ID: 1086464458

View in Genome Browser
Species Human (GRCh38)
Location 11:87038371-87038393
Sequence CCTGCAAGGGAGAAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1285
Summary {0: 1, 1: 0, 2: 6, 3: 109, 4: 1169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086464458 Original CRISPR CCTGCAAGGGAGAAGGAGGA GGG Intronic