ID: 1086486071

View in Genome Browser
Species Human (GRCh38)
Location 11:87303351-87303373
Sequence TTTTCCACTGACTGGGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 1, 2: 17, 3: 65, 4: 369}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086486071_1086486076 4 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486076 11:87303378-87303400 TCTTCCGTGAAACCGGTCCCTGG 0: 7
1: 121
2: 858
3: 1214
4: 1516
1086486071_1086486075 -3 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486075 11:87303371-87303393 AAAATTCTCTTCCGTGAAACCGG 0: 1
1: 28
2: 484
3: 750
4: 1071
1086486071_1086486081 20 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486081 11:87303394-87303416 TCCCTGGTGCCAAAAAGGTTGGG 0: 956
1: 1606
2: 1390
3: 917
4: 585
1086486071_1086486080 19 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486080 11:87303393-87303415 GTCCCTGGTGCCAAAAAGGTTGG 0: 923
1: 1683
2: 1429
3: 952
4: 599
1086486071_1086486083 21 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486083 11:87303395-87303417 CCCTGGTGCCAAAAAGGTTGGGG 0: 949
1: 1567
2: 1323
3: 855
4: 618
1086486071_1086486078 15 Left 1086486071 11:87303351-87303373 CCAGCCACCCAGTCAGTGGAAAA 0: 1
1: 1
2: 17
3: 65
4: 369
Right 1086486078 11:87303389-87303411 ACCGGTCCCTGGTGCCAAAAAGG 0: 149
1: 1181
2: 1479
3: 1023
4: 537

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086486071 Original CRISPR TTTTCCACTGACTGGGTGGC TGG (reversed) Intronic
901267817 1:7925493-7925515 TTTTCCACGGACTGGGTGGGTGG + Intronic
901479413 1:9514486-9514508 TTGTCCACTGAGAGGGTGGAGGG + Intergenic
901714234 1:11140297-11140319 TATTCCACAGATTGGGTGGGGGG + Intronic
902221377 1:14967973-14967995 TTTTCCACGGACCAGGTGTCCGG + Intronic
902592734 1:17486635-17486657 TTTTCCACAGACTGAGTCGGGGG - Intergenic
904277761 1:29395352-29395374 CTTCCCACTGCCTGGGTGCCCGG + Intergenic
905688945 1:39928646-39928668 TTTTCCACAGACTGGGGTGCGGG - Intergenic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906664740 1:47612529-47612551 TTTTCCACGGACATGGGGGCAGG - Intergenic
907150819 1:52285783-52285805 TTTTCCACGGACTGTGGGGAAGG - Intronic
907389946 1:54151646-54151668 TCTGCCAGTGACTGGGTGACTGG + Intronic
908081909 1:60589925-60589947 TTGACCACTGACTGTGTGCCAGG - Intergenic
908309075 1:62857573-62857595 TTCTCCACGGACTGGGGGGGTGG - Intronic
908611767 1:65868925-65868947 TTTTCCACAGACGGGGTGGTGGG - Intronic
909617365 1:77626254-77626276 TTTTCCACAGACTGGGTGATGGG + Intronic
911719728 1:101177817-101177839 TTTTCCACAGAGTGGGTTGGGGG - Intergenic
911745214 1:101434465-101434487 CTTTCCACTCTCTGGCTGGCTGG - Intergenic
912904489 1:113689591-113689613 TTTTCCACGGACCTGGGGGCAGG + Intergenic
915519463 1:156433041-156433063 TTTTCCTCTGCCTGGCTGGGTGG + Intergenic
915946914 1:160159505-160159527 TTTTCCACCAACTGTGTGGAAGG + Exonic
918453456 1:184683682-184683704 TTTTCCACAGACAGGTAGGCTGG + Intergenic
920033955 1:203053764-203053786 TTCTCCACTGCCTGGGATGCTGG + Exonic
921533379 1:216313035-216313057 TTTTCCACGAACTGGGTGTGAGG + Intronic
921638786 1:217527216-217527238 TTTTCCACAGACTGGGGGTAGGG - Intronic
921894131 1:220381226-220381248 GCTTTCTCTGACTGGGTGGCTGG - Intergenic
922102220 1:222486571-222486593 TTTTCCACAGACTGGGAGTGAGG + Intergenic
922263302 1:223961677-223961699 TTTTCCACAGACTGGGAGTGAGG + Intergenic
923811248 1:237319694-237319716 TTATCCACGGACAGGTTGGCTGG - Intronic
924345143 1:243066691-243066713 TTTTCCACAGACTGGGAGTGAGG + Intergenic
924695673 1:246397319-246397341 TTTTCCACAGACTGGAGGACAGG - Intronic
1064314332 10:14240702-14240724 TTTTTCACTGCCTGTGTGGAAGG - Intronic
1064676944 10:17769927-17769949 ATTCTCACTAACTGGGTGGCAGG - Intronic
1064838573 10:19562911-19562933 TTTTCCACGGATGGGGTGCCAGG - Intronic
1065373970 10:25017468-25017490 TTTCTCACTGCCTGGTTGGCTGG + Intronic
1065631418 10:27684790-27684812 TTTTCCACAGACCGGGGAGCGGG + Intronic
1065939564 10:30551760-30551782 TTTTCCACAGACTGGGGTGGGGG + Intergenic
1066731193 10:38438118-38438140 TTTTCCACAGACTGGGAGTAAGG - Intergenic
1068603309 10:58978451-58978473 TTTTCCACAGACTGGGAGGCGGG + Intergenic
1069605065 10:69733698-69733720 TTTTCCATAGACGGGGTGGGGGG - Intergenic
1069681403 10:70288249-70288271 TTTTCCACGGACTCGGGGGTGGG - Intergenic
1070048402 10:72862440-72862462 TTTTCCACTGACAGTGGGGGCGG + Intronic
1071363656 10:84877202-84877224 TTTTCAACAGAATGGGAGGCAGG - Intergenic
1072656361 10:97333313-97333335 TTTCCCACCGATTCGGTGGCTGG - Exonic
1073276420 10:102315499-102315521 TTTTCCACAGACAGTGGGGCTGG + Intronic
1073505615 10:103986140-103986162 TTTTCCACAGACTGGATGCGGGG + Intronic
1074069589 10:110052558-110052580 TTTTCCACAGACTGGGGGTCGGG - Intronic
1075307828 10:121383455-121383477 TTTTCCACAGACTGGGGGCAAGG + Intergenic
1076815656 10:132913596-132913618 TTTTCCACGGACTGGCTGGGTGG - Intronic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1077318741 11:1930929-1930951 TTTTCCACAGTCTGGCTGGCTGG - Intronic
1079435447 11:20443169-20443191 ATTTACAATGCCTGGGTGGCAGG - Intronic
1080244475 11:30164037-30164059 TTTTCCACAGACTGGGTAGTGGG + Intergenic
1080244541 11:30164505-30164527 TTTTCCACAGACCAGGTGGTGGG + Intergenic
1080437079 11:32255030-32255052 TGTTCCACTGTCAGGTTGGCTGG + Intergenic
1080954504 11:37077687-37077709 TTTTCCACGGACTCGGGTGCAGG + Intergenic
1081194081 11:40140007-40140029 TTTTCCACCTACTGTGTGTCAGG + Intronic
1081311963 11:41585365-41585387 TTTCCCAGTGATTGGATGGCTGG + Intergenic
1081475093 11:43421844-43421866 TTTTCCAAAGACTGGGGGGTGGG - Intronic
1083555579 11:63623608-63623630 TTTTCCAGAGACGGGGTGGAAGG + Intergenic
1083576677 11:63796901-63796923 TTTTCCACAGACAGGGTTGGGGG + Intergenic
1083813694 11:65119874-65119896 TACTCCATTTACTGGGTGGCTGG - Intergenic
1084610717 11:70201199-70201221 TATTCCACTGTCTGGGTGTTTGG - Intergenic
1085156984 11:74304869-74304891 TTTTCCACGGACCGGGGGGTTGG + Intronic
1085541730 11:77276733-77276755 CTTTACACTGACTTGGTGACTGG - Intronic
1085608305 11:77922842-77922864 TTTTCCAGTGACTGGTTTGCTGG + Intronic
1086486071 11:87303351-87303373 TTTTCCACTGACTGGGTGGCTGG - Intronic
1088205492 11:107387600-107387622 TTTTCCACAGACAGGGTGGCAGG + Intronic
1088482118 11:110304144-110304166 TTTTCCACAGACTGGCGGGCGGG - Intergenic
1088619130 11:111664080-111664102 TTTTGCACTTACTGGCTGGAAGG - Intronic
1088736289 11:112730380-112730402 TTTTCCACTAATGGGGTGGGGGG - Intergenic
1089110512 11:116052248-116052270 TATTCCACTGGCTGGATGGGTGG + Intergenic
1089397838 11:118147433-118147455 TATTCCACTCACTGGGTGTGTGG - Intronic
1089549123 11:119256959-119256981 TTATCCACTCATTGGTTGGCAGG + Intronic
1089570716 11:119407138-119407160 TTTTCCATGGACTGGGTGAGGGG + Intergenic
1089706781 11:120283825-120283847 TATTCCACTGACTGGTGGGCAGG - Intronic
1091574444 12:1720324-1720346 TTTTCCATGGACTGGTGGGCAGG + Intronic
1091658929 12:2367112-2367134 TTTTCCACTGACTGAAGGGATGG + Intronic
1092805381 12:12217501-12217523 TTTTCCACGGACTGGGCTGGAGG - Intronic
1092969941 12:13683856-13683878 TTTTACATTGCCTGGGTGTCAGG + Intronic
1093879151 12:24383746-24383768 TTTTCCAAGGACTGGTTGGGGGG + Intergenic
1095178935 12:39124768-39124790 TTTTCCACGGACTTGGGGGTAGG + Intergenic
1096189231 12:49604314-49604336 TTCTCCGCTGGCTGGGTGACTGG - Exonic
1096218658 12:49813327-49813349 CTTCACACTTACTGGGTGGCTGG - Intronic
1098172750 12:67763108-67763130 TTTTCCATAGACAGGGTGGGGGG - Intergenic
1099485462 12:83224127-83224149 TCTTCCACAGAATGTGTGGCGGG + Intergenic
1099814320 12:87625564-87625586 TTTTCCACACACTTGGTGGGGGG - Intergenic
1099863529 12:88249347-88249369 TTTTCCACAGACGGGTTGGGGGG - Intergenic
1100225351 12:92550793-92550815 TTATCCACTTACTGAGAGGCTGG + Intergenic
1100691567 12:97043800-97043822 TTGTACACTGCCTGGGTGGTGGG + Intergenic
1101749056 12:107567842-107567864 TTTTCCACAGACTGGGGGTAGGG - Intronic
1102419401 12:112791963-112791985 TTGTCCACTGACTCACTGGCTGG + Exonic
1102532808 12:113559069-113559091 TTTCCCACTGGCTAGGTTGCAGG + Intergenic
1102574597 12:113848382-113848404 GTGCCCACTGCCTGGGTGGCTGG + Intronic
1103860058 12:124005039-124005061 TTTTCCACAGACTGGGGGCAGGG - Intronic
1104023380 12:125008682-125008704 TTTTCCATGGACTGGGTCGGGGG + Intronic
1104650639 12:130529743-130529765 TTTTCCACAGACTGGGGTGGGGG + Intronic
1105669806 13:22600594-22600616 TTTTCCACAGACTGGGCGGAAGG + Intergenic
1107386649 13:39917146-39917168 TTTTTCACTGACTCGGTTGTTGG + Intergenic
1107389818 13:39952404-39952426 TTTCCCATTGGCTGGGTGACTGG + Intergenic
1107574006 13:41697495-41697517 TTTCCCACTGACTGGGGAGGTGG + Intronic
1107593607 13:41937193-41937215 TTTTCCACAGACTGGGGGGAGGG + Intronic
1109176701 13:59166573-59166595 TTTTCCACAGACTGGGGGGTGGG - Intergenic
1109226618 13:59704045-59704067 TTTTCGACTGATTGTCTGGCAGG + Intronic
1110330911 13:74271196-74271218 TTTTCCACAGATGGGGTGGGAGG - Intergenic
1110358364 13:74595504-74595526 TTTTCCACGGACTGGGGGTGGGG + Intergenic
1110918287 13:81050815-81050837 ATTTCCACTTCCTGGGTAGCTGG - Intergenic
1111005316 13:82240119-82240141 TTTTGCACTGACTCTTTGGCTGG - Intergenic
1111633822 13:90877529-90877551 CTTGCCTCTGACTGAGTGGCTGG + Intergenic
1113190502 13:107740085-107740107 TTTTCCACAGACTGGGGGAGAGG - Intronic
1114581952 14:23769303-23769325 TTTTCCACGGACTGGGGAGGCGG + Intergenic
1116089292 14:40284566-40284588 TTTTCCACAGACTGGGAGTCAGG + Intergenic
1117138815 14:52765660-52765682 TTTTCCACGGATGGGGTGGCGGG + Intronic
1117396860 14:55319577-55319599 TCTTTCCCTGAATGGGTGGCAGG + Intronic
1117533915 14:56686412-56686434 TTTTCTACTGAATGGGTGTCTGG + Intronic
1117581136 14:57152863-57152885 TTTTCCACAGACTGAGGGGATGG - Intergenic
1117767745 14:59100478-59100500 TTTTCCACAGACTGGGTCGGGGG + Intergenic
1118187976 14:63554779-63554801 TTTTCCACTGACTGGGGTGTGGG + Intergenic
1118626777 14:67666739-67666761 TGTTCCAATGACTGTGGGGCAGG - Intronic
1118776284 14:68976347-68976369 CTTTCTACTGACTGGGAGGCGGG - Intronic
1119253667 14:73179642-73179664 TTTTACACTGTCTGGGTGTTAGG + Intronic
1119480337 14:74954635-74954657 TTTTCTCCTGGGTGGGTGGCCGG - Intronic
1119907310 14:78317536-78317558 TTTTCCACAGATGGAGTGGCAGG - Intronic
1120275478 14:82367982-82368004 TTTACCACTGAATGGGTGTGTGG - Intergenic
1120635682 14:86948152-86948174 TTTTCCACAGACTGGGGGGAGGG + Intergenic
1120703803 14:87726707-87726729 TTTTCCAGTGTGTGGGTGGTTGG - Intergenic
1121798239 14:96753413-96753435 TTTTTCACAGACTGGGTGGGGGG - Intergenic
1121958587 14:98237818-98237840 TTTTCCACGGACTGGGAGCAGGG + Intergenic
1122926842 14:104907102-104907124 TCATCCCCTGACCGGGTGGCTGG - Intergenic
1123140191 14:106069216-106069238 TTTTCCTATGACTTGGTAGCTGG + Intergenic
1124440253 15:29680491-29680513 TTTTCCATGGACTGGGTTGCAGG + Intergenic
1125062187 15:35437741-35437763 TTTGCCACTGACTGGTTTGCTGG - Intronic
1125708264 15:41761969-41761991 TTATCCTTTGACTGGGTGGTGGG + Intronic
1125979477 15:43987477-43987499 TTTTCCACGGACCAGGTTGCAGG + Intronic
1126328835 15:47510340-47510362 TTTTCCATAAACTGGGGGGCAGG - Intronic
1128178194 15:65575794-65575816 TTTTAAACTCACTGGGAGGCTGG + Intronic
1129406254 15:75320563-75320585 TTTTCCACAGACGGGGTTGGGGG - Intergenic
1129735218 15:77957056-77957078 TTTTCCACAGACGGGGTTGGGGG + Intergenic
1135065428 16:19305583-19305605 TCTGCCACTTACTGGCTGGCAGG + Intronic
1135241223 16:20808159-20808181 CTTTCCACTGACTGGGAGAAGGG - Intronic
1135506973 16:23047432-23047454 TTCTCCACTGACTGCCTGGAAGG + Intergenic
1137639706 16:50017828-50017850 TTTTCCACGGACTGGGGAGGTGG - Intergenic
1139375047 16:66491630-66491652 TTTTCCACAGACAGGGTGGAGGG + Intronic
1139456672 16:67084998-67085020 TGTGCCACTGACTAGGTGTCAGG + Intronic
1140704496 16:77614015-77614037 TTATCCACTGACTGGCTGACTGG - Intergenic
1141137764 16:81477821-81477843 TTTCCCACTAACTGGAAGGCAGG - Intronic
1141680596 16:85541555-85541577 TTGTCCACGGAGTGGCTGGCAGG - Intergenic
1143209613 17:5175432-5175454 TTTTCCACGGACTGGGGGGATGG - Intergenic
1143460729 17:7101856-7101878 TTCTCCCCAGACTGGGTAGCAGG - Intronic
1143646786 17:8235362-8235384 TTTGCCACTGCCTGGGTTCCAGG + Intronic
1144617792 17:16792289-16792311 TTTTCCACGGACTGGGGGGATGG + Intronic
1144619094 17:16804892-16804914 TTTTCCACGGACTGGGGGGATGG - Intergenic
1144893606 17:18510803-18510825 TTTTCCACGGACTGGGGGGCTGG + Intergenic
1144894912 17:18523393-18523415 TTTTCCACGGACTGGGGGGCTGG - Intergenic
1145137311 17:20420841-20420863 TTTTCCACGGACTGGGGGGCTGG + Intergenic
1145138617 17:20433471-20433493 TTTTCCACGGACTGGGGGGCTGG - Intergenic
1146544354 17:33725396-33725418 TTGTCCACTCACGGGGAGGCAGG + Intronic
1148138582 17:45311892-45311914 TTTTCCACCCTCAGGGTGGCTGG + Intronic
1149447240 17:56722904-56722926 TTAAGCACTCACTGGGTGGCAGG + Intergenic
1149505137 17:57188028-57188050 GTTTCCAGGGACTGGGAGGCTGG + Intergenic
1149870531 17:60176774-60176796 TTTTCCACGGACTGGGGGATGGG + Intergenic
1150151030 17:62808784-62808806 TCTGCCACTGACTGGGTGCCTGG - Intergenic
1150455828 17:65305634-65305656 TTTTCCATGGGCTGGGTGGGGGG + Intergenic
1150924265 17:69516058-69516080 TTTTCCATGAACTGGGTGGGGGG + Intronic
1152283530 17:79399223-79399245 ACTGCCACGGACTGGGTGGCTGG - Intronic
1152422328 17:80200618-80200640 TTTTCCACAGACCGGGTTGTGGG + Intronic
1153148934 18:2067865-2067887 TTTTCAGCTGACTGGGTTGCAGG - Intergenic
1153406595 18:4747787-4747809 TTTTCCACAGATGGGCTGGCAGG - Intergenic
1155263434 18:24067672-24067694 TTTTCCATGGACTGGGTTGAGGG - Intronic
1155528170 18:26738714-26738736 TTTTCCACGGACAGGGTGGTGGG - Intergenic
1155702215 18:28760691-28760713 TTTTCCACGGACAGGTTGGATGG - Intergenic
1158421137 18:57295541-57295563 TTTTCCACTGACCGGGTGGTAGG - Intergenic
1160213100 18:76900854-76900876 TTTTCCACAGATTGGGGGTCGGG + Intronic
1160398284 18:78588243-78588265 AGTACCCCTGACTGGGTGGCTGG - Intergenic
1160414690 18:78700267-78700289 TTATTCACTCTCTGGGTGGCTGG - Intergenic
1161657314 19:5524291-5524313 TATTCCACTGCTGGGGTGGCTGG - Intergenic
1161997420 19:7721985-7722007 TTTTCCACAGACTGGGGTGGGGG + Intergenic
1162676083 19:12299344-12299366 CTTTCCACTGACAGTATGGCAGG - Intergenic
1162676776 19:12304998-12305020 TTTTCCACAGACTGCGGGGGAGG + Intergenic
1163024090 19:14499687-14499709 TTTTCCCCTGACAGAGTGGGAGG - Intergenic
1163689008 19:18728431-18728453 TTTTCAAGTGACTTGGTGTCAGG - Intronic
1164774995 19:30845960-30845982 TTCTCCACTGACTGGGTAGGGGG + Intergenic
1166233732 19:41441318-41441340 TTTTCCATAGACTGGGGGTCGGG + Intergenic
1166315124 19:41985305-41985327 TTTTCCACCAACTGTGTGGAAGG - Exonic
1168384692 19:55953413-55953435 TTTTCCATGGACCAGGTGGCGGG - Intronic
925744184 2:7030702-7030724 TTTTCCACAGACTGGGCAGGGGG + Intronic
926286549 2:11493294-11493316 TTTTCCACAGACAGGGTGTGGGG + Intergenic
926618967 2:15029794-15029816 TTTGCCACTGACTGCCTGGGAGG + Intergenic
926715861 2:15922936-15922958 CTCTCCATTGACTGTGTGGCAGG + Intergenic
927448717 2:23188115-23188137 TTTTCCACTGATGGGGAGCCAGG + Intergenic
927856868 2:26533243-26533265 TTTTCCACAGACTGGGATGGTGG - Intronic
928154723 2:28866382-28866404 TTTTCCACAGACTGGGGAGAGGG + Intronic
928243263 2:29605139-29605161 TTTTCCACGGACAGGGGGGTGGG + Intronic
928675257 2:33644668-33644690 TTTTCCACAGACTGGGAGTGGGG - Intergenic
929215675 2:39409353-39409375 TTTTCCACTACATGGGGGGCTGG + Intronic
929417359 2:41756968-41756990 TTTTCCACAGACTGGAGGGGGGG + Intergenic
929559803 2:42949156-42949178 TTTTCCACTTTCTAGGTTGCTGG + Intergenic
930666962 2:54108627-54108649 TTTTCCCCCGAGTTGGTGGCTGG + Intronic
930706691 2:54511477-54511499 TTTTCCACTGACGGGTTGTGGGG + Intronic
932020724 2:68083426-68083448 TTTTCCATGGACTGGGTTGGTGG - Intronic
932420592 2:71599146-71599168 TTCTCCACTGTGTGGGTGTCTGG - Intronic
934818142 2:97348247-97348269 TTTTCCACAAACTGGGGGGTGGG - Intergenic
935254768 2:101299971-101299993 TTATCCACTGCCTGGGAGGTTGG + Intronic
935730033 2:106057523-106057545 TTTTCCCCTGAGTGTGTTGCAGG - Intergenic
936819198 2:116498136-116498158 TTTACCACTGATGGGTTGGCTGG + Intergenic
937288193 2:120766275-120766297 CTTCACACTGTCTGGGTGGCAGG - Intronic
937902755 2:127034574-127034596 TTTTCCACGGACTGGGATGGGGG - Intergenic
938048633 2:128146767-128146789 TTTGCCAATGGCAGGGTGGCTGG - Intronic
940375100 2:152948833-152948855 TTTTCCATAGACTGGCTGGTGGG + Intergenic
940453271 2:153867541-153867563 TTTTCCACAGACTGGGAGAGGGG + Intergenic
941748590 2:169112321-169112343 GTTTCCAGAGACTGGGGGGCAGG - Intergenic
941878774 2:170461060-170461082 TTTTCAGCTGCCTGGGGGGCTGG + Intronic
943248166 2:185483199-185483221 TTTTCCATGGACTGGGTGGAGGG - Intergenic
944300911 2:198123896-198123918 TTTTCCATGGACTGGGGGGCTGG - Intronic
944624130 2:201552666-201552688 TTTTCCACTGCATGGGTAGGGGG + Intronic
945104018 2:206291202-206291224 TTTTCCACAGATGGGGTGGAGGG + Intronic
946458086 2:219845401-219845423 TTTGCCACTGACTGGCTGTGTGG + Intergenic
946474473 2:219994309-219994331 TGTTGCACTGACTCTGTGGCTGG + Intergenic
946770896 2:223087154-223087176 CTTTCTACTTACTGCGTGGCAGG + Intronic
947658857 2:231851621-231851643 TTTTCCACAGACGGGGTGGGAGG + Intergenic
948438846 2:237972495-237972517 TTTCACACTCACTGGGTGCCAGG - Intronic
948602555 2:239115718-239115740 TCTTCCGCTGAGTGGGTGGTGGG - Intronic
1168805070 20:667746-667768 AAATCCACTGACTGGGTGTCTGG - Intronic
1169150216 20:3283540-3283562 CTTTCCACTGAGTGCCTGGCTGG + Intronic
1169550320 20:6695527-6695549 TTTTCCACGGACTGGGGTGGTGG + Intergenic
1170233819 20:14079911-14079933 TTTTCCACAGACTGGGGGTAGGG - Intronic
1170561169 20:17559821-17559843 TTTTCCACAGACGGGGTGGCAGG - Intronic
1170663320 20:18363538-18363560 TTTTCCACTGACCAGGTGCAGGG + Intergenic
1172610880 20:36251690-36251712 TTTACCACAGCCTGGGAGGCAGG - Intronic
1173952520 20:47004774-47004796 TTTTCCTCTGCCTGGGAAGCAGG - Intronic
1174044480 20:47723893-47723915 TTTTCCACGGACTGGGGGTGAGG - Intronic
1174167019 20:48592350-48592372 TTTTCCACAGACCAGGGGGCAGG + Intergenic
1174524838 20:51162666-51162688 TGTGCCACTGGCTGTGTGGCTGG + Intergenic
1174906461 20:54557264-54557286 TTTTCCACAGACGGGGTTGGGGG + Intronic
1174940170 20:54918317-54918339 TCTTGCACTGACTGGGTTCCTGG + Intergenic
1175694951 20:61095471-61095493 TTTTCCATGAACTGGGTGGTGGG + Intergenic
1176308530 21:5137053-5137075 TTTTCCACAGACAGGGTTGGGGG - Intronic
1176868396 21:14069362-14069384 TTTTACACTAACTGGGGGGGGGG - Intergenic
1177723994 21:24943796-24943818 TTTTTCACTGACTGGGAGCGGGG + Intergenic
1178955769 21:37020249-37020271 TTTTTAATTAACTGGGTGGCTGG - Intergenic
1179848529 21:44124979-44125001 TTTTCCACAGACAGGGTTGGGGG + Intronic
1179925344 21:44531092-44531114 CCTTTCACTGACAGGGTGGCTGG + Exonic
1179949428 21:44701392-44701414 TTTTCCACGGACTGGGGAGGGGG + Intronic
1181480591 22:23196613-23196635 TTTTCCACAGACTGGGGGTTAGG + Intronic
1182458117 22:30465446-30465468 TATTTGACTGACTGGCTGGCTGG - Intronic
1182722544 22:32415034-32415056 TTTTCCACTGACTGGGATTGGGG + Intronic
1183245948 22:36693504-36693526 TTTTCCACTGTCTAGGTCACTGG - Intronic
1183384404 22:37506736-37506758 TTCTCCACTGACTGGGATGCTGG - Intronic
1183621575 22:38976221-38976243 TTTTCCACTGACAGGGTGAGGGG - Intronic
949584379 3:5423557-5423579 CTTTCCACTAAGTGGGTGGGTGG + Intergenic
949612907 3:5721150-5721172 ATTTACAGTGAATGGGTGGCAGG - Intergenic
950374855 3:12562981-12563003 TTTTCCACGGAATGGGGGGATGG - Intronic
950515167 3:13460369-13460391 ATGTCCACAGACTGGGTGGTGGG + Intergenic
950670810 3:14524346-14524368 TTCTCCACTGCCTCGGTTGCGGG - Intronic
950758406 3:15197734-15197756 TTTTCCACAGACTGCGGGGATGG + Intergenic
950761678 3:15235539-15235561 TTTTCCACAGACTGGGGGGTGGG + Intronic
953027543 3:39153618-39153640 TTTTCCACTGACGAGGAGGGCGG - Intronic
955400096 3:58585453-58585475 GGTTCCAGTAACTGGGTGGCGGG + Intronic
956601603 3:71028630-71028652 TTTTCCAGGAACTGGGGGGCAGG + Intronic
956999007 3:74862744-74862766 TTTTCCACTCTCTGGATGGAAGG + Intergenic
957736548 3:84211098-84211120 TTTTCCACTGACTGAATGGAGGG + Intergenic
958461153 3:94397619-94397641 AATACCACAGACTGGGTGGCTGG - Intergenic
958465542 3:94453380-94453402 TTTTCCACAGACTTTGTGGAAGG + Intergenic
960804906 3:121574278-121574300 TTTTCCACGGACTGGTTGGGGGG + Intronic
960879678 3:122331880-122331902 TTTTCCACAGATGGGGTGGAGGG + Intronic
962285486 3:134082620-134082642 TTTTCCACAGACCTGGAGGCAGG - Intronic
962486298 3:135845863-135845885 TTTTCCACTTACTCTGTGCCAGG - Intergenic
963040158 3:141064615-141064637 TGTACCACTGTCTGGGTGGGAGG + Intronic
963301079 3:143597756-143597778 TTTTACACTTACTGGCAGGCAGG + Intronic
963354957 3:144199882-144199904 TTTTCCAATAACTGAGTGGCTGG + Intergenic
965452632 3:168857439-168857461 TTTTCCACAGGCTTGGTGCCTGG + Intergenic
965853674 3:173062768-173062790 TTTTCCACGGACAGGTTGGAGGG + Intronic
965971172 3:174558331-174558353 TTTTCCACAGACTGGGTACGGGG + Intronic
966184150 3:177213297-177213319 ATACCCACTGCCTGGGTGGCTGG + Intergenic
967056055 3:185829280-185829302 TTTTCCACAGACAGGTTGGGGGG + Intergenic
968438152 4:606201-606223 TTTTCCACAGACTAGGCGTCGGG - Intergenic
968443616 4:636863-636885 GTGTCCACTGGCTGGATGGCTGG - Intronic
969378466 4:6778739-6778761 TTTTCCATGGACTGGGTGGAGGG + Intergenic
970038809 4:11772503-11772525 TTTTCCACAGACTGGGATGGGGG + Intergenic
970900483 4:21152900-21152922 TTTTCCACAGACAGGGTTGGGGG - Intronic
971103442 4:23495938-23495960 TTTTACTCTGATTTGGTGGCAGG + Intergenic
972396006 4:38660492-38660514 TTTGCCAGTGACTGGTTGGAGGG - Intergenic
973205481 4:47555337-47555359 TTTTCCACAGACGGGTTGGGTGG - Intronic
975345348 4:73286854-73286876 TTTTCCACACACTTGGTGTCAGG - Intergenic
975960746 4:79901561-79901583 TTTTCCACAGACCGGGGGGTGGG + Intronic
976787218 4:88835455-88835477 TTTTCCACAGACTAGGGGGTGGG + Intronic
977302100 4:95279843-95279865 TTTTCCACTGACTGCTGGGGCGG + Intronic
978554053 4:109959528-109959550 TTTTCCACTGAGTCTCTGGCTGG - Intronic
979161301 4:117464654-117464676 TTTTCCAGGGACCGGGTGGGGGG - Intergenic
979257572 4:118620988-118621010 TTTTCCACAGACTGGGAGTGAGG - Intergenic
979330777 4:119419559-119419581 TTTTCCACAGACTGGGAGTGAGG + Intergenic
979837269 4:125386902-125386924 TTTTCCACATACTGGGTGGGAGG + Intronic
980851986 4:138394288-138394310 TTTACCACTGACTGGTTTGATGG + Intergenic
981207123 4:142055801-142055823 TTTTCCACTGACCTGGGGGTGGG + Intronic
981520034 4:145651777-145651799 TTTTCCACAGACTGGGGGTAAGG + Intronic
981786306 4:148483108-148483130 TTTTCCACAGACTGGGGTGGGGG - Intergenic
982039770 4:151385244-151385266 TTTTCCACAGACTGGGGTGGAGG + Intergenic
982079894 4:151778978-151779000 TTTTCCACAGACTGGGCTGGAGG - Intergenic
982086301 4:151840210-151840232 TTTTCCACAGACTGGGGGTGGGG - Intergenic
982484442 4:155950855-155950877 TTTTCCACGGACTGGGGTGTGGG - Intronic
984246619 4:177282575-177282597 ATTTCCACTCACTGGGTTACAGG + Intergenic
984466746 4:180109452-180109474 TTTTCCACAGATGGGGTGGGTGG - Intergenic
985529468 5:425199-425221 TTTCCCACCCACTGGGTGCCTGG + Intronic
985530014 5:428585-428607 TTTTCCACAGACTGGGAGTGGGG + Intronic
985636898 5:1040221-1040243 TTTTCCACGGACGGGGTGTGGGG - Intergenic
987133278 5:14879011-14879033 TTTTCCACAGACTGGGGGCAGGG - Intergenic
987790073 5:22553766-22553788 TTTTCCACAGATAGGGTGGGAGG + Intronic
988546105 5:32159025-32159047 TTTGCCACTCAGTGCGTGGCAGG - Intronic
988689482 5:33558149-33558171 TTTTCCACGGACTGGGGGAATGG - Intronic
989469155 5:41795059-41795081 TTTTCCACAGACTGGGGGATGGG + Intronic
989512433 5:42303814-42303836 TTTTCCACAGACTTGTTGGGTGG - Intergenic
989552379 5:42751015-42751037 TTTTCCACAGACTGGGATGGGGG - Intergenic
990468861 5:56094873-56094895 TTTTCCACGGACGGGGTGCGGGG + Intergenic
990568779 5:57056792-57056814 TTTTCCACAGACCGGGTAGTGGG - Intergenic
990612112 5:57468117-57468139 TTTTCCACAGACTGGGGGGTGGG + Intergenic
991444621 5:66685862-66685884 TTTTCCATAGACTGGGAGGAGGG + Intronic
991448521 5:66726845-66726867 TTTTCCACGGACTGGGGGTAGGG - Intronic
992110144 5:73485083-73485105 TTTTCCACAGACTGGGAGACAGG - Intergenic
992129302 5:73675307-73675329 TTTTCTACTGAGTGGGTCACAGG + Intronic
992313045 5:75522234-75522256 TTTTCCACATACTTGGTGTCAGG + Intronic
992664076 5:78988879-78988901 TTTTCCACTGACCGGGCAGCAGG + Intergenic
993456494 5:88133144-88133166 TTTTCAACTGCCTGGGAGGCTGG - Intergenic
993770544 5:91919275-91919297 TTTTCCACAGACTGGGTGGGGGG + Intergenic
994952002 5:106475431-106475453 TTTTCCACTGATGGGGTGTGGGG - Intergenic
995463878 5:112430852-112430874 TTTTCCACAGACTTGGGGGTGGG + Intergenic
995791547 5:115893525-115893547 TTTTCAACTGCCTGGAAGGCTGG + Intronic
997358440 5:133279403-133279425 TTTTCCACAGACTGGGAGTGGGG - Intronic
997415136 5:133722311-133722333 TCTTCCACAGACTGGGTGGTGGG - Intergenic
998659049 5:144215699-144215721 TATTGCACTGACTGGGTGTCTGG - Intronic
998765516 5:145482593-145482615 TTTTCCACGAACTGGGTTGTTGG + Intronic
999186871 5:149717698-149717720 TTTTCCAGTGTCTGGGTAGAGGG + Intergenic
999587274 5:153103844-153103866 TTTTCCACAGACTGGGGGATGGG - Intergenic
1000471313 5:161645743-161645765 GTGTACACTGCCTGGGTGGCGGG - Intronic
1001312715 5:170622918-170622940 TTTTCCACGGACAGGGTGTGTGG + Intronic
1001359331 5:171065285-171065307 TTTTCCACAGAATGGGGGGGTGG + Intronic
1001448354 5:171805284-171805306 TTTTCCACTGCCTTGGTGCCGGG - Intergenic
1001709450 5:173766547-173766569 ATTTCCTCTGACAGGATGGCAGG - Intergenic
1002195641 5:177499557-177499579 TTTTCCACAGACTGGGGGTGGGG - Intergenic
1002550959 5:179991678-179991700 TTTTCCACAGACTGGCGGGTAGG + Intronic
1002949684 6:1797269-1797291 TTTTCCACTGACTGGGGGGTGGG - Intronic
1002954134 6:1845640-1845662 TTTTCCACGGACTGGGGGTGTGG + Intronic
1003371430 6:5531203-5531225 TTTTCCAGTGACTGGCTGAGGGG - Intronic
1004016287 6:11734944-11734966 TTTCCCACTCACTGGGTGAAAGG + Intronic
1004645681 6:17558638-17558660 TTTTCCACAGACAGGGTGGGGGG - Intergenic
1004673928 6:17823364-17823386 TTTTTCACAGTCTGGCTGGCTGG + Intronic
1007041689 6:38727849-38727871 TTTTCCAGTGACTGGGTGGCAGG + Intronic
1007915310 6:45556157-45556179 TTTTCCTTTCACTGGGAGGCAGG - Intronic
1008765293 6:54905254-54905276 TTTACTACTGACTGGGTGGCAGG + Intronic
1009428430 6:63540223-63540245 TTTTCTAGTGGCTGGGTGGTAGG - Intronic
1009432003 6:63574103-63574125 TTTTCAACTGACTGAGTAACAGG - Intronic
1010805720 6:80233939-80233961 TTTTCCACAGACTGGAGGGGTGG + Intronic
1011552483 6:88542529-88542551 TTAGCCATTGTCTGGGTGGCTGG - Intergenic
1012421206 6:99067301-99067323 TTTACCACTTACTGTGTGCCAGG + Intergenic
1013385489 6:109625679-109625701 TTTTCCACAGACTGGGTTGTGGG - Intronic
1014268364 6:119308199-119308221 TTTTCCACAGACAAGGTGCCAGG + Intronic
1014720481 6:124911695-124911717 TTTTCCATGGACAGGGTGGTGGG + Intergenic
1015147666 6:130005579-130005601 TTTTCTACAGACTGTGGGGCAGG + Intergenic
1015646175 6:135391310-135391332 TTTTCCATGGACTTGGGGGCAGG + Intronic
1016055271 6:139571874-139571896 TTTTCCACGGACTTGGGGTCGGG - Intergenic
1016417730 6:143850790-143850812 GTTGCCACTGTCTGTGTGGCAGG + Intronic
1016518052 6:144918796-144918818 TTTTCCATAGACAGGGAGGCAGG - Intergenic
1016702272 6:147067240-147067262 TTTCCCACGGACTGGGTAGGGGG + Intergenic
1017041257 6:150310160-150310182 TTTTCCACGGACTGGGAGTCGGG - Intergenic
1017093780 6:150785933-150785955 TTTTCCACAGACTGGATTGTGGG - Intronic
1018664466 6:166122350-166122372 TTTTCCACAGACTGGGGAGGAGG + Intergenic
1019675152 7:2307100-2307122 TTTTCTGTTGACTGGGTGGGAGG - Intronic
1021263995 7:18496252-18496274 TTTTCCTCAGATGGGGTGGCTGG + Intronic
1021738532 7:23662495-23662517 TTTTCCACGGACTGGGGAGGTGG - Intergenic
1022539808 7:31125137-31125159 TTTTCCAGGGACTGGGTGGCAGG + Intergenic
1023399556 7:39782263-39782285 TTTTCCACAGACTGGGAGTGAGG - Intergenic
1023423530 7:40010030-40010052 TTTTCCACAGACTGTGGGGGAGG + Intronic
1024403724 7:48953401-48953423 GATTCCATTGACTGGGTGACAGG + Intergenic
1024493678 7:50017022-50017044 TTTTCCACAGACTGGGAGGGTGG + Intronic
1025844594 7:65184997-65185019 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025894922 7:65691335-65691357 TTTTCCAGTGACTGGTTTGCTGG - Intergenic
1025937647 7:66049906-66049928 TTTTCCACTGACTAGGAGGCAGG + Intergenic
1026225269 7:68434729-68434751 TTTTCCACGGACTGGGGGTTGGG + Intergenic
1027375164 7:77540719-77540741 TTTTCCCCTGACTGGAAGGCTGG + Intronic
1028391826 7:90325884-90325906 TTTTCCACAGATGGGGTGGGTGG - Intergenic
1028600052 7:92591198-92591220 GTTTTCACTAACTGGGTGGCTGG + Intergenic
1030327147 7:108232314-108232336 GTTTCCACTTACTGGATGGGCGG + Exonic
1030661236 7:112221481-112221503 TTTTCCACAGACTGGGTTTTGGG + Intronic
1030771779 7:113484448-113484470 TTTTCCACGGACTGGGTGGTGGG - Intergenic
1031546206 7:123053765-123053787 TTTTCCACAGACTGGGGTGGTGG - Intergenic
1032049885 7:128641753-128641775 TTTTCCACAGACTGGGAGTGAGG - Intergenic
1032315707 7:130836577-130836599 TTTTCCCCTGACATGGTGACTGG - Intergenic
1032549549 7:132771687-132771709 TCTACCACTTCCTGGGTGGCAGG + Intergenic
1033282609 7:140016840-140016862 TTTCCCAGTGACTGGGTCGTAGG - Intronic
1034887231 7:154807120-154807142 CTTTGCCCTGACGGGGTGGCAGG - Intronic
1035774096 8:2173961-2173983 TTTTCCACGGACGGGGTGAGGGG + Intergenic
1036402550 8:8423173-8423195 TTTTCCACGAACGGGGTGGGAGG + Intergenic
1036586233 8:10126429-10126451 TTTTCCACAGACTGGGGGCAGGG + Intronic
1036692586 8:10953187-10953209 TTTTCCACAGACTAGGAGGGAGG - Intronic
1036772104 8:11586393-11586415 TTTTCCACAGACTGGGGAGAAGG - Intergenic
1038396114 8:27246819-27246841 TTTACCACTAACCGGGAGGCTGG - Intronic
1038607657 8:29024967-29024989 TTTTCCACCGACGGGGTGGGGGG - Intronic
1038729755 8:30116362-30116384 TTTTCCATGGACAGGGAGGCGGG + Intronic
1039042042 8:33417405-33417427 TTTTCCACAGACTGTGGGGCGGG - Intronic
1039042305 8:33419327-33419349 TTTTCCACAGACTGGGGTGGTGG + Intronic
1039851948 8:41376089-41376111 TTTTCCACTCATTTGGTGGATGG - Intergenic
1040010648 8:42658480-42658502 TTTTCCAGGGACTGGGTTGGGGG + Intergenic
1041040997 8:53845508-53845530 TCTTCCACAGACAGGGTGGGAGG - Intergenic
1041332966 8:56748384-56748406 TTTTCCACAGACTGGGGGTAGGG - Intergenic
1041439751 8:57882039-57882061 TTTTCCACAGACTGGGAGTAAGG - Intergenic
1041450711 8:58004019-58004041 TTTTCCACGGACTGGGGGATGGG + Intronic
1041694736 8:60723981-60724003 TCTGCCACTGACTGGCTGGGTGG + Intronic
1041746204 8:61211591-61211613 TTTGCCACTCACTGTGTGCCAGG + Intronic
1042398019 8:68313639-68313661 TCTTGCACTGAGTGGGTTGCTGG - Intronic
1042928491 8:73990664-73990686 TTTTCCACGGACTGAGGGGATGG - Intergenic
1043511862 8:80957874-80957896 TTTTGCCCTGCCTGGGTGACGGG - Intergenic
1043781342 8:84339637-84339659 TTTTCCACAAACTGGGGGGTGGG - Intronic
1045877529 8:106999734-106999756 TTTTCCACAGACAGGGTGGGGGG - Intergenic
1047951082 8:129935341-129935363 TTTTCCACGGACAGGGCGACAGG + Intronic
1049175434 8:141189698-141189720 TTTTCCCCTGACTTAGTGTCGGG + Intronic
1050807457 9:9698786-9698808 TTTTCCACCTACTTGGTGCCTGG + Intronic
1054733936 9:68731535-68731557 TTTTAGACTGAGTGGGTGGTTGG + Intronic
1055699803 9:78931276-78931298 TTTTCTACTGACTGGATCGGTGG + Intergenic
1055828819 9:80357642-80357664 GCTGCCACTCACTGGGTGGCTGG + Intergenic
1056110868 9:83393432-83393454 TTTTCCAACGACAGGGTGGTGGG + Intronic
1056144118 9:83712259-83712281 TTTTCCATGGACTGGGGGTCAGG - Intergenic
1056566585 9:87777952-87777974 TTTTCCACAGACTGGGGGGATGG + Intergenic
1059017268 9:110532940-110532962 TTTTCCACTGACTAGGGTACGGG + Intronic
1059499234 9:114737037-114737059 TTTTCCACTGACAAGGTTGAGGG + Intergenic
1060720297 9:125972114-125972136 TTGTCCACGGGCTGGGTTGCCGG - Intergenic
1060903056 9:127278664-127278686 TTTATCACAAACTGGGTGGCTGG + Intronic
1061107924 9:128546419-128546441 TTTTCAAATGACTGGGGGGAGGG + Intergenic
1061300398 9:129701354-129701376 TTGACCACTAACTGGGTGCCAGG + Intronic
1061581179 9:131537433-131537455 TTTTCCACAGACTGGGTAGGGGG + Intergenic
1186627949 X:11315235-11315257 TTTTCCACAGACAGTGCGGCGGG + Intronic
1187156439 X:16724452-16724474 TTGGCCACTGGCTGGGTGTCCGG - Intronic
1187386239 X:18851338-18851360 TTTTCCACAGACTGGGGTGGGGG - Intergenic
1188232842 X:27686818-27686840 TTTTCTACGGACTGGGTAGAGGG + Intronic
1188545989 X:31307913-31307935 TTTTCCACAGACTGGGAGGCAGG + Intronic
1189213281 X:39302594-39302616 TTTTCCATGGACAGGGTGGAGGG - Intergenic
1189344196 X:40228153-40228175 TTTTCCACAGACAGGGAGGTGGG + Intergenic
1189453181 X:41158718-41158740 TTTTCCACGGACTGGGGGGTGGG + Intronic
1189571191 X:42299417-42299439 TTTTCCACTGACTGAGAGGCAGG - Intergenic
1189629052 X:42932340-42932362 TTTTCCAGTGACTGTTTAGCGGG + Intergenic
1190287814 X:48972214-48972236 CTTTCCACAGTCTGGGGGGCAGG - Intergenic
1190379054 X:49820303-49820325 TTTTCCACAGACTGGGGAGTAGG - Intergenic
1192165551 X:68825468-68825490 TTTTCCACTTCCTGGCTGGGTGG + Intergenic
1192356680 X:70410584-70410606 TTTTCCACGGACTGGTTGTGGGG + Intronic
1192683567 X:73280348-73280370 TTTTCCATGGACTGGGGGGAAGG + Intergenic
1193227164 X:78998041-78998063 ATTAGGACTGACTGGGTGGCTGG + Intergenic
1194474980 X:94347328-94347350 ATTTCCACAAACTTGGTGGCTGG + Intergenic
1195944201 X:110191852-110191874 TTTTCCACGGATGGGGTGGGTGG + Intergenic
1196872299 X:120124650-120124672 TTTTCCATGGACTTGGTGGGCGG + Intergenic
1197260576 X:124312939-124312961 TTTTCCACACACTTGGTGCCTGG - Intronic
1197654825 X:129105614-129105636 TTTTCCATGGACTGGGGGGAAGG + Intergenic
1197840872 X:130745035-130745057 TTTTCCACAGACTGAGTCGGGGG - Intronic
1198066801 X:133106249-133106271 TTTTCCACAGACAGGGAGGATGG - Intergenic
1198828281 X:140721379-140721401 TTTTCCACGGACTGGGGGTGAGG + Intergenic
1199248195 X:145631170-145631192 TGTTCCACTGAGTGGGCTGCGGG + Intergenic
1199308322 X:146293126-146293148 ATTGGGACTGACTGGGTGGCTGG - Intergenic