGAAAGGGAGCTGGAGGAGGG + Intergenic
1007714258 6:43845254-43845276 CCTGGAAAGGAAAAGAAGGAGGG - Intergenic
1007738315 6:43995496-43995518 CCTGCAACTGTGAATGAGGATGG + Intergenic
1007775540 6:44222662-44222684 CCTCCAAGGGAGGGGGAGGGAGG - Intronic
1007930046 6:45682521-45682543 CCAGAAAGGAAGAAGGAGAAGGG - Intergenic
1008918359 6:56815202-56815224 CCTGAAAGGGAAAAGTAGGGAGG + Intronic
1009021195 6:57949581-57949603 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1009060453 6:58392283-58392305 ACTAGAAGGGAGAAGGAGGGTGG + Intergenic
1009230458 6:61055051-61055073 ACTAGAAGGGAGAAGGAGGGTGG - Intergenic
1010253537 6:73733049-73733071 TCTGCAAGTTACAAGGAGGAAGG - Intronic
1010831519 6:80536309-80536331 AGTGCAAGGGAGAACAAGGAAGG + Intergenic
1010991208 6:82482316-82482338 CTCTCAAGAGAGAAGGAGGAAGG - Intergenic
1011328010 6:86172414-86172436 CCAGCATGGGAGAACGATGAAGG - Intergenic
1011489277 6:87874116-87874138 TCTTCAAGGGAGAAGAGGGAGGG + Intergenic
1011490846 6:87890298-87890320 CTTGCAAGGGAGAAGAAAGGAGG + Intergenic
1011525813 6:88263763-88263785 GCTGCAGGGCAGAAGGAGGGAGG + Intergenic
1011530660 6:88317615-88317637 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1011643770 6:89438354-89438376 ACTGCAAGGGGGAAAGAGTATGG + Intronic
1011645991 6:89458589-89458611 CCAGCACGGGAGAAAGATGAAGG + Intronic
1011803296 6:91042929-91042951 CCTTAAAGCGGGAAGGAGGATGG + Intergenic
1011830366 6:91364500-91364522 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1012931343 6:105320525-105320547 CCAGCCAAGGAGAAGGAGAAGGG - Intronic
1013067807 6:106700458-106700480 CATTCAAGGGAGAAGGGCGAGGG - Intergenic
1013607134 6:111760887-111760909 CCAGAAAGGGAGAAGGCCGAGGG - Intronic
1014176845 6:118340869-118340891 CCTGCAAGCCAGAAGGGGGGTGG - Intergenic
1014498972 6:122163100-122163122 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1014860710 6:126464556-126464578 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1015003202 6:128245600-128245622 GCTGAAAGTGAGATGGAGGATGG + Intronic
1015109076 6:129570511-129570533 CCTGAAAGGGACAGGGAGAATGG + Intergenic
1015726369 6:136303530-136303552 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1016100917 6:140099041-140099063 CCTGAATGGGAGGAGTAGGACGG + Intergenic
1016111624 6:140231628-140231650 CCTGAAAGTGATAAGGAGAATGG + Intergenic
1016683324 6:146855026-146855048 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1016903122 6:149121471-149121493 CCTGAAAGGTAGAAAGAAGAGGG + Intergenic
1017082171 6:150680543-150680565 CCTGCAAAGGAGATTGAAGAGGG + Intronic
1017557057 6:155583066-155583088 TCTGCCATGGGGAAGGAGGATGG + Intergenic
1017873354 6:158504008-158504030 CGGGCCAGTGAGAAGGAGGACGG + Exonic
1017949085 6:159120379-159120401 GGAGCAAAGGAGAAGGAGGAAGG - Intergenic
1018051891 6:160016389-160016411 CCAGCAAGGCAGATTGAGGAAGG - Intronic
1018060092 6:160083427-160083449 CTTGCAGGTGAGATGGAGGAAGG - Intronic
1018234589 6:161711784-161711806 CCAGCATGGGAGAAAGATGAAGG - Intronic
1018254757 6:161906860-161906882 CCAGCACGGGAGAAAGATGAAGG + Intronic
1018382477 6:163271149-163271171 CCAGCACGGGAGAAAGATGAAGG + Intronic
1018427508 6:163696635-163696657 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1018486908 6:164249843-164249865 CCTGCATTTGAAAAGGAGGATGG - Intergenic
1018619417 6:165715549-165715571 AATGAAGGGGAGAAGGAGGAGGG + Intronic
1018654459 6:166020640-166020662 CCAGCAGGGGAGAAAGATGAAGG - Intergenic
1018731022 6:166650499-166650521 GCTGGAGGAGAGAAGGAGGAGGG + Intronic
1018756509 6:166853870-166853892 CCTGCAGGAGAGAGGCAGGATGG + Intronic
1018773016 6:166988813-166988835 CATGCAAGGTGGAAGGAGAAAGG - Intergenic
1018894708 6:168005699-168005721 CCAGCACGGGAGAAGGATGTAGG + Intronic
1019137887 6:169922526-169922548 GCTGCCTGGGAGGAGGAGGAAGG + Intergenic
1019203804 6:170342096-170342118 CCAGCATGGGAGAAGGATGTAGG + Intronic
1019295486 7:271928-271950 CCTGCAGGGGGGAGCGAGGAGGG + Intergenic
1019389425 7:777552-777574 CCAGCGAGGGAGAAAGGGGATGG + Intronic
1019748326 7:2712955-2712977 CCTGCCAGGGATAAAGAGGAAGG + Exonic
1019954542 7:4402883-4402905 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1019979897 7:4613783-4613805 TCTGGAAGGGAGTAGGAGGAGGG - Intergenic
1020033182 7:4947349-4947371 CTTACATGGGAGCAGGAGGAAGG + Intronic
1020100841 7:5393605-5393627 CCTGGGAGGAGGAAGGAGGAAGG + Intronic
1020326229 7:6976496-6976518 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1020501029 7:8920585-8920607 CCAGCAAGGGAGAGAGATGAAGG + Intergenic
1020623718 7:10551176-10551198 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1021292858 7:18867150-18867172 CATGCAGGGAAGAAGGAAGAGGG + Intronic
1021523512 7:21560590-21560612 CCAGCATGGGAGAAGGATGAAGG + Intronic
1021795932 7:24254293-24254315 TCTCCATGGGAGAAGGGGGAAGG - Intergenic
1021877196 7:25059952-25059974 CATGCAAGGGACAAAAAGGAGGG - Intergenic
1022141992 7:27500676-27500698 CAAACCAGGGAGAAGGAGGAGGG + Intergenic
1022234535 7:28448156-28448178 CCAGCACGGGAGAAAGAGGTAGG - Intronic
1023167707 7:37359184-37359206 CCTGCAAGGAAGGAGTAGGAAGG - Intronic
1023214436 7:37847090-37847112 GCTGCAAGTGGGAGGGAGGAAGG + Intronic
1023455051 7:40329535-40329557 CCCTCAGGCGAGAAGGAGGAGGG - Intronic
1023942535 7:44779079-44779101 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1024010470 7:45261954-45261976 CCTGGAAGCAAAAAGGAGGAGGG - Intergenic
1024476105 7:49813218-49813240 CCTGCAGGAGAGCAGGAGGCAGG - Intronic
1024975344 7:55109048-55109070 GCTGCAAGGGAGAAGGTGGGAGG + Intronic
1026072196 7:67131879-67131901 CCAGCACGGGAGAAAGATGAAGG + Intronic
1026134500 7:67647393-67647415 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1026255443 7:68707276-68707298 CCTGCTAGGGAGAAGAGAGAGGG - Intergenic
1026507890 7:71002191-71002213 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1026704704 7:72680387-72680409 CCAGCACGGGAGAAAGATGAAGG - Intronic
1027194005 7:76015914-76015936 CCAGCAAGGGAGAAAGATGTAGG - Intronic
1027655761 7:80929456-80929478 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
1027676333 7:81163040-81163062 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1027869430 7:83687908-83687930 TCTTCAAGGGAGAAGCAAGAAGG + Intergenic
1028666461 7:93349237-93349259 CCTGCAGGTGAGAAAGAGCATGG + Intronic
1029090882 7:98047308-98047330 CATGAGAGTGAGAAGGAGGAGGG + Intergenic
1029282459 7:99444883-99444905 TCTGCCGGGGAGAAGGAGGTGGG - Intronic
1029404705 7:100367512-100367534 GCCGCAAGGCAGAAGGAGGCTGG + Exonic
1029484273 7:100829594-100829616 CCTGCATCGGGGAGGGAGGAGGG - Intronic
1029493415 7:100884458-100884480 CCAGCAAGAAAGAAGAAGGACGG + Exonic
1029611733 7:101630248-101630270 ACTGGGAGGGAGCAGGAGGAGGG - Intergenic
1030035518 7:105405310-105405332 AGGGCAGGGGAGAAGGAGGAGGG + Intergenic
1030185287 7:106755635-106755657 CCTGGAAGGGAAGAGGAGAAGGG + Intergenic
1030348164 7:108456052-108456074 CCTGCAGGGGAGAAGGGAGTTGG + Intronic
1030368114 7:108669497-108669519 CCAGCATGGGAGAAGGATGTAGG - Intergenic
1030585552 7:111414187-111414209 CCTGCAGGGGAACAGGAGGAAGG - Intronic
1031239618 7:119220369-119220391 CCAGCAAGGGAGAAAGATGAAGG + Intergenic
1031482043 7:122289789-122289811 ACTGCAAGTGAGAAAGAGGGAGG + Intergenic
1031882345 7:127211343-127211365 CCAGCATGGGAGAAAGATGAAGG + Intronic
1032240097 7:130153601-130153623 CCAGGCAGGGAGAGGGAGGAAGG - Intergenic
1032659587 7:133968949-133968971 CCTGAAAGTGACAAGGAGAATGG - Intronic
1033208678 7:139444066-139444088 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1033597741 7:142868746-142868768 CCAGCCTGGGTGAAGGAGGAGGG + Intronic
1033754756 7:144389183-144389205 CAAGCAAGGGAAGAGGAGGAGGG - Intergenic
1033844655 7:145417568-145417590 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1034076910 7:148240852-148240874 CCAGCATGGGAGAAAGATGAAGG + Intronic
1034354427 7:150441896-150441918 CCTGCAAGGGGTAAGGGGAAGGG - Intergenic
1034824775 7:154251731-154251753 CCAGCATGGGAGAAAGATGAAGG + Intronic
1034923385 7:155101808-155101830 CCGGCTTGGGAGATGGAGGAAGG - Intergenic
1034999872 7:155604070-155604092 ACTGCAAGGGAGGAGGGAGAGGG + Intergenic
1035122229 7:156578471-156578493 CCTGCCAGGGAGGAAAAGGAGGG + Intergenic
1035514636 8:222199-222221 GCTACTAGGGAGAATGAGGAAGG + Intergenic
1035533135 8:371179-371201 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1036936080 8:13003937-13003959 GCTGCCAGGGAGTTGGAGGAGGG - Intronic
1037893512 8:22636663-22636685 CCTGCCAAGGAGGAGGAGAAAGG + Intronic
1038034082 8:23672303-23672325 GGAGCAAAGGAGAAGGAGGAGGG - Intergenic
1038083395 8:24165522-24165544 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1038526581 8:28279306-28279328 CCAGCACGGGAGAAGGATGTAGG - Intergenic
1039218823 8:35305183-35305205 ACTCCAAGTGAGAAGTAGGATGG + Intronic
1039264934 8:35814466-35814488 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1039451203 8:37676360-37676382 CCTGTGAGGGAGAAGGAAGGAGG - Intergenic
1039719049 8:40142806-40142828 CCTGCAAGAGACAGGGAGAACGG - Intergenic
1039801950 8:40965540-40965562 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1040491891 8:47931302-47931324 CCAACAAGGGAGGAGGAGGCTGG + Intronic
1040962303 8:53047758-53047780 CCTGAAAGTGACAGGGAGGATGG - Intergenic
1041016599 8:53597779-53597801 CTAGGAAGTGAGAAGGAGGAGGG - Intergenic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1041388063 8:57325536-57325558 CCTGCAAGTGACAGGGAGAATGG - Intergenic
1041746916 8:61217356-61217378 CTTTAAGGGGAGAAGGAGGAGGG + Intronic
1041846804 8:62338747-62338769 CCAGCAAGGGAGAAAGATGTAGG + Intronic
1041925364 8:63230565-63230587 CCTGCATGGGAGAAAGATGAAGG - Intergenic
1042101461 8:65279696-65279718 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1042486866 8:69356001-69356023 CCTGCAAGTGACAGGGAGAATGG - Intergenic
1042532914 8:69833169-69833191 CCTGCAAAGCAGAAAGAGGGCGG + Exonic
1042753380 8:72183319-72183341 CCTGCAAGGGAAAGAGATGACGG - Intergenic
1042812750 8:72844547-72844569 CCTGAAAGTGACAAGGAGAATGG - Intronic
1042855282 8:73260965-73260987 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1043158336 8:76814956-76814978 CCTGTAATGGAGAAAGAGGGTGG + Intronic
1043180857 8:77085028-77085050 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1043393334 8:79812290-79812312 CCTGGAAGGGAGAAGGGGAAGGG + Intergenic
1043499090 8:80835502-80835524 GCTGCAAGAGAGAAGGAGCAGGG + Intronic
1043509169 8:80932688-80932710 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1043529327 8:81132630-81132652 CCAGCAAGACAGAAGGGGGAAGG - Intergenic
1043609498 8:82044982-82045004 GCTAAAAGGGAGAAGGAGGGAGG + Intergenic
1043661376 8:82746450-82746472 CTTCCCAGAGAGAAGGAGGAGGG + Intergenic
1043788572 8:84433632-84433654 GCAGCAAGGGAAAATGAGGAAGG - Intronic
1044038488 8:87336305-87336327 CCTGAAAGGGACAGGGAGAATGG - Intronic
1044476250 8:92629960-92629982 CCTTCAAAGGAGCAGGAGAATGG - Intergenic
1044487536 8:92770136-92770158 CCAGCATGGGAGAAGGATGTAGG + Intergenic
1044500118 8:92944702-92944724 CTAGCAAGGGAAAAGGAGGAGGG + Intronic
1044540537 8:93404163-93404185 CCTACAAGGGAATAGGAGGCAGG + Intergenic
1044744900 8:95362436-95362458 GCTGGAAGGGGAAAGGAGGAAGG - Intergenic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1044894268 8:96873027-96873049 AGTGCAAGGAAGAAGGAAGATGG - Intronic
1045010160 8:97951815-97951837 CGGGGAAGGGAAAAGGAGGAAGG - Intronic
1045396948 8:101770535-101770557 CCTGCAAAGAAGAAGCAGGCTGG + Intronic
1045554876 8:103206445-103206467 CCTGCAAGGAGGAAGGAGCTAGG + Intronic
1045857606 8:106782050-106782072 TCTGCAATGGAGACTGAGGAAGG + Intergenic
1046277959 8:111987111-111987133 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1046313757 8:112473760-112473782 ACTCCAAGGGTGAAGGAGCAGGG - Intronic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1047240131 8:123079787-123079809 GCTGCAATGGGGAAGGAGAAAGG - Intronic
1047449295 8:124949358-124949380 CCAGCAAGGGAGAAACAGGAAGG - Intergenic
1047580264 8:126206341-126206363 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1047749216 8:127867253-127867275 CCTGGGAGGGTGGAGGAGGAGGG + Intergenic
1047828545 8:128606143-128606165 GCTGCAAGGGATGAGGAGAAGGG - Intergenic
1048331045 8:133471010-133471032 CGTGGAAGGAGGAAGGAGGATGG - Intronic
1048625849 8:136184208-136184230 CCTGCAAGGGAGAAAGATGAAGG + Intergenic
1048907700 8:139104365-139104387 CCAGCAAGGGAGAAAGATGAAGG + Intergenic
1048920216 8:139222603-139222625 CCTGCAGGGGTGAAGGATAATGG + Intergenic
1049176172 8:141194011-141194033 CCTGCCAGGGAGAAACGGGAGGG - Exonic
1049239915 8:141532167-141532189 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1049415204 8:142491881-142491903 CCTGACAGGGAGAGGGAGGCAGG + Intronic
1049484976 8:142851467-142851489 CCTGAAAGTGAGAGGGAGAATGG + Intronic
1050186093 9:2975486-2975508 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1050598906 9:7231092-7231114 CCTCCAAGGGAGAAGGTTCAGGG + Intergenic
1050874267 9:10614641-10614663 GCAGAAAGGGAGAAGGAGGGAGG - Intergenic
1051315590 9:15827206-15827228 CCTGCAAGGGAGAAAAAAGAAGG - Intronic
1051425572 9:16928293-16928315 CCTGCAAGGCTGCAGCAGGATGG - Intergenic
1051983070 9:23047229-23047251 CCTGAAAGAGACAAGGAGAATGG + Intergenic
1052070850 9:24080071-24080093 GCTGCAAGAGAGAATGAGGAAGG - Intergenic
1052889131 9:33680839-33680861 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1052975699 9:34408348-34408370 CCTGCAAGGGAGGTGGAGATGGG + Intronic
1052996021 9:34552018-34552040 CCTGCAGAGGAGCAGGAGGCCGG - Exonic
1053096552 9:35333545-35333567 GATGAAAGGGAGAAGGAGGAAGG - Intronic
1053162140 9:35820494-35820516 CCTGAAGAGGAGAAGGAGGTTGG + Intronic
1053724763 9:40988273-40988295 ACTAGAGGGGAGAAGGAGGAAGG - Intergenic
1054341209 9:63863726-63863748 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1054755364 9:68952026-68952048 ACTGGAAGGGTGTAGGAGGAGGG - Intronic
1054770238 9:69076815-69076837 CCAGCAAGGGAGAAAGGGGAAGG + Intronic
1055210460 9:73784535-73784557 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1055341358 9:75287496-75287518 CCTACAAGCCAGAAGGGGGAGGG - Intergenic
1055829667 9:80363126-80363148 CCTAGAAGGGAGAGGGAGGGGGG - Intergenic
1056017957 9:82411177-82411199 AATGCAAGAGAGAAGGAGGGAGG - Intergenic
1056678240 9:88695112-88695134 CCTCCAAGGAAGATGGAGCAGGG - Intergenic
1056692795 9:88822486-88822508 TCTGAAAGGGAGAAAGAGGAGGG - Intergenic
1056900815 9:90597544-90597566 CCCGCAGCGGAGGAGGAGGAAGG + Intergenic
1057188293 9:93071432-93071454 CCAGCATGGGAGAAAGATGAAGG + Intronic
1057460469 9:95256074-95256096 CCTGAAAGTGACAAGGAGAATGG + Intronic
1057558464 9:96108286-96108308 CCTTCCAGGGAGGAGTAGGATGG - Exonic
1057851936 9:98572668-98572690 CCTGAGAGTGAGAAGGAGGCAGG + Intronic
1058100940 9:100916979-100917001 CCGGCATGGGAGAAAGATGAAGG - Intergenic
1058643530 9:107109670-107109692 CCTGCAAGGGTGAATGTAGAGGG - Intergenic
1058694490 9:107547879-107547901 GCTGTAAGGAGGAAGGAGGAAGG + Intergenic
1058873043 9:109218821-109218843 CCTGCCAGGGAATAAGAGGAAGG - Intronic
1059014194 9:110496400-110496422 CCAGCACGGGAGAAAGATGAAGG - Intronic
1060542848 9:124442567-124442589 CATTCAAGGCAGAAGGAAGAGGG + Intergenic
1061147589 9:128808892-128808914 CCAGGGAGGGAGAAGGAAGAGGG + Exonic
1061644838 9:131992775-131992797 CCAGCAAGGGGCAAGGAGGAAGG - Intronic
1061656462 9:132094981-132095003 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1061669968 9:132183144-132183166 CCAGGAAGCCAGAAGGAGGATGG - Intronic
1061902140 9:133678382-133678404 GCTGCAGGGGAGAAAGAGGGCGG - Intronic
1062161585 9:135083359-135083381 CCTGCCAGGGAGAGTGCGGAGGG + Intronic
1062190777 9:135246841-135246863 CATGCAAGAGAGGAGGAAGAGGG + Intergenic
1062229224 9:135472175-135472197 CCTGAAAGGCAAAAGGAGGTTGG - Intergenic
1062437214 9:136551583-136551605 CGAGAAAGGGGGAAGGAGGAAGG - Intergenic
1203522604 Un_GL000213v1:57225-57247 CCTGCCTTGGAGAAGAAGGAAGG - Intergenic
1203450044 Un_GL000219v1:103717-103739 ACTAGAGGGGAGAAGGAGGAAGG + Intergenic
1203469261 Un_GL000220v1:108979-109001 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1203477082 Un_GL000220v1:152951-152973 CCCGCAAGCGAGGAGGACGACGG - Intergenic
1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185550642 X:980720-980742 GCTGCCATGGAGGAGGAGGAGGG + Intergenic
1185728264 X:2440600-2440622 CCAGCATGGGAGAAAGATGAAGG - Intronic
1185735849 X:2495656-2495678 GCTGCAAGGGAGGAGGAAGGAGG - Intronic
1185989350 X:4875710-4875732 CCAGCAAGGGAGAAAGATGGAGG - Intergenic
1186114724 X:6293305-6293327 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1186852090 X:13590613-13590635 CCAGCCAGAGAGAAGGAGGTTGG - Intronic
1187098662 X:16170497-16170519 CATGCAGGAGAGGAGGAGGATGG - Exonic
1187308364 X:18117215-18117237 TCTGGAAGGGGGAAGGGGGAAGG + Intergenic
1187424402 X:19164087-19164109 CCTGCAAGAGACAAGGAAGGTGG - Intergenic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187927611 X:24264265-24264287 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1188567596 X:31544431-31544453 GCTTCAGGGGAGAAGGGGGAAGG - Intronic
1188611209 X:32100110-32100132 CCTGAAAGGGAGAAGTAAAAAGG + Intronic
1188954438 X:36417467-36417489 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1189743081 X:44141877-44141899 TCTCCAAGGGAAAAGGGGGAAGG + Intergenic
1189761657 X:44328136-44328158 CTTGCAAGGGAGAAGGAATTTGG - Intronic
1190035679 X:47021124-47021146 ACTGGCAGGGAGAAGAAGGAGGG - Intronic
1190054457 X:47173715-47173737 CCTGCAAGAGGGAGGGAGGGAGG - Intronic
1190652433 X:52580199-52580221 CCAGCATGGGAGAAAGTGGAAGG - Intergenic
1190793280 X:53719770-53719792 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1190966267 X:55304322-55304344 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1191155505 X:57268384-57268406 CCTGAAAGAGATAAGGAGAATGG + Intergenic
1191718926 X:64213139-64213161 CCAGCACAGGAGAATGAGGAAGG + Intergenic
1191766422 X:64703808-64703830 CCTGAAAGAGATGAGGAGGATGG - Intergenic
1192675481 X:73191626-73191648 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1193121070 X:77823535-77823557 CCAGCACGGGAGAAAGATGAAGG - Intergenic
1193174206 X:78372939-78372961 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1193267941 X:79495325-79495347 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1193391575 X:80935476-80935498 CCAGCAAGGGAGAAAGATGGAGG - Intergenic
1193452274 X:81685457-81685479 CCTGAAAGTGACAGGGAGGATGG + Intergenic
1193461746 X:81798331-81798353 CCAGCATGGGAGAAAGAAGAAGG - Intergenic
1193484295 X:82067412-82067434 CCAGCAAGAGAGAAAGATGAAGG + Intergenic
1193780994 X:85701249-85701271 TCTCTCAGGGAGAAGGAGGAGGG - Intergenic
1193852284 X:86553281-86553303 CCAGCATGGGAGAAAGATGAAGG + Intronic
1193876795 X:86870879-86870901 CCTGCATGGGAGAAAGATGTAGG - Intergenic
1194128980 X:90055720-90055742 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1194233171 X:91348935-91348957 CCAGCAAGGGAGAAAGATGAAGG - Intergenic
1194954259 X:100161193-100161215 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1194958467 X:100208381-100208403 CTTTCAAGGGAGGAGGAGGGAGG - Intergenic
1195123966 X:101786629-101786651 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1195198280 X:102520112-102520134 CTAGCAAGGGAGAAAGATGAAGG + Intergenic
1195275394 X:103276124-103276146 CCTGCAAGGCAGCGGGAGGCGGG - Intronic
1196361656 X:114868342-114868364 CCTGGAAGCAAAAAGGAGGAGGG - Intronic
1196365255 X:114916407-114916429 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1196589267 X:117466821-117466843 CCTGAAAGTGACGAGGAGGATGG - Intergenic
1196865053 X:120063567-120063589 CCAGCATGGGAGAAAGAGGTAGG - Intergenic
1196878048 X:120172765-120172787 CCAGCATGGGAGAAAGAGGTAGG + Intergenic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1197026144 X:121752050-121752072 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1197243731 X:124147005-124147027 CCTGGAAGGGAGAATAAGAAGGG + Intronic
1197346989 X:125336195-125336217 CCAGCATGGGAGAAAGAAGAAGG - Intergenic
1197364467 X:125546455-125546477 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1197409639 X:126099328-126099350 CCAGCAAGGGAGAAAGATGTAGG + Intergenic
1197474337 X:126902012-126902034 CCTGAAAGAGATGAGGAGGATGG + Intergenic
1197598382 X:128495299-128495321 CCAGCATGGGAGAAAGATGAAGG - Intergenic
1197633265 X:128886546-128886568 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1197883781 X:131196654-131196676 CATGGAAGGAAGAAGGAAGAGGG - Intergenic
1198130799 X:133693066-133693088 CCTGTGAGGGAGAGGGAGCAGGG + Intronic
1198295240 X:135281097-135281119 CCTGAAAGTGACAAGGAGAATGG - Intronic
1198593343 X:138209159-138209181 CCAGCAAGGGAGAAAGATGAAGG + Intergenic
1198663635 X:138997715-138997737 CCTGAAAGTGACAAGGAGAATGG + Intronic
1199022836 X:142902568-142902590 CCAGCATGGGAGAAAGATGAAGG + Intergenic
1199111100 X:143935898-143935920 CCAGCAAGGGAGAAAGATAAAGG - Intergenic
1199243194 X:145572615-145572637 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1199507921 X:148586948-148586970 TATGGAAGGGGGAAGGAGGATGG - Intronic
1199758426 X:150886786-150886808 TCTGCAAGGGATAAGGCGGGTGG - Intronic
1199784863 X:151096028-151096050 CCAGCACGGGAGAAAGATGAAGG + Intergenic
1199820611 X:151442206-151442228 CCAGCAAGGGAGAAAGATGTAGG - Intergenic
1200184092 X:154170469-154170491 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200189746 X:154207597-154207619 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200195499 X:154245406-154245428 GCTACAAAGGTGAAGGAGGAGGG + Intergenic
1200201151 X:154282527-154282549 GCTACAAAGGTGAAGGAGGAGGG + Intronic
1200624069 Y:5490682-5490704 CCTCCAATTCAGAAGGAGGAGGG - Intronic
1201182785 Y:11365640-11365662 CCAGCATGGGAGAAAGATGAGGG + Intergenic
1201544625 Y:15148073-15148095 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1201608847 Y:15817662-15817684 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1201614964 Y:15886827-15886849 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1201635566 Y:16119316-16119338 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1202170264 Y:22036025-22036047 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202221101 Y:22550348-22550370 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic
1202322011 Y:23645314-23645336 TCTGAAAGGCAGAAAGAGGAAGG + Intergenic
1202333257 Y:23777616-23777638 CCTGAAAGTGACAAGGAGAATGG - Intergenic
1202537512 Y:25892447-25892469 CCTGAAAGTGACAAGGAGAATGG + Intergenic
1202548756 Y:26024742-26024764 TCTGAAAGGCAGAAAGAGGAAGG - Intergenic