ID: 1086472940

View in Genome Browser
Species Human (GRCh38)
Location 11:87135605-87135627
Sequence ATGTTTAAACCCAAACCATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086472940 Original CRISPR ATGTTTAAACCCAAACCATG CGG Intronic
903087001 1:20870264-20870286 GTGTTTAAAAGCAAAGCATGAGG - Intronic
906675504 1:47690549-47690571 CTGTGTAAACCCAGCCCATGAGG - Intergenic
908052725 1:60250110-60250132 ATGTTGAAACCAAAACCATTGGG - Intergenic
909748647 1:79131525-79131547 AAATTTAAACCCAAACCATCTGG - Intergenic
909785226 1:79603944-79603966 ATGTTTAAACCCTAACAAAATGG + Intergenic
917241557 1:172954377-172954399 ATGTTTCAATCCCAACCATGAGG - Intergenic
918948189 1:191098089-191098111 ATGTTTAATCTCAAAACATTTGG - Intergenic
919280490 1:195483142-195483164 TTGTTTAAAAACAAATCATGGGG + Intergenic
920300683 1:204986861-204986883 ATGATGAAAACCAAACCAAGGGG - Intronic
921317509 1:213905950-213905972 ATGTTTAAACAAATAACATGCGG + Intergenic
1063264288 10:4429875-4429897 ACCTCTAAACCCAAATCATGAGG + Intergenic
1064614713 10:17141075-17141097 ATGTCTCATCCAAAACCATGAGG - Intergenic
1067950807 10:50737025-50737047 ATTTTAGAACCCAAAACATGGGG + Intergenic
1068272261 10:54743778-54743800 ATTTTATAACCCAAAACATGGGG - Intronic
1069735694 10:70652665-70652687 CTGCTAAAACCCAAAGCATGGGG + Intergenic
1070886152 10:79902244-79902266 ATTTTAGAACCCAAAACATGGGG + Intergenic
1071513979 10:86284945-86284967 ATGTCAAGACCTAAACCATGGGG + Intronic
1072734541 10:97869901-97869923 ATGGTAAAGCCCAAACCAGGTGG - Exonic
1073778903 10:106815500-106815522 ATTATCAAACCCAAACCATTTGG - Intronic
1074122172 10:110500971-110500993 ATATTTAAAGCCAAAAGATGGGG + Intronic
1078495873 11:11816339-11816361 ATATTTAAACCCAGACAATCCGG - Intergenic
1079087645 11:17458318-17458340 TTGTTTATACACAAACCCTGGGG - Intronic
1080551734 11:33378462-33378484 AGGGCTAAACCCAAACAATGTGG - Intergenic
1083514525 11:63244148-63244170 ATCTTTAAACACGAACTATGTGG - Intronic
1084002888 11:66307304-66307326 ATGTAGAAACTCAAACAATGTGG + Intergenic
1084636002 11:70393049-70393071 ATGTTTAGAACCAGGCCATGTGG - Intergenic
1086472940 11:87135605-87135627 ATGTTTAAACCCAAACCATGCGG + Intronic
1087495978 11:98891017-98891039 ATGTTAATATCCAAACAATGTGG - Intergenic
1087512766 11:99119191-99119213 ATAGGTAAACCCAAGCCATGGGG + Intronic
1087844432 11:102956283-102956305 GTGTTTAAATTCCAACCATGGGG - Intergenic
1088292706 11:108258403-108258425 ATTTTTTGACCCAAACTATGTGG + Intronic
1089896731 11:121937839-121937861 AAGTTACAAACCAAACCATGAGG - Intergenic
1090362168 11:126181222-126181244 ACTTTTAAACCCAAACAATTAGG + Intergenic
1094106567 12:26818092-26818114 ATGTTTAAAACTAAATAATGTGG + Intronic
1096506873 12:52099244-52099266 ATGTTAAAAACCAAATCACGGGG + Intergenic
1096508655 12:52114595-52114617 ATGTTAAAAACCAAATCACGGGG - Intergenic
1097745210 12:63294023-63294045 ATGCTTAACTCCAAACCAAGTGG + Intergenic
1097881335 12:64689390-64689412 CTTTTTAAAAACAAACCATGGGG + Intronic
1102193570 12:111007893-111007915 ATGTTGAAGCCCTAACCTTGAGG - Intergenic
1104269852 12:127273294-127273316 ATGTGTAAACTCAACCAATGGGG - Intergenic
1104583903 12:130031550-130031572 AAATTTAAACCCAAAACATCAGG - Intergenic
1108131379 13:47304847-47304869 CTGTTAAAACCCAAACCAGTTGG - Intergenic
1112312722 13:98333825-98333847 AACTTTAAATCCAAACCCTGGGG - Intronic
1113888356 13:113723433-113723455 ATGTGTAAAACCAAACTGTGCGG - Intronic
1114806414 14:25842047-25842069 ATGTCAATACCCATACCATGAGG - Intergenic
1115630925 14:35244529-35244551 ATGTTTAAACCCAATCATTCAGG - Intronic
1117300268 14:54418857-54418879 ATGTTAAAAATCAAACGATGCGG + Intronic
1117734770 14:58757317-58757339 ATTCTTAACCCCAAGCCATGTGG - Intergenic
1127646208 15:60961887-60961909 ATGTCTAAACCCAGCGCATGTGG - Intronic
1127665452 15:61141758-61141780 ATATTTAAACCCAAAGCAGTAGG - Intronic
1127883355 15:63177360-63177382 ATGTTTAAACACAGACCAAGTGG + Intergenic
1129804162 15:78440245-78440267 ATGTGTAATCCCAAAACTTGGGG - Intronic
1131576804 15:93600537-93600559 ATGTTTAAACCTAAGCCATATGG + Intergenic
1131942140 15:97578596-97578618 ATGTAAAACCCCAAACCATAAGG - Intergenic
1132151421 15:99463254-99463276 ATAATTAAACCCAAAGCAAGTGG + Intergenic
1134178065 16:12024645-12024667 ATGATGTAACCCAAACCTTGGGG + Intronic
1137651277 16:50122693-50122715 ATGTGTCAAGCCAAGCCATGAGG + Intergenic
1139273116 16:65701681-65701703 AGATTTAAACCCAAATCATCTGG - Intergenic
1140376194 16:74447132-74447154 ATGTTTAAGCCCACATCATGAGG - Intergenic
1141916129 16:87098594-87098616 ATTTTAAAAACCACACCATGAGG - Intronic
1143345877 17:6248669-6248691 CTGCTTAAACCCAAACCCAGTGG - Intergenic
1144362517 17:14508762-14508784 ATGTTTAAATCCTAACCTGGAGG + Intergenic
1146685145 17:34836491-34836513 ATGTTTACATTCAATCCATGGGG - Intergenic
1149589249 17:57816328-57816350 ATGTTGAAACCTAACCCGTGAGG - Intergenic
1150368939 17:64619030-64619052 ATCTTTAAAACAACACCATGAGG - Intronic
1151177245 17:72298956-72298978 ATCTTTAAACCCAAACACTCAGG - Intergenic
1153606347 18:6837332-6837354 ATACCTATACCCAAACCATGAGG + Exonic
1156355406 18:36336093-36336115 CTGTCTAAAACCAAACCGTGTGG + Intronic
1156827100 18:41444023-41444045 ATGATTAAACCCAGTCCTTGTGG - Intergenic
1157019620 18:43764162-43764184 ATGTTTTAACTCATTCCATGAGG + Intergenic
1159182133 18:64921905-64921927 ATGTTTAAACAAACATCATGTGG + Intergenic
1159192752 18:65069366-65069388 ATGTTTAAACCAAAATAATATGG + Intergenic
1163888539 19:19990715-19990737 ATGTACAAAACCAAACTATGTGG + Intergenic
1164034953 19:21444814-21444836 ACATTTAAAACAAAACCATGAGG - Intronic
929382857 2:41372962-41372984 ATTTGTAAACCCATATCATGGGG - Intergenic
931366105 2:61620513-61620535 CTTTTTATACTCAAACCATGTGG + Intergenic
935466809 2:103408236-103408258 ATTTTTAAAGCCAAATCATTTGG - Intergenic
935972950 2:108548429-108548451 ATGTTTTAACCCTGAGCATGTGG + Intronic
937276526 2:120688012-120688034 ATGGTTAAGCCCATAGCATGTGG - Intergenic
938219995 2:129557636-129557658 ATATTTAAACCCACATCATTTGG - Intergenic
940101950 2:150050442-150050464 ATATTTAAGCCCCAACCATCTGG + Intergenic
941570325 2:167161734-167161756 ATGTTAATCCCCAAACAATGGGG - Intronic
941581827 2:167306881-167306903 ATGTTTAAATAGTAACCATGAGG - Intergenic
942464602 2:176194759-176194781 ATGTTTAGACGCTAACAATGTGG - Intergenic
942784723 2:179687990-179688012 ATGTTCAAACCAAATCTATGGGG - Intronic
943741569 2:191415778-191415800 ATGTGTAAACCCATACCTGGAGG + Intronic
948865494 2:240772830-240772852 AGCATTGAACCCAAACCATGTGG + Intronic
1168968238 20:1913178-1913200 ATATTTACACCCAAAGCAGGTGG + Intronic
1173051557 20:39567074-39567096 ATGTTCCAACCCAAATCATCTGG - Intergenic
1178759450 21:35386938-35386960 GTGTTTAAAGCAAAACCAAGAGG - Intronic
1179149180 21:38795704-38795726 ATGATCAATCCCAGACCATGGGG - Intergenic
1182811033 22:33116712-33116734 TTGTTTCAACCCAGAGCATGAGG - Intergenic
1184749978 22:46479656-46479678 ATTTTTAAAACCAAACCACTAGG + Intronic
950778598 3:15372051-15372073 ATGGTGAAGCCCTAACCATGTGG - Intergenic
950910770 3:16588797-16588819 ATGTTTAAACCCAAAACAAATGG - Intronic
951452255 3:22852642-22852664 ATGTTAATCCCCAAACAATGGGG - Intergenic
952324550 3:32309236-32309258 AAGTTTAAACCCAAATCAGCTGG - Intronic
955115605 3:55996905-55996927 ATGGCTAAAGCCAAACTATGGGG + Intronic
956259781 3:67326506-67326528 AAGTCTAAACCCAAATCATTCGG - Intergenic
956818715 3:72932588-72932610 GTGGTAAAACCCAATCCATGTGG - Intronic
957925503 3:86805477-86805499 AAGTTTAAACTTAAACCATGAGG - Intergenic
959326652 3:104945465-104945487 CTGTTTAAATCTAAACCATATGG + Intergenic
959982233 3:112529081-112529103 ATGTTAAAAACCAAATCATGGGG - Intergenic
960885758 3:122392646-122392668 TTGTTAAAACACAAATCATGAGG - Intronic
961500063 3:127326108-127326130 TTGTTTCAACCAAAACCAAGAGG + Intergenic
964418391 3:156473991-156474013 ATGTTTCAGCCCTAACCATTTGG - Intronic
964476633 3:157103511-157103533 ACATTAAAACCGAAACCATGTGG + Intergenic
965127807 3:164651668-164651690 ATGTTTACAACCAGACCTTGAGG + Intergenic
967352616 3:188530832-188530854 ATATCTAAACCCAACCCATTAGG + Intronic
967614431 3:191547644-191547666 ATGTTAAACTCCAAACAATGGGG - Intergenic
971607283 4:28673888-28673910 ATGTTTAAGCTCCCACCATGTGG - Intergenic
971967632 4:33580684-33580706 ATGTTAAAAACAAAATCATGCGG - Intergenic
972678280 4:41281107-41281129 ATGTTTAAATCCAAACTGAGCGG + Intergenic
975250641 4:72174403-72174425 ATTTTTAAACCCCTACCATTTGG - Intergenic
976018426 4:80589267-80589289 ATGTTTAAACTCAAGCAATCTGG + Intronic
976213599 4:82694615-82694637 ATGTTTGTACCCCCACCATGTGG + Intronic
976479827 4:85528235-85528257 ATGTATAAACCCAACTGATGTGG - Intronic
977201029 4:94116802-94116824 CAGTTTAAACCCAGTCCATGTGG + Intergenic
982519602 4:156397436-156397458 TTATTTTAACCCAAACCATTTGG + Intergenic
992618898 5:78573237-78573259 AGCCTTAAACCCAATCCATGAGG + Intronic
996544514 5:124663553-124663575 GTGTATAAAACCAAACCATTTGG - Intronic
998552813 5:143093854-143093876 AGGTTCAACCCCACACCATGGGG + Intronic
1000245455 5:159445294-159445316 AGGTTTAAACACAGAACATGTGG + Intergenic
1003606735 6:7569148-7569170 ATGAATAAAGCCAAACCCTGGGG + Intronic
1004451821 6:15754608-15754630 GTCTTTAAACCAATACCATGTGG + Intergenic
1008056669 6:46952759-46952781 ATGTCTAAACCCATAGCATTTGG - Intronic
1010656521 6:78518127-78518149 AGGTCTAAACCCCAACCTTGGGG - Intergenic
1011518509 6:88178964-88178986 ATTTTTAAACCAAAAAAATGTGG + Intergenic
1012995975 6:105975208-105975230 CTATGTAAACCAAAACCATGCGG + Intergenic
1014257578 6:119178341-119178363 ATGTTTCAGCCTAATCCATGGGG + Exonic
1014777881 6:125531503-125531525 ATTTTTAAACCAAAACCACTAGG + Intergenic
1017019682 6:150130308-150130330 ATCATCAAACCCACACCATGGGG - Intergenic
1018600463 6:165533032-165533054 ATGGCTAAAACTAAACCATGTGG + Intronic
1019691668 7:2418274-2418296 AGGTTTAAACGCAAACACTGTGG - Intronic
1022843575 7:34188879-34188901 AGGCTTAAACCCCAACCATGGGG - Intergenic
1023337894 7:39189010-39189032 ATGATGGACCCCAAACCATGTGG - Intronic
1023787087 7:43718504-43718526 ATTTTAAATCCCAAACCCTGAGG - Intronic
1024001595 7:45193458-45193480 ATGTTTATACACACACAATGGGG + Intergenic
1024561890 7:50651788-50651810 ATTCTTCAACTCAAACCATGTGG + Intronic
1025217921 7:57075584-57075606 AGGGGTAAGCCCAAACCATGTGG - Intergenic
1025628838 7:63249223-63249245 AGGGGTAAGCCCAAACCATGTGG - Intergenic
1025653425 7:63494873-63494895 AGGGGTAAGCCCAAACCATGTGG + Intergenic
1025809046 7:64862500-64862522 ATGTTTAATCCAACACAATGGGG + Intergenic
1027596971 7:80185818-80185840 ATGTTGAAACCCTAACCACGTGG + Intronic
1028263681 7:88695952-88695974 ATGATGAAGCCCAAACCCTGGGG - Intergenic
1030299461 7:107960691-107960713 TTGCTTAAACCCATGCCATGGGG - Intronic
1031457394 7:121999220-121999242 ATGATTATACCCAGGCCATGAGG - Intronic
1032328295 7:130952592-130952614 ATACTTTAACCCAAACCATGAGG + Intergenic
1032834398 7:135659968-135659990 ATGTTAAAACACAGACCAGGGGG + Intergenic
1034383136 7:150716525-150716547 CTCTTTAAACCATAACCATGGGG + Intergenic
1034592225 7:152151184-152151206 ATGTATAAAACCAAACTATGTGG + Intronic
1036239726 8:7071668-7071690 GAGTTTTAACCCAAACTATGGGG + Intergenic
1036372910 8:8175912-8175934 GTGTTTTAACCCAAACTGTGGGG + Intergenic
1036877995 8:12489729-12489751 GTGTTTTAACCCAAACTGTGGGG - Intergenic
1039389644 8:37167695-37167717 AGGTTTAAACCCAAACCATATGG + Intergenic
1040783875 8:51142301-51142323 ATGTTGAAACCCTAACCAATAGG + Intergenic
1043846977 8:85175132-85175154 ATGTTGAAACCCTAACCCTCGGG + Intergenic
1045648096 8:104318734-104318756 ATGTTTATACCCAAATTATTGGG - Intergenic
1047925066 8:129674641-129674663 ATCTGTAAACCCAAACCACTAGG + Intergenic
1048843548 8:138585365-138585387 ATATTTCAACCCAAACCTTGGGG - Intergenic
1051339377 9:16097119-16097141 AAGCTGAAACCCAACCCATGAGG + Intergenic
1055363161 9:75517013-75517035 ATTTTCAAACCCAAAATATGGGG - Intergenic
1055417390 9:76098229-76098251 ATATTTAAACCCAGACATTGTGG - Intronic
1056512535 9:87319591-87319613 ATGGATAATACCAAACCATGAGG + Intergenic
1056687118 9:88775985-88776007 ATGTTTAAACTCAAACCTGAAGG + Intergenic
1062513706 9:136921703-136921725 TTTTTTAAACCCCAACTATGGGG + Intronic
1185811513 X:3114751-3114773 GTGTTTATACCTAAATCATGAGG - Intergenic
1187110205 X:16290539-16290561 TTCTTTAAAACCAAACCATGAGG + Intergenic
1187394060 X:18905089-18905111 ATGTTTTTACCCAAACCAAAGGG + Intronic
1188340638 X:28997002-28997024 ACATTTAAACTGAAACCATGGGG - Intronic
1194365311 X:93006819-93006841 ATGTTAATCCCCAAACAATGGGG - Intergenic
1195962342 X:110398741-110398763 ATGTTTACAACCCAACTATGAGG - Intronic
1196028055 X:111063541-111063563 ATGGTTGAATCCAAAGCATGGGG - Intronic
1197945687 X:131836990-131837012 ATGTGTAAAACAAAATCATGAGG - Intergenic
1200673531 Y:6123077-6123099 ATGTTAATCCCCAAACAATGGGG - Intergenic
1201269790 Y:12243557-12243579 GTGTTTATACCTAAATCATGAGG + Intergenic
1201536486 Y:15053775-15053797 TTGTTTTAACCTAAGCCATGCGG + Intergenic
1202276875 Y:23131294-23131316 ATGTTTAAACCCAAAACAAATGG - Intronic
1202289153 Y:23289395-23289417 ATGTTTAAACCCAAAACAAATGG + Intronic
1202429867 Y:24765008-24765030 ATGTTTAAACCCAAAACAAATGG - Intronic
1202440925 Y:24905079-24905101 ATGTTTAAACCCAAAACAAATGG + Intronic