ID: 1086473743

View in Genome Browser
Species Human (GRCh38)
Location 11:87147074-87147096
Sequence CACTCTGGGAAGCCGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4175
Summary {0: 1, 1: 2, 2: 77, 3: 979, 4: 3116}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086473739_1086473743 -10 Left 1086473739 11:87147061-87147083 CCAGTAATCCCAGCACTCTGGGA 0: 7643
1: 296201
2: 259723
3: 149283
4: 132738
Right 1086473743 11:87147074-87147096 CACTCTGGGAAGCCGAGACAGGG 0: 1
1: 2
2: 77
3: 979
4: 3116
1086473736_1086473743 -3 Left 1086473736 11:87147054-87147076 CCTCACACCAGTAATCCCAGCAC 0: 2
1: 776
2: 1983
3: 2836
4: 2591
Right 1086473743 11:87147074-87147096 CACTCTGGGAAGCCGAGACAGGG 0: 1
1: 2
2: 77
3: 979
4: 3116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086473743 Original CRISPR CACTCTGGGAAGCCGAGACA GGG Intronic
Too many off-targets to display for this crispr