ID: 1086466740

View in Genome Browser
Species Human (GRCh38)
Location 11:87061750-87061772
Sequence AATCACATGGGGAAAGAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 314}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086466733_1086466740 17 Left 1086466733 11:87061710-87061732 CCAATACAGTCAACCATCTCTAT 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG 0: 1
1: 0
2: 1
3: 24
4: 314
1086466732_1086466740 18 Left 1086466732 11:87061709-87061731 CCCAATACAGTCAACCATCTCTA 0: 1
1: 0
2: 0
3: 16
4: 211
Right 1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG 0: 1
1: 0
2: 1
3: 24
4: 314
1086466735_1086466740 4 Left 1086466735 11:87061723-87061745 CCATCTCTATGGCAAATGTGCAG 0: 1
1: 0
2: 0
3: 15
4: 131
Right 1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG 0: 1
1: 0
2: 1
3: 24
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086466740 Original CRISPR AATCACATGGGGAAAGAAAC GGG Intronic
903513925 1:23897233-23897255 AATCACATGGGGCAGAAAACAGG + Intronic
904148847 1:28419282-28419304 TATCAAATGGGGACAAAAACAGG - Intronic
905474875 1:38219031-38219053 TATCACAGAGGGAAAGAAGCTGG - Intergenic
907048460 1:51314189-51314211 CATCACATGGAGAAGGCAACAGG + Intronic
907664942 1:56426485-56426507 GACAACATGGGCAAAGAAACGGG - Intergenic
907827715 1:58035095-58035117 AAGCCCATGTGGAGAGAAACGGG + Intronic
908040113 1:60103476-60103498 TATGAAATGGGGGAAGAAACAGG - Intergenic
909589901 1:77335939-77335961 ACTCACATGGTGAAAGGGACAGG + Intronic
918822276 1:189270274-189270296 TCTCACATGGGGAAAGAAACAGG + Intergenic
920567785 1:206989315-206989337 AACCAAATGGAGAAAGAAGCTGG + Intergenic
920586507 1:207168534-207168556 AATCACAGAGGTAAAGACACAGG - Intergenic
921011944 1:211150466-211150488 AATCAAATGGGGAAAGAGAGAGG + Intergenic
921635392 1:217486700-217486722 AATGGCATGTGGAAAGCAACTGG + Intronic
921725277 1:218516532-218516554 AAACACCTCGGGAAAGAAAAAGG + Intergenic
921892905 1:220370792-220370814 CATGACATGGGCAAAGATACAGG + Intergenic
923840632 1:237667372-237667394 AATCAAATGTAGAAAGAATCCGG + Intronic
924041614 1:239989386-239989408 AATCAGATGGAGAAGGCAACAGG + Intergenic
1065385524 10:25129921-25129943 CATGATATGGGGACAGAAACTGG + Intergenic
1065616031 10:27524693-27524715 AATCAAATTGGGTAAGAAACTGG + Intronic
1066025404 10:31353206-31353228 AGGGACATGGGAAAAGAAACAGG - Intronic
1067780530 10:49200791-49200813 AACCACAGGGAGAAATAAACAGG + Intergenic
1070009616 10:72459482-72459504 AAGCACAAGGGTAAAAAAACAGG - Intronic
1071252675 10:83836990-83837012 AATCACATGGGAACAGAGACAGG - Intergenic
1071695720 10:87867869-87867891 AATAACATGGGAAAGGCAACTGG + Intronic
1072290992 10:93964474-93964496 AATAACTTGAGGAAATAAACAGG + Intergenic
1072405279 10:95146143-95146165 AACCACATCGGAAAAGAAAATGG - Intergenic
1072512126 10:96138314-96138336 AGTAACAAGGGGACAGAAACAGG - Intronic
1072858124 10:98971575-98971597 AATAACATTGTGAAATAAACGGG - Intronic
1073655920 10:105416563-105416585 ACTTACATGGGCAAAGATACTGG - Intergenic
1074741579 10:116489604-116489626 TATCACAGAGAGAAAGAAACAGG + Intergenic
1076121879 10:127942984-127943006 AATCACGTGGGCCAGGAAACCGG + Intronic
1077643739 11:3904964-3904986 TATAAAATGGGGAAAGAAAGGGG + Intronic
1078483246 11:11698573-11698595 AATTACAAGGGGACAAAAACAGG + Intergenic
1078847116 11:15128358-15128380 AATCATATGGGGATACAAAGTGG + Intronic
1079626363 11:22621411-22621433 AATGATATGGAGATAGAAACTGG + Intergenic
1080368052 11:31600208-31600230 AATCACATGGTGAAGAAAAGAGG - Intronic
1080490014 11:32752033-32752055 AGCTACATGGGGAAAGACACTGG - Intronic
1081243953 11:40740829-40740851 ATTCACATGTGGAAAGAAATTGG - Intronic
1081483277 11:43508127-43508149 AGTCACATGGGGAGAAAAATAGG + Intergenic
1083191244 11:61053777-61053799 AAGCAAATGGGAAAAAAAACGGG + Intergenic
1083339317 11:61948680-61948702 ACTGATATGGGGAAAGAAGCAGG - Intergenic
1083939838 11:65889876-65889898 AATAACATAGTGAAAGACACTGG - Intergenic
1086004222 11:82017011-82017033 TATGACCTGGGGAAACAAACTGG + Intergenic
1086343437 11:85870744-85870766 AATACCATGGGGAAAATAACAGG - Intronic
1086466740 11:87061750-87061772 AATCACATGGGGAAAGAAACGGG + Intronic
1087804065 11:102537035-102537057 AATCAGATAGGAAAAGTAACAGG + Intergenic
1087883775 11:103452016-103452038 ATTCACATGAGGAAAAAAAGGGG - Intronic
1087974788 11:104531402-104531424 ATTAACATGTGGAAAGAAGCTGG - Intergenic
1088892402 11:114055465-114055487 AAGCAGAGGGGGAAAGAATCAGG - Intergenic
1090538440 11:127672856-127672878 ATTCACATAGAAAAAGAAACAGG - Intergenic
1090597041 11:128330881-128330903 AATCATATGCTGAAAGATACTGG - Intergenic
1093079555 12:14793789-14793811 AATCAGATGGAGAAAGTGACGGG - Exonic
1093718642 12:22412883-22412905 CATAACCTAGGGAAAGAAACAGG + Intronic
1098424043 12:70339390-70339412 GATCACAGGGGAAAAGAGACGGG - Intronic
1098890195 12:76002446-76002468 CATTGCATGGAGAAAGAAACAGG + Intergenic
1099711265 12:86227889-86227911 ATTAAAATGGGGAAAGAATCTGG - Intronic
1102082280 12:110108156-110108178 TAACACCTGGGGAAAGAGACGGG - Intergenic
1103394429 12:120597144-120597166 AACCACATGGGGATAGAGTCTGG + Intergenic
1104292067 12:127479381-127479403 AATCACAAGGAGAAAGAGAGAGG - Intergenic
1104502128 12:129296542-129296564 TGTCACTTGAGGAAAGAAACAGG - Intronic
1105759279 13:23498605-23498627 ACTGACATGGGGAAGGAAAGGGG + Intergenic
1106355411 13:28977409-28977431 AATGACTTTGGGAAATAAACTGG + Intronic
1106919600 13:34549279-34549301 AATCAAGTGGGGAGAGAAACAGG + Intergenic
1107104615 13:36630027-36630049 AACCACAAGGGCAAAGAAACTGG + Intergenic
1108052301 13:46458106-46458128 TAACACATGGGGAAAGCAAAGGG + Intergenic
1108178332 13:47817314-47817336 AATCAGAGGGGGAAAAAAGCAGG + Intergenic
1108213682 13:48162746-48162768 AGTCTCATGGGAAAAAAAACAGG + Intergenic
1108754306 13:53481396-53481418 AGTCAGAGGGGGCAAGAAACTGG + Intergenic
1109128228 13:58545869-58545891 TCTCACATGAGGAAAGAAACCGG - Intergenic
1109538983 13:63748109-63748131 TAACACATGGGGAAAGCAAAGGG - Intergenic
1109544860 13:63831720-63831742 TAACACATGGGGAAAGCAAAGGG + Intergenic
1109576750 13:64269304-64269326 AGCCACATGTGGAATGAAACTGG + Intergenic
1110419853 13:75294359-75294381 AGTCACATGAGCAATGAAACAGG + Intronic
1112792463 13:103017540-103017562 AAGGACAGGTGGAAAGAAACGGG + Intergenic
1113113700 13:106851821-106851843 AATGACAGGGGGAAAGACAATGG - Intergenic
1113216199 13:108043366-108043388 AATCCTATGGGGTAAGAATCAGG - Intergenic
1115538294 14:34393828-34393850 AATCAAATGGAAAAAAAAACAGG + Intronic
1115828521 14:37307153-37307175 AATCACAGGAGCACAGAAACGGG + Intronic
1116808646 14:49518300-49518322 AATTACATCGGGAAAGAAATGGG + Intergenic
1117078334 14:52126354-52126376 AATCACATGGGAAAAGAGATAGG - Intergenic
1117360722 14:54971031-54971053 AACCACATGCAGAATGAAACTGG + Intronic
1118236376 14:64008790-64008812 AACCACATGCGGAAACAAAGCGG - Intronic
1118440716 14:65809114-65809136 GAACACATGGTGAAAAAAACAGG + Intergenic
1118753873 14:68824338-68824360 AGGCACAAGGGGAAAGTAACTGG + Intergenic
1118838489 14:69493844-69493866 CAACACATGGGGACAGAAAAGGG + Intronic
1120605941 14:86578045-86578067 AAGAACATGGGGAAAGAAGAGGG - Intergenic
1124708712 15:31987032-31987054 AATCACAAGGGAAAGGAAAAGGG - Intergenic
1124725256 15:32150914-32150936 AAACACATAGGGAAAGAGAGAGG - Intronic
1124858486 15:33413790-33413812 AAATACATGGGGAAAAAGACAGG - Intronic
1124868314 15:33515783-33515805 AGACAAATGGGGAAAGAGACTGG - Intronic
1124952830 15:34339060-34339082 AATCACCTGGGCCCAGAAACTGG + Intergenic
1125652882 15:41332139-41332161 AACCACCTGGGGAAGAAAACGGG - Intronic
1125872989 15:43119236-43119258 AATCATATGGATAAAGAAACAGG + Intronic
1126409713 15:48360547-48360569 AACCACATGTGGAAAAAAATAGG - Intergenic
1127039303 15:54955752-54955774 GATCTCATTGGGAAAGAAAATGG + Intergenic
1127512055 15:59652497-59652519 AAAATCATGGGGAAAAAAACTGG - Intronic
1127944337 15:63735223-63735245 AGTCACATAGGGAAAGTAAAAGG + Intronic
1128287815 15:66452717-66452739 AATTACATATGGAAAGCAACTGG + Intronic
1130545512 15:84855319-84855341 AGTGATATGGGGAAATAAACAGG - Intronic
1130554518 15:84913419-84913441 CATCACCTGGGCCAAGAAACAGG - Intronic
1133511605 16:6463660-6463682 AATGACATGGTGAACGAGACCGG - Intronic
1133803606 16:9105794-9105816 AAGGACATGGGAAAAGAATCTGG + Intronic
1134220498 16:12350017-12350039 CATCAGAGGAGGAAAGAAACTGG - Intronic
1134363059 16:13550778-13550800 AATCAAGTTGGGAAAGAAGCAGG - Intergenic
1135619545 16:23943898-23943920 GATCACATGGGGAAGGCACCAGG + Intronic
1135928237 16:26714083-26714105 CATCACTTTGGGAAAGAAAAGGG + Intergenic
1136711872 16:32244462-32244484 AATCACAAGAAGAAGGAAACTGG - Intergenic
1136756044 16:32684944-32684966 AATCACAAGCAGAAGGAAACTGG + Intergenic
1136812069 16:33185428-33185450 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136818545 16:33295508-33295530 AATCACAAGCAGAAGGAAACTGG - Intronic
1136825109 16:33352041-33352063 AATCACAAGCAGAAGGAAACTGG - Intergenic
1136830175 16:33450812-33450834 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137015791 16:35373189-35373211 AATCACAAGCAGAAGGAAACTGG + Intergenic
1137024856 16:35463143-35463165 AATCACAAGCAGAAGGAAACTGG - Intergenic
1137226728 16:46519652-46519674 ATTCACATGAGGAGAGAAAATGG + Intergenic
1138095388 16:54207218-54207240 GCCCCCATGGGGAAAGAAACTGG - Intergenic
1139108172 16:63854438-63854460 AATTACATGGGTAAACAAAAAGG - Intergenic
1139965775 16:70744574-70744596 GATCACCTGGGGAGAGAAGCGGG + Exonic
1140728341 16:77833961-77833983 AATCACCTGGGGAGAGATACTGG - Intronic
1202990647 16_KI270728v1_random:8398-8420 AATCACAAGCAGAAGGAAACTGG - Intergenic
1203058184 16_KI270728v1_random:945297-945319 AATCACAAGCAGAAGGAAACTGG + Intergenic
1143924471 17:10357613-10357635 AATCACTTGGGGGTAGAAAAAGG + Intronic
1144010559 17:11144585-11144607 AGTCACATCGGCAAAGAATCTGG + Intergenic
1148383939 17:47221261-47221283 AATCACAGGGGCAAACCAACAGG - Intronic
1148739943 17:49887185-49887207 AAGCACATGGGGGAGGAAGCAGG - Intergenic
1150647945 17:66991586-66991608 ACTCACATGGGTAAGGATACGGG + Intronic
1150852686 17:68719769-68719791 AAACATATGAGTAAAGAAACAGG + Intergenic
1151393930 17:73807300-73807322 AATCACTTTGGGAAACAATCTGG + Intergenic
1152161778 17:78673307-78673329 AAATTAATGGGGAAAGAAACTGG + Intergenic
1153005421 18:494476-494498 CATCACATTGATAAAGAAACTGG + Intronic
1153112759 18:1611899-1611921 AATCAGATGGGGTATGAAAGAGG + Intergenic
1153144323 18:2012759-2012781 AATCAGATAGAGAAAGAAAATGG - Intergenic
1154056350 18:11016219-11016241 CATCCCACAGGGAAAGAAACAGG + Intronic
1155451254 18:25964762-25964784 AATCACATGGGATAAGGAAGTGG - Intergenic
1156220955 18:35051417-35051439 AATTTCAGGGGGAAAGAAATTGG - Intronic
1157661463 18:49448631-49448653 AAACACAGGGGGAAAAAAGCAGG + Intronic
1158445147 18:57513480-57513502 CATCCCAGTGGGAAAGAAACAGG - Intergenic
1160109732 18:76015035-76015057 AATAACATGGAAAAAGAGACAGG - Intergenic
1162687127 19:12396796-12396818 AATCTAATGGGGAAAAAAAAAGG + Intronic
1164533796 19:29068882-29068904 TAGCACATGGGAAAAGAAAATGG - Intergenic
1164588505 19:29493077-29493099 AATCACAAGGAAAAGGAAACTGG + Intergenic
1165089347 19:33374406-33374428 AATAAAATAGGGAAAGCAACTGG + Intronic
1166273549 19:41734441-41734463 AATCTCTTTGGGAAAAAAACAGG + Intronic
1166330476 19:42075590-42075612 AGTCACATGGAGAGAGAAAAGGG - Intronic
1167040099 19:47019027-47019049 CTTAACATGGGGAAAGAAAATGG - Intergenic
1167906280 19:52663530-52663552 GATGACATGAGGAAAGAAAATGG + Intronic
925556368 2:5135078-5135100 CTTCAGATGGGGAGAGAAACTGG - Intergenic
925985692 2:9213118-9213140 CATAACATGGGGATAGAAAGTGG + Intronic
926947001 2:18199265-18199287 AATCAGATGGTGAAAGAACAGGG + Intronic
928029541 2:27766846-27766868 AAACTCAGGGGGTAAGAAACAGG + Intergenic
928976284 2:37089870-37089892 AGTCACATGTGGAAATAAACAGG + Intronic
929888628 2:45900962-45900984 AAGGACTTTGGGAAAGAAACTGG + Intronic
930177945 2:48319197-48319219 AAATACATGGGGAAAATAACAGG + Intronic
930565025 2:53007964-53007986 ATTTACATGGGAAAAGAAATGGG - Intergenic
931034172 2:58218430-58218452 AAACTCATGTGGAAAGAAAAAGG + Intronic
932097274 2:68862594-68862616 AATAAAAGGGGGAAAAAAACTGG + Intergenic
933348241 2:81118520-81118542 AATCACAATGGTAATGAAACAGG + Intergenic
934892252 2:98080817-98080839 AATCACATTGTGAAAGGCACTGG + Intergenic
934930918 2:98422046-98422068 ACACACATGGGGAAAAAAACAGG + Intergenic
936493189 2:112993402-112993424 TATCTCTTGGGGAAAGAAAAAGG - Intergenic
936806629 2:116340803-116340825 AATCACATGGTGCTAGAAAGAGG - Intergenic
937181372 2:119998773-119998795 AATAAAATAAGGAAAGAAACAGG - Intergenic
938798167 2:134735884-134735906 AAAAACATTGGGATAGAAACAGG - Intergenic
938914036 2:135916772-135916794 TATCAAAATGGGAAAGAAACTGG - Intronic
940100079 2:150027223-150027245 AATCATTTGGGGAAGGAAAAGGG - Intergenic
941298213 2:163767297-163767319 AATCACATGGGGCAAGGTGCAGG - Intergenic
943230752 2:185247848-185247870 TATCACATGGGGAAAGTCACAGG + Intergenic
943851961 2:192734994-192735016 AATCAGATAGGGACACAAACAGG - Intergenic
944285040 2:197939802-197939824 AATCACTTGGGGGAAGACAGTGG - Intronic
945564709 2:211383068-211383090 AAACTGCTGGGGAAAGAAACTGG + Exonic
945566531 2:211407529-211407551 AATCAAAAAGGGAAAGAAATTGG - Intronic
946037017 2:216752216-216752238 AAACATAAGGGGAAAGAAACTGG + Intergenic
946383299 2:219364449-219364471 TTTCACATGGGGAAAGGATCAGG - Intergenic
948362120 2:237429578-237429600 ATGTTCATGGGGAAAGAAACGGG + Intergenic
1169584777 20:7068985-7069007 AATAATATGGAGAAAAAAACAGG - Intergenic
1171083724 20:22216074-22216096 AATCACAAGGGAAAAGTAATAGG + Intergenic
1172269410 20:33645343-33645365 AATCAAATGAGAAAAAAAACAGG - Exonic
1174982703 20:55414866-55414888 TATCAGATGTGGAAAGAAAAAGG - Intergenic
1176589077 21:8622989-8623011 AATCACTTTGGGAATAAAACTGG + Intergenic
1177353075 21:19970657-19970679 AATCAAATTTGGAAAGAATCTGG - Intergenic
1177724416 21:24948661-24948683 AATCACTTTGGCAAAGGAACAGG + Intergenic
1177745823 21:25211963-25211985 AATCAGATGGTAAAAGAAAAGGG - Intergenic
1179049691 21:37878716-37878738 AATCACAAAGGGAAAAATACAGG + Intronic
1180271901 22:10599986-10600008 AATCACTTTGGGAATAAAACTGG + Intergenic
1181033820 22:20160539-20160561 CATCACTTGGGGAAAAAATCAGG - Intergenic
1181037498 22:20176964-20176986 AAACAGATGGGGAAATAAAGTGG - Intergenic
1181452947 22:23036037-23036059 AAGCACATGGGGAAAGGAGCTGG + Intergenic
1182683472 22:32101558-32101580 AAAGACATGGGAAAAGAAATTGG - Intronic
949138241 3:598780-598802 AATCACTTTGGGAATAAAACTGG - Intergenic
950062802 3:10086275-10086297 CAAGACAAGGGGAAAGAAACAGG - Intronic
952538236 3:34336512-34336534 AATCACATGGGTAAAACTACAGG - Intergenic
953833537 3:46323586-46323608 AAAGACATGGAGAAAGAAAGTGG - Intergenic
954739849 3:52740162-52740184 AACCAGATGGGCAAAGAAGCAGG + Intronic
955180527 3:56664775-56664797 CAACACATGGGGAAAAAAAATGG + Intronic
955378299 3:58416404-58416426 AATCACAATGAGATAGAAACTGG - Intronic
955597557 3:60608166-60608188 AATTAGATAGGGAAAGAAAGAGG - Intronic
955966183 3:64391569-64391591 AAAGAAATGGAGAAAGAAACAGG + Intronic
956256894 3:67292661-67292683 AATAACATGGGTAAAGCACCTGG - Intergenic
957632683 3:82737933-82737955 AAACAAATGGGCAAAGAAACAGG - Intergenic
958913549 3:100022634-100022656 AAGCACAGGGGAAAAGAAAGAGG + Intronic
959357204 3:105347164-105347186 AATAACATATTGAAAGAAACAGG + Intergenic
960812309 3:121636645-121636667 AAACAGATGGGGAAAAAATCTGG + Intronic
961004962 3:123398723-123398745 AATGGCATGGGCAAAGAAAACGG - Intronic
961174861 3:124826544-124826566 AATCTCATAGGTAAGGAAACTGG + Intronic
961483858 3:127203252-127203274 AATCCCATGAGGAAAAAAAATGG - Intergenic
961835844 3:129658643-129658665 AATAACATGAGGCAAGAAAGAGG + Intronic
962037377 3:131666791-131666813 AATTACAGGGGGAAAAAAAAGGG + Intronic
962371743 3:134826401-134826423 CATCATATGGGGGAAGATACGGG + Intronic
962671092 3:137709494-137709516 AATATCATGGGGAAGGGAACTGG + Intergenic
965309044 3:167105715-167105737 AATAACATAGGGAAAGCACCTGG - Intergenic
966771917 3:183511562-183511584 TATCACATGGGGAAAGACCTTGG + Intronic
970216667 4:13765955-13765977 AATCATATGGGTAAAGCACCAGG + Intergenic
970508891 4:16760694-16760716 AATCACATGAGCAACTAAACAGG + Intronic
970513712 4:16806305-16806327 AGTTTCATGGGGAAAGAAAGAGG - Intronic
970912706 4:21295727-21295749 TATAGCATGGGGACAGAAACAGG - Intronic
971466191 4:26964586-26964608 AATCACAGGGAGAAAAAAACTGG - Intronic
971829085 4:31666668-31666690 AATCAAATGGGGAAAGCAAAGGG + Intergenic
972747732 4:41955488-41955510 AATTACATGCAGACAGAAACTGG - Exonic
973186386 4:47334315-47334337 AATCACATTAGGAAGCAAACAGG - Intronic
973665447 4:53154344-53154366 TATCACATGGTGAAAGAGAATGG + Intronic
974444344 4:61960309-61960331 GATCACCTGGGGAAAGACAGAGG + Intronic
975429894 4:74276904-74276926 AATTACTTGGGGAAAGAAAGAGG + Intronic
976270542 4:83226234-83226256 AATCTTATGGGGAAAAAAGCAGG + Intergenic
976430192 4:84954420-84954442 AATGCCATGGGGAAAGAACTTGG + Intronic
977517456 4:98039045-98039067 AACCACATTAGGAAAGAAATTGG + Intronic
977556397 4:98491299-98491321 AATCCCAAGGGGAAAAATACTGG - Intronic
979492541 4:121344826-121344848 ATTCACATTGGGAAAGATAAAGG - Intronic
981150160 4:141371277-141371299 AAACAACTGGGGAAAGAAAATGG - Intergenic
982101409 4:151971817-151971839 GATCACATGGTGAAAGAAGAAGG - Intergenic
983854784 4:172630492-172630514 AATCACATTGCCACAGAAACTGG + Intronic
985108421 4:186521433-186521455 GATCACATGGGCAGAGAAGCGGG - Intronic
987363722 5:17129701-17129723 AATCACATGGGAAGAGAATTTGG + Intronic
988684427 5:33513797-33513819 TATCACATGGGCAGAGAAAGGGG - Intergenic
988927973 5:36008348-36008370 AATTACATGGGCAGAGAAAAAGG + Intergenic
993423028 5:87725628-87725650 AATTACTGGGGGAAAAAAACTGG - Intergenic
993426971 5:87777311-87777333 AAGCATATAGGAAAAGAAACAGG + Intergenic
993466340 5:88251144-88251166 AATCATAGGGGTAAAGAAAACGG + Intronic
994471029 5:100207514-100207536 AGTCACACTGGGAGAGAAACGGG - Intergenic
995411977 5:111868209-111868231 AAACACATTTGGAAAGACACTGG - Intronic
997209806 5:132070618-132070640 TATCACAAGGGGAAGGAAATGGG - Intergenic
999790496 5:154935367-154935389 CATGAAATGGTGAAAGAAACGGG + Intronic
1000210550 5:159103475-159103497 AATCACATGGGGAAGGGTGCAGG + Intergenic
1001045994 5:168372203-168372225 AATGACTTGAGGAAAGAAGCAGG + Intronic
1001722517 5:173868320-173868342 AATCACGTGGGGATAGAGAAGGG + Intergenic
1001817342 5:174681052-174681074 AGTCACATGATGAAAGACACAGG + Intergenic
1003488807 6:6602713-6602735 TATCTCAAGGGGGAAGAAACTGG + Intronic
1005421135 6:25652293-25652315 AATCAGATAGCGAAAGAAGCAGG + Exonic
1005715340 6:28542242-28542264 AAACAAAAGGGGAAAGAATCTGG - Intergenic
1006132433 6:31877573-31877595 AAGGCTATGGGGAAAGAAACTGG + Intronic
1006262428 6:32886451-32886473 AAAGGCATGGGTAAAGAAACTGG - Intergenic
1007315760 6:40987404-40987426 AATAAAAAGGGGAAAAAAACAGG + Intergenic
1008380204 6:50832606-50832628 AATGACATTGGGAAACAACCAGG - Intronic
1008501049 6:52183495-52183517 AATAAAATGGGGAAACAAAATGG - Intergenic
1008836006 6:55831092-55831114 AACCAAGTGGGGAAAGAAGCCGG - Intronic
1010035555 6:71321600-71321622 AATAAACTGTGGAAAGAAACTGG + Intergenic
1012312884 6:97749841-97749863 AATGACATGGGAAAAGAGAAGGG - Intergenic
1012931919 6:105326383-105326405 AGTCACATTTGGAAAAAAACAGG - Intronic
1013274270 6:108569321-108569343 AATAAAATGGTGAAAGATACTGG - Intronic
1013307869 6:108866536-108866558 ACTTACATGGGGAAGGGAACTGG + Intronic
1013648447 6:112169168-112169190 AATCTCAAGGGGAGAGAAGCTGG + Intronic
1013866875 6:114709189-114709211 AAGTACATGGAGAAAGAATCAGG - Intergenic
1014925172 6:127261904-127261926 AATCACATGGAAAAAGTAAGTGG + Intergenic
1016149859 6:140727020-140727042 CATTACATGGTGAAAGAAAAGGG - Intergenic
1016617576 6:146070294-146070316 AATTACATTAGGAAAAAAACTGG + Intronic
1017089460 6:150745702-150745724 AATCACATGCGGAGAAAAATGGG + Intronic
1017120872 6:151022832-151022854 AAGAGCATGGGGGAAGAAACAGG - Intronic
1018884698 6:167924889-167924911 GAGCAAATGGGGAAAGAAAAAGG - Intronic
1019145894 6:169975432-169975454 AATCCCATGGGGACCGAGACCGG - Intergenic
1020027625 7:4910444-4910466 AATTCAGTGGGGAAAGAAACAGG - Intronic
1021352473 7:19612292-19612314 AATTACATGGGAAAATGAACTGG + Intergenic
1022414059 7:30163236-30163258 ATTCATTTGGAGAAAGAAACTGG - Intergenic
1023431812 7:40101161-40101183 AGTCACATGGAAAAATAAACAGG - Intergenic
1023768142 7:43531123-43531145 AATCACATCGGAAAAGAGTCAGG - Intronic
1024285397 7:47752932-47752954 AATCTCATGGGGATAGAGAGTGG - Intronic
1024653586 7:51430101-51430123 AATGACATGTGGAAATAAATTGG - Intergenic
1028483936 7:91337823-91337845 AATTACATGGGAGAAGAAAATGG + Intergenic
1029457917 7:100680225-100680247 GACTAGATGGGGAAAGAAACGGG + Exonic
1029654662 7:101916342-101916364 AGACATCTGGGGAAAGAAACGGG - Intronic
1030788482 7:113693526-113693548 AATCAGATGGGGAAGGGAATGGG + Intergenic
1031956275 7:127945575-127945597 AATCACATACGGAACCAAACTGG + Intronic
1032777739 7:135131835-135131857 ACTAACATGAGGAATGAAACAGG + Intronic
1032989535 7:137377288-137377310 AATCACATAGGAAAAAAAAGAGG + Intergenic
1033840354 7:145366088-145366110 AAACACACAGGAAAAGAAACAGG - Intergenic
1033857924 7:145587976-145587998 GATCACATGAGGAAGGAAAGAGG - Intergenic
1034140614 7:148812120-148812142 AATCACTTGGGGAAAGTAGAGGG - Intronic
1034366780 7:150556948-150556970 ATTCAGATGTGCAAAGAAACAGG + Intergenic
1034544321 7:151779908-151779930 AAGGAGATGGGGAAAGAAAGGGG + Intronic
1034924323 7:155109210-155109232 AATCACGGGGGGAAATCAACAGG - Intergenic
1035302452 7:157906429-157906451 AACGACATGGGGAAAGAGAATGG - Intronic
1035926185 8:3730212-3730234 AACCATATGGGGAATCAAACTGG - Intronic
1036485383 8:9174434-9174456 AGGCACATGGAGAAAGAAAGAGG + Intergenic
1037041245 8:14237606-14237628 AATCACATGGGGCAGTTAACCGG - Exonic
1037054337 8:14419914-14419936 AATGACATGGGGGATGAAAAAGG - Intronic
1038720550 8:30031661-30031683 ATTTGCATGGGGAAAGAGACTGG - Intergenic
1039607609 8:38895403-38895425 ATTTTCATGGGGAATGAAACAGG - Intergenic
1040032999 8:42843018-42843040 CCTCACTTGTGGAAAGAAACGGG + Exonic
1040857685 8:51966410-51966432 TATGACATGTGCAAAGAAACAGG - Intergenic
1042846293 8:73172589-73172611 AAACACAGGGGGAAAGAACAGGG - Intergenic
1044351791 8:91175176-91175198 AATCTCATGGGGACTCAAACAGG + Intronic
1045345052 8:101286420-101286442 AGTCACATAGGGGAAGAATCAGG - Intergenic
1045457810 8:102399043-102399065 AATCACAAGGGCATGGAAACAGG + Intronic
1045566586 8:103322661-103322683 AATAAATTGGGGAAAGAAACTGG + Intronic
1045956742 8:107917071-107917093 AATAACAAGGGGAAAGAAAGAGG + Intronic
1046208542 8:111037789-111037811 AAGCACATTGGGGAAGAAATCGG + Intergenic
1046276397 8:111966110-111966132 AATCACATGGGAAAATGAGCAGG - Intergenic
1046548522 8:115682502-115682524 AAAAAGATGAGGAAAGAAACAGG + Intronic
1046617506 8:116493608-116493630 AATTACATTGGGAAAGATCCTGG + Intergenic
1048021618 8:130544773-130544795 AATGACCAGGGGCAAGAAACTGG - Intergenic
1049817540 8:144614258-144614280 TATCAGGTGTGGAAAGAAACAGG - Intergenic
1050531148 9:6590534-6590556 CATCACATGGCAAAAGAAAAAGG - Intronic
1051017816 9:12502236-12502258 AATAAAATGGGAATAGAAACAGG - Intergenic
1051462648 9:17339698-17339720 ATTCTCATGAGGGAAGAAACTGG + Intronic
1052341757 9:27370537-27370559 CTTCACATGGAGAAAGAAAAAGG - Intronic
1053339742 9:37314338-37314360 AATCACATTTGGGAAGACACAGG + Intronic
1054803267 9:69374047-69374069 TAACCCATGGTGAAAGAAACAGG - Intronic
1054830311 9:69617627-69617649 AATGTCATGGGGAAAAAAAACGG + Intronic
1055371587 9:75605565-75605587 AATCCCATAGGGAGACAAACAGG - Intergenic
1055492923 9:76824786-76824808 AATCACATGAGGAAACAGACAGG + Intronic
1057518033 9:95738087-95738109 AGACAGTTGGGGAAAGAAACAGG + Intergenic
1057780453 9:98045707-98045729 CATCAGATGGGGTCAGAAACAGG + Intergenic
1060507951 9:124212474-124212496 AATCAGATCGGAAAACAAACTGG - Intergenic
1060679642 9:125550385-125550407 AATCACATGGGCTCAGAAATGGG + Intronic
1061532889 9:131228704-131228726 AATCCCAAGAGGAAAGAATCTGG - Intronic
1061543840 9:131292326-131292348 TGTCACATGGGGAAAGAAGGTGG - Intronic
1203619080 Un_KI270749v1:101569-101591 AATCACTTTGGGAATAAAACTGG + Intergenic
1185886475 X:3788061-3788083 AATCACATAGACAAAGAAAAAGG + Intergenic
1186749036 X:12602505-12602527 AATGACATGGGGAATGAAGTTGG + Intronic
1187096314 X:16152223-16152245 AATCACATGGAGAGAGACAGAGG - Intronic
1187607113 X:20897249-20897271 AATCTCATGGTGAATGAAAATGG + Intergenic
1188263684 X:28044139-28044161 ATTCACATAGTAAAAGAAACAGG + Intergenic
1188747539 X:33864438-33864460 CAACAGATGGGGAAAGAAAAGGG + Intergenic
1189053142 X:37667865-37667887 CATCACATGGGGAGAGAAGAAGG + Intronic
1190459342 X:50656450-50656472 ATTCACATGCGGAATGAAATTGG - Intronic
1192219609 X:69188442-69188464 AATCACTTAGGGGAAGGAACTGG + Intergenic
1192323286 X:70109830-70109852 AAGCCCTTGGGGAAAAAAACTGG - Intergenic
1192612573 X:72582198-72582220 AAACACATGGTGAAAGACAGAGG + Intronic
1193492261 X:82164444-82164466 AAAGACATGGGGAAAGCATCTGG + Intergenic
1195873756 X:109516035-109516057 AATCAAATCGGGAATGAAAAAGG + Intergenic
1197431480 X:126371764-126371786 AATCACAGGCAGAATGAAACTGG + Intergenic
1198493871 X:137170690-137170712 AATTCCATGGGGAAAAAGACTGG + Intergenic