ID: 1086486912

View in Genome Browser
Species Human (GRCh38)
Location 11:87315117-87315139
Sequence CAGTAGCAGCAGTAGTAGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 288}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086486912 Original CRISPR CAGTAGCAGCAGTAGTAGGG GGG (reversed) Intronic
903413811 1:23168224-23168246 CAGCAGCAGGAGGAGGAGGGCGG - Intronic
903549920 1:24150691-24150713 CAGTAGGAGGAGGAGGAGGGCGG + Intergenic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906277229 1:44525516-44525538 CACTTGCTACAGTAGTAGGGGGG - Intronic
906705293 1:47890377-47890399 CAGTAGCAGCAGTGATAGGCTGG + Intronic
906815105 1:48870690-48870712 CAGTAGGAGCTGTAGGAGTGGGG - Intronic
907332531 1:53680398-53680420 CAGTGGCACCAGTACTGGGGTGG + Intronic
907894545 1:58673872-58673894 CAGGAGCACCAGTAGCAGGTGGG + Intronic
908070533 1:60455089-60455111 CAGTGGCAGCAGTTGCATGGAGG - Intergenic
908723309 1:67148809-67148831 CAGTAGCAGCAGTGTTAGAACGG + Intronic
908930840 1:69314881-69314903 CAGTAGTGGCAGCAGTGGGGTGG + Intergenic
909170026 1:72282963-72282985 CAGCAGCAGCAGAAGCAGCGCGG + Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
912611674 1:111052924-111052946 CATTAGCAGCAGCAGCAGTGTGG - Intergenic
914826687 1:151142574-151142596 CAGCAGCAGCAGTAGCAGCAAGG + Exonic
916059537 1:161089234-161089256 CAGTAGCAGCAGCAGCAGCCAGG + Exonic
916203626 1:162294960-162294982 CAGCAGCAGCAGCAGTGGTGAGG - Intronic
917107731 1:171510173-171510195 CAGTAGCAGTAGGTGTAGGAAGG + Intronic
918270897 1:182898217-182898239 CAGTGGCAGCAACAGAAGGGAGG + Intergenic
919478429 1:198056577-198056599 CAGTGGCAGCAGTTGTAGGCAGG + Intergenic
919666332 1:200296368-200296390 TATTAGTAGCAGGAGTAGGGAGG - Intergenic
920038098 1:203078378-203078400 CAGTGGCAGGAGTTGTAGAGGGG - Exonic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
921764431 1:218953504-218953526 CAGCAGCAGCAGCAGGAGGGAGG + Intergenic
1062926721 10:1321670-1321692 TAGTAGCATCAGTAGCACGGTGG - Intronic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1063988679 10:11536201-11536223 CAGGACCACCAGTGGTAGGGTGG - Intronic
1064645341 10:17454199-17454221 CAGCAGCAGCAGCAGCAGGCTGG + Exonic
1065879618 10:30027567-30027589 CAGCAGCAGCAGCAGCAGTGAGG - Exonic
1067712123 10:48657689-48657711 CATTAGCAGCAGCAGAAGGTAGG + Intergenic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1069606387 10:69741408-69741430 CAATGGCAGCAGGAGTGGGGAGG - Intergenic
1070061276 10:72985418-72985440 GAGTGGCAGCAGTAGTAGGTTGG - Intergenic
1070267984 10:74923224-74923246 GAGTAGGAGAAGTAGAAGGGAGG + Intronic
1070634661 10:78115333-78115355 GAGTAGGAGTAGGAGTAGGGAGG + Intergenic
1072189052 10:93066011-93066033 CAGTAGCAGCAGGACGAGCGAGG - Exonic
1072336611 10:94403285-94403307 CAGCAGCTGCAGCAGTAGCGAGG + Exonic
1074453353 10:113577209-113577231 CAGACACAGCGGTAGTAGGGAGG - Exonic
1077370013 11:2177445-2177467 CAGCAGCAGTAGCAGAAGGGGGG - Intergenic
1077673574 11:4179200-4179222 CAGTGGCAGCAGCAGTAGGCAGG + Intergenic
1078148448 11:8738596-8738618 CAGTAGCAGCAGGGATGGGGAGG - Intronic
1080394211 11:31875069-31875091 CAGTAGCAGGAGCAGCAGGAGGG - Intronic
1081180842 11:39984289-39984311 CAGTAAGTGCAGTATTAGGGTGG - Intergenic
1081489179 11:43554181-43554203 CAGTGGCAGCAGCAAAAGGGAGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082039911 11:47676343-47676365 GAGTAGCAGCAGTGGTTGTGGGG - Intronic
1083880948 11:65547964-65547986 CAGTGGCAGGAGTAGTCAGGGGG + Exonic
1084687294 11:70704025-70704047 CCCCAGCAGCAGGAGTAGGGCGG - Intronic
1084764967 11:71302241-71302263 CAGCAGCAGCAGTAGGAGCATGG + Intergenic
1086093081 11:83023500-83023522 CAGTAGCACGAGTAGAAGAGAGG - Intronic
1086486912 11:87315117-87315139 CAGTAGCAGCAGTAGTAGGGGGG - Intronic
1086582346 11:88413683-88413705 TAGGGGCAGCAGTAGCAGGGTGG - Intergenic
1088206448 11:107397654-107397676 GAGCATCAGCTGTAGTAGGGTGG - Intronic
1088696267 11:112368656-112368678 CAGAAGCAGCAGGAGGAGGCTGG - Intergenic
1091111352 11:132971927-132971949 CAGCAGCAGTAGCAGCAGGGTGG - Intronic
1091826214 12:3514703-3514725 CAGGAGCACCAGTGGGAGGGTGG + Intronic
1094076987 12:26488068-26488090 CAGGAGAAGCAGTAGGAGGTAGG + Intronic
1094448949 12:30563501-30563523 CAGCAAAAGCAGTAGTAAGGAGG + Intergenic
1094523408 12:31216166-31216188 CAGAAGCAGCAGCAGCAGTGAGG - Intergenic
1095092985 12:38124218-38124240 CAGAAGGAGGACTAGTAGGGGGG - Intergenic
1095155607 12:38850175-38850197 CAGTAGGAACAGTGGGAGGGTGG - Intronic
1095262698 12:40115571-40115593 TAGCAGCAGCAGTTGTAGTGGGG + Intergenic
1095283398 12:40383475-40383497 CAGAAGCAGCAGTACAAAGGTGG + Intergenic
1095466972 12:42497856-42497878 CAGCAGCCGTAGGAGTAGGGAGG - Intronic
1095879223 12:47114599-47114621 CAGTAGCAGAAGTAGTGGGGAGG - Intronic
1096664558 12:53154540-53154562 GAGGAGCAGCAGGAGTGGGGAGG + Intergenic
1097140617 12:56899970-56899992 CAGGAGCAGCAGTGGTGGTGGGG + Intergenic
1098892748 12:76026305-76026327 CAGTAGCAGCCTTAGAAGAGTGG - Exonic
1099882519 12:88483909-88483931 CAGCAAAAGCAGTAGTAAGGGGG + Intergenic
1100776393 12:97979470-97979492 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1101303395 12:103503988-103504010 CAGTGGCAGAAGTATTAGGTTGG + Intergenic
1101966241 12:109284260-109284282 CAGTGGCAGGAGTAGTAGAGGGG - Intronic
1102262480 12:111452754-111452776 TGGTAGAAGCAGTAGAAGGGAGG + Exonic
1102522430 12:113486917-113486939 CAGAGGCAGCAGGTGTAGGGAGG - Intergenic
1102791845 12:115653107-115653129 CAGAAGCAGAAATAGAAGGGTGG - Intergenic
1103074154 12:117968888-117968910 CAGCAGCAGCAGCAGCAGCGCGG - Intronic
1103858279 12:123990346-123990368 GAGTAGCAACAGTAGTTAGGGGG - Intronic
1106063330 13:26317784-26317806 CAGCAAAAGCAGTAGTAAGGGGG + Intronic
1108639708 13:52371709-52371731 CAGCAGCAGCAGCAGGATGGGGG + Intergenic
1109476618 13:62887320-62887342 CATCAGCAGCAGTGGTAGAGTGG + Intergenic
1111296927 13:86291231-86291253 CTGTAGCAGGAGTAAGAGGGTGG - Intergenic
1112061287 13:95742069-95742091 CAGTGGCAGCAGCTGTAGGCAGG + Intronic
1113491186 13:110693328-110693350 CAGCACCAGCAGCAGTAGGTGGG - Intronic
1113823446 13:113231989-113232011 CAGTAGTAACAGTGGTAGGCGGG - Intronic
1114191690 14:20444014-20444036 CAGTGGCAGCAGTGGAAGTGAGG + Intergenic
1116725265 14:48554767-48554789 CAGCAGCAGCAGCAGCAGAGTGG - Intergenic
1119490263 14:75026004-75026026 CAGTAGCAGAGGGAGTAGAGAGG - Intronic
1119573753 14:75699685-75699707 GAGAAGCAGCAGCAGTAGCGAGG - Intronic
1119599017 14:75962175-75962197 CTGTAGCAGCAGGGTTAGGGTGG - Intronic
1119770198 14:77215823-77215845 CAGTAGAAGAAGTAGGAGGAGGG - Intronic
1120423349 14:84316026-84316048 CAGTGGCAGCAGTCTTAGGCAGG - Intergenic
1121862609 14:97332484-97332506 GAGGAGCAGCAGTAGTAAAGAGG - Intergenic
1122741919 14:103876325-103876347 CAGTGGCAGAAGTACCAGGGAGG + Intergenic
1122985331 14:105209124-105209146 CAGCTGCTGCAGTAGTTGGGGGG + Intergenic
1124047252 15:26161707-26161729 CAGTACCAGCAGGAGGAAGGTGG - Intergenic
1128809274 15:70558535-70558557 GTGGAGCAGCAGTAGGAGGGAGG - Intergenic
1130760961 15:86819229-86819251 CAGTAGTACTAGTAGTAGGTTGG + Intronic
1135606018 16:23825424-23825446 TAGTAGCAGTAGTAGTAGTATGG + Intergenic
1139447462 16:67006669-67006691 CAGAAGCAGCAGGAGTAGGGTGG + Intronic
1140854709 16:78967881-78967903 CAGTAGCTGCAGGAGGAGGAGGG + Intronic
1141393727 16:83686161-83686183 CAGTAGGCGCAGTGGTACGGAGG - Intronic
1143585514 17:7848511-7848533 CAGCAGGAGCAGTAGTGGTGGGG - Exonic
1143631514 17:8142885-8142907 CAGTAAGAGCAGTTGAAGGGAGG - Intronic
1144137756 17:12314618-12314640 CAGTGGCAGCAGCAGGAGGGTGG + Intergenic
1147262786 17:39218268-39218290 CAGCAGCAGCAGCAGCAGCGTGG + Intronic
1148238398 17:45984014-45984036 CAGAAGCAGCAGGAGTCGGGAGG - Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151961959 17:77410232-77410254 CAGTAGCAGCAGTGGGATGGGGG - Intronic
1153013792 18:565276-565298 CAGCAGCAGCAGCAGTGGGATGG - Intergenic
1155615356 18:27715725-27715747 CTGTAACATCAGAAGTAGGGAGG - Intergenic
1155674284 18:28410647-28410669 CAGTAGCGGCAGTACAAGGTAGG - Intergenic
1155779388 18:29811786-29811808 CAGCAGCAGCAGTAGCACAGTGG - Intergenic
1158001849 18:52628711-52628733 AGGTAGCAGCATGAGTAGGGAGG + Intronic
1158264684 18:55649092-55649114 CAGCGGCAGCAGTTGGAGGGAGG - Intronic
1159102221 18:63970153-63970175 CAGCAGCAGCAGCAGGAGGTGGG + Exonic
1159432955 18:68379503-68379525 AAGTTCCAGCAGTACTAGGGAGG + Intergenic
1160377369 18:78423185-78423207 CAGCAGCAGCAATAGCAGGGGGG - Intergenic
1160865096 19:1252847-1252869 CAGCAGCAGCAGCAGTGGCGTGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1163121373 19:15220192-15220214 CACTAGCAGAAGATGTAGGGCGG + Intergenic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1165377006 19:35449875-35449897 CAGCAGCAGCAGGAGGAGGTCGG - Exonic
1165896149 19:39142501-39142523 CAGATCCAGCAGAAGTAGGGTGG + Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167517047 19:49929514-49929536 CAGGCGCAGAAGTAGTACGGTGG + Exonic
927400342 2:22703697-22703719 CAGCAGCAGCAGTGGCAGTGGGG - Intergenic
927569350 2:24144775-24144797 CAGTGGCAGCAGGCATAGGGAGG - Intronic
928067014 2:28175201-28175223 CAGTAGCAGCAGGTGCAGGTAGG - Intronic
928436746 2:31259443-31259465 CAGTAGGAGCTGAAGTAGGAGGG - Intronic
928865616 2:35914307-35914329 CAGCAGCAGCAGTAGCAAGAGGG - Intergenic
929266063 2:39920357-39920379 CAGTGGCAGCAGCTGTAGGCAGG + Intergenic
929590562 2:43143061-43143083 CAGCAGCAGCAGCAGGAGGGAGG - Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929604360 2:43225373-43225395 CTGCAGCAGCAGCAGAAGGGGGG - Exonic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
931762359 2:65430080-65430102 GAGTAGCAGTAGTAGCAGTGAGG - Intronic
931939394 2:67235187-67235209 CAGAAGCAGCAGTAGGTAGGTGG - Intergenic
932061461 2:68503983-68504005 CAGTATCAACAGTAGAAGAGGGG + Intronic
932892971 2:75611933-75611955 CTGTCCCAGCAGCAGTAGGGAGG - Intergenic
933336322 2:80964198-80964220 CAGCAGCAGCAGCAGCATGGTGG + Intergenic
933816702 2:86074380-86074402 CAGTGGCAGCAGTTGTTGGAGGG - Intronic
935942162 2:108251464-108251486 CAGTAGTATCACTAGTAGTGAGG + Intronic
936598128 2:113868896-113868918 CAGCAGCAGCAGCAGAAGGAAGG + Intergenic
936676175 2:114717714-114717736 TAATAGCATCAGTAGAAGGGAGG - Intronic
937587039 2:123565218-123565240 CTGTAGCACCAGCACTAGGGGGG + Intergenic
937795554 2:126014417-126014439 AAGTAGCTGCAGTAAGAGGGAGG + Intergenic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
938975955 2:136479369-136479391 CAGTAGTGGCAGAAGTTGGGTGG + Intergenic
938989840 2:136616479-136616501 CAATGGCAGGAGTAGTAGGGAGG - Intergenic
940362732 2:152813474-152813496 CAGTGGCAGCTGCAGGAGGGAGG + Intergenic
941933238 2:170963422-170963444 CAGCAGCAGCAGTAGCAGCGGGG - Intronic
945357425 2:208856762-208856784 CTGCAGCAGCAGTAGCAGAGGGG + Intergenic
945400625 2:209378015-209378037 CAGCAGCAGAAGTGGTAGGCAGG + Intergenic
945521492 2:210833095-210833117 CAGTTGCAGCAGAAGCAGGTAGG + Intergenic
946939763 2:224758534-224758556 TTGTAGCAGCAGTAGCAGGTGGG + Intergenic
947043354 2:225949462-225949484 CAGCAGCAGCAGCCGTAGGTTGG - Intergenic
947118379 2:226795330-226795352 CGGTAGCAGCAGCAGCAGCGAGG - Exonic
948006852 2:234616804-234616826 CAGTAGCAGCAGAAGCGAGGAGG + Intergenic
948594592 2:239071595-239071617 CAGTCACAGCAGTAGCAGGCTGG - Intronic
948992760 2:241563151-241563173 CGGGAGCAGCAGGAGCAGGGAGG - Intronic
1169534733 20:6525739-6525761 CAGTAGCAGCAGCCATAGGCAGG + Intergenic
1170532997 20:17313381-17313403 CAGGAGCAGCAGGAGTGGGAGGG - Intronic
1170586082 20:17735155-17735177 CAATTGCAGAAGTAGTGGGGCGG + Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1172281507 20:33711064-33711086 CAGTAGCAGCTATAGGAGGGTGG + Intronic
1172699269 20:36843018-36843040 CAGTGGCAGCATGAGGAGGGAGG - Intronic
1173018203 20:39245725-39245747 CAGAGGCAGAAGGAGTAGGGAGG + Intergenic
1173855997 20:46251220-46251242 CAGCAGCAGCAGCAGTAGCGCGG + Exonic
1173856000 20:46251223-46251245 CAGCAGCAGCAGTAGCGCGGGGG + Exonic
1176955668 21:15100298-15100320 TAGTAGTAGTAGTAGTAGGCAGG - Intergenic
1177198421 21:17927606-17927628 TAATAGCAGCAGCTGTAGGGTGG + Intronic
1177198742 21:17930339-17930361 TATTAGCAGCAGTTGTAGGGAGG + Intronic
1178470969 21:32892433-32892455 CAGTAGCAGCAATACGTGGGAGG - Intergenic
1178514694 21:33236627-33236649 CAGTAGCAGCAGCAGTTGTTAGG + Intronic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1182460748 22:30481885-30481907 CAGCAGCAGGAGCAGGAGGGCGG + Intergenic
1183016659 22:34993981-34994003 TAGTAGTAGTAGTAGAAGGGAGG + Intergenic
1184933727 22:47702252-47702274 CAGCAGCAGCAGCAGCGGGGTGG - Intergenic
1184933728 22:47702255-47702277 CAGCAGCAGCAGCAGCAGCGGGG - Intergenic
950796050 3:15511546-15511568 CAGGAGCAGCATTGGTTGGGTGG - Intronic
952254486 3:31683729-31683751 CAGTAGAAGCAGGAGATGGGTGG + Exonic
953046643 3:39298719-39298741 CAGTAGCTGCAGTGGCAGGCTGG - Intergenic
953563449 3:44012390-44012412 GAGGAGCAGCAGCAGTAGGCTGG - Intergenic
954423008 3:50428513-50428535 CATTAGCAGCAAAAGCAGGGCGG + Intronic
955133793 3:56196104-56196126 TAGGAGCAGCAATAGTAGTGTGG - Intronic
956339883 3:68210666-68210688 TAGTAGCAGCAACAGTAGGGTGG - Intronic
956609144 3:71104392-71104414 CAGCAACAGCAGCAGAAGGGCGG - Intronic
957723901 3:84039441-84039463 CAGCAGCAGCAGTACTAGGAAGG + Intergenic
958481277 3:94648568-94648590 CAGAAGGAGGACTAGTAGGGGGG - Intergenic
958678599 3:97296618-97296640 CAGCAGCAGCAGTGGCAGTGAGG + Intronic
959940957 3:112080524-112080546 TAGTAGTAGTAGTAGTAGTGAGG - Intronic
960688145 3:120314231-120314253 CAGCAGCAGCAGCAGCATGGTGG - Intergenic
960811537 3:121631761-121631783 CATTTGCAGCAGGAATAGGGAGG + Exonic
963928715 3:150979193-150979215 GAGAAGCAGAAGGAGTAGGGAGG + Intergenic
964902030 3:161671210-161671232 CAGCAGGAGCAGTTGTAGGTAGG + Intergenic
966683385 3:182667433-182667455 CAGTAGCGGCAGTAGGTGGAGGG - Intergenic
967460895 3:189744550-189744572 TGGTAGCAGCAGTGGTTGGGTGG - Intronic
967528187 3:190518169-190518191 CTGTAGCAGCTGTGGTAGTGTGG + Intronic
969210299 4:5682192-5682214 CAGTAGTAGCAATAGCAGGCCGG + Intronic
969425202 4:7120247-7120269 AAGTAGCAGAAGTAGCAGGCAGG + Intergenic
970180274 4:13384367-13384389 CAGCAGCAGCAGCAGCACGGTGG - Intronic
971183090 4:24349306-24349328 CATCAGCTGCAGTAGTAGTGTGG + Intergenic
971321866 4:25612181-25612203 CAGTGGAAGCAGCAGAAGGGTGG + Intergenic
972028550 4:34420062-34420084 CAGTGCCAGCAGTAGTAGATTGG - Intergenic
972083432 4:35182708-35182730 CAGCAGCAGCAGTAGCAGTGTGG - Intergenic
973916078 4:55636112-55636134 CAGCAGCAGCAGCAGGAGCGGGG + Exonic
974205149 4:58692614-58692636 TAGTAAAAGCAGTATTAGGGGGG - Intergenic
975232870 4:71955339-71955361 CAGTAGCATTAGGTGTAGGGAGG + Intergenic
975491884 4:74998196-74998218 CAGTTGCAGCAGTTGGAGGTTGG + Intronic
976075471 4:81294016-81294038 CAGTAGCAGTTGGAGAAGGGTGG + Intergenic
976415954 4:84774875-84774897 TAATAGCAGCAATAGTAGGCTGG + Exonic
976492324 4:85685899-85685921 CAGTAGCTGAAGTAACAGGGTGG + Intronic
978442009 4:108743399-108743421 CAGCAGAAGCATTAGTAGGGAGG - Intronic
980398070 4:132241623-132241645 TAGTAGCAGTAGTAGTAGTAAGG + Intergenic
980792028 4:137632454-137632476 CAGCAGCAGCAGCAGCATGGGGG - Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
981511962 4:145567021-145567043 CAGCAGCAGCAGCAGCATGGCGG - Intergenic
981582549 4:146264654-146264676 CAGTTGCAGCAGGAGTTGTGAGG - Intronic
982215602 4:153080302-153080324 CAGTAGCAGCAGCAGCAGCCAGG + Intergenic
983238646 4:165207490-165207512 CAGCAGCAGCAGCAGGAGGAAGG + Intronic
988774681 5:34467119-34467141 CAGAAGGAGGACTAGTAGGGGGG + Intergenic
989068921 5:37490294-37490316 TTGCAGCAGCAGTAGTAGGCAGG + Intronic
990577255 5:57135392-57135414 CAGTAACAGCAGTTTTAGGCTGG - Intergenic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
992146723 5:73858055-73858077 CAGCAGCAGCAGTAGGAAAGTGG - Intronic
994946807 5:106404605-106404627 CAGTAGCAGGAGATGCAGGGAGG + Intergenic
996326958 5:122286280-122286302 CATCAGCTGCAGTAGTATGGGGG + Intergenic
997183499 5:131857956-131857978 CAGCAGCAGCAGTGGTGGGCTGG - Intronic
997659513 5:135578740-135578762 CAGCAGCAGCAGGAGCAGCGCGG + Exonic
997980707 5:138465944-138465966 CAGCAGCAGCAGCAGCAGCGGGG + Exonic
1001029522 5:168251760-168251782 CAGTAGCAGCAAAAGAATGGTGG + Intronic
1002396011 5:178955242-178955264 GAGTAGGAGCTGTAGTGGGGTGG + Intronic
1002455906 5:179345266-179345288 CAGCAGCAGCAGCAGCAGCGCGG + Exonic
1002940213 6:1709211-1709233 CAGCAGCAGCACTACAAGGGTGG - Intronic
1004082021 6:12404277-12404299 CAATAGTAGCAGTAGTCTGGGGG + Intergenic
1004421259 6:15472205-15472227 CAGAAACAGCAGTAGGAGGTGGG - Intronic
1004897891 6:20166605-20166627 CAGCAGCATCAGTAATTGGGTGG + Intronic
1005831257 6:29672861-29672883 CAATGGAAGCAGTAGTTGGGCGG + Exonic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006143875 6:31946715-31946737 GAGTAGGAGCAGTTTTAGGGTGG + Intronic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1008272570 6:49507152-49507174 CAGAAGGAGGACTAGTAGGGGGG + Intronic
1008716396 6:54295097-54295119 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1008716397 6:54295100-54295122 CAGCAGCAGCAGCAGCGGGGTGG + Intergenic
1009644368 6:66378305-66378327 CATCAGCTGCAGTAGTATGGGGG - Intergenic
1011744153 6:90393079-90393101 TAGTAGCAGCAGCAGTAGCTAGG + Intergenic
1012668917 6:102015650-102015672 CAGTAGCAGCAGCAGCACGGTGG - Intronic
1020607761 7:10359981-10360003 CAGAAGCAGCAGTAGCATGGCGG + Intergenic
1020725663 7:11810547-11810569 CAGTAACAGCAGCATTGGGGTGG - Intronic
1021131140 7:16913976-16913998 CAGTAGCAGCAGCAGCAGTGTGG - Intergenic
1021341540 7:19469225-19469247 CAGTAGGAGCAGTATCAGAGTGG - Intergenic
1022503016 7:30894338-30894360 CCATAGCAGCAGTTGGAGGGGGG - Intergenic
1024782287 7:52865230-52865252 CAGTGGCAGCAGGTGTAGGTAGG - Intergenic
1026642600 7:72140427-72140449 CAGGAGCAGCAGAAGGAGGTGGG - Intronic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028401625 7:90431240-90431262 CACCAGCTGCAGTAGTAGGAGGG - Intronic
1030358563 7:108570076-108570098 GAGGAGCAGCAGTAGTCGGAGGG + Exonic
1031820606 7:126496737-126496759 CAGTTGCAGAACTAGTAGGATGG + Intronic
1033148025 7:138887864-138887886 CAGCAGCAGCAGCAGCAGTGAGG + Intronic
1033300693 7:140182447-140182469 CAGTATCATTAGTAGTAGGAAGG - Intergenic
1037143057 8:15540507-15540529 CAGCAGCAGCAGGAGAAGGAAGG - Exonic
1037150026 8:15626066-15626088 CAGGAGCAGCAGTGGCAGTGGGG + Intronic
1037799619 8:22025257-22025279 CAGTAGCGCCAGTAGCACGGAGG + Exonic
1040370345 8:46764760-46764782 CAGTAGCAGCAGTAGCACCTAGG - Intergenic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042312075 8:67388795-67388817 CAGGAGCAGGAGGAGGAGGGAGG - Intergenic
1043131810 8:76472188-76472210 CAGCAGCAGCAGTAGCATGCAGG + Intergenic
1043291313 8:78605050-78605072 CTGTAGTAGCAGTAGTAGTAGGG + Exonic
1045326766 8:101123118-101123140 AGGCAGCAGCAGTAGTGGGGTGG - Intergenic
1045718319 8:105074905-105074927 CAGCAGCAGCAGCGGGAGGGAGG - Intronic
1047418934 8:124690141-124690163 CGGGAGCAGCAGCAGTGGGGAGG - Intronic
1048980906 8:139703132-139703154 CAGCAGCAGCAGCAGCAGCGGGG + Intergenic
1048980907 8:139703135-139703157 CAGCAGCAGCAGCAGCGGGGAGG + Intergenic
1049409027 8:142464242-142464264 CAGCAGCAGCAGTAGCAGCGGGG - Exonic
1049478579 8:142808232-142808254 CAGCAGCAGCAGCAGTGGGCTGG + Intergenic
1051553179 9:18353234-18353256 TAGTAGCAGCAGTGGTAAAGTGG + Intergenic
1052307219 9:27023996-27024018 CATCAGCTGCAGTAGTATGGGGG - Intronic
1052652872 9:31325978-31326000 CAGTGGCTGCCGCAGTAGGGTGG + Intergenic
1053030892 9:34777216-34777238 CAGTAGTGGCAGCAGTAGGCTGG + Intergenic
1053542847 9:38993161-38993183 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1053807293 9:41816678-41816700 CAGCAGCAGCAGTGGCAGCGAGG + Intergenic
1054623299 9:67370749-67370771 CAGCAGCAGCAGTGGCAGCGAGG - Intergenic
1055336841 9:75240273-75240295 CAGTTGCAGCAGTGGAAGAGTGG + Intergenic
1055391506 9:75826775-75826797 CAGCAGCATCAGTAGCAAGGAGG + Intergenic
1058144132 9:101392156-101392178 CAGCAGAAGCAGTAGTAAGAGGG + Intronic
1058229884 9:102412643-102412665 CAGCAGCAGCTGTAGTAAGATGG - Intergenic
1058596244 9:106618726-106618748 CAGTTGGAGGAGTAGCAGGGAGG - Intergenic
1058915639 9:109561738-109561760 CACCAGCAGCATTAGGAGGGAGG + Intergenic
1059860520 9:118455785-118455807 AACTAGCAGCAGTTGTAGAGAGG + Intergenic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1061396379 9:130346079-130346101 CGGTAGCAGCAGAAGGCGGGTGG + Intronic
1062084622 9:134642249-134642271 CAGCAGCAGCAGCAGCAGCGGGG - Exonic
1062403703 9:136383539-136383561 CAGCAGCAGCAGCAGCAGCGAGG - Exonic
1187856065 X:23637116-23637138 CAGTGGCAGCAGCTGTAGGCAGG - Intergenic
1188213947 X:27455148-27455170 GAGTAGGAGCAGAAGTGGGGAGG - Intergenic
1188707882 X:33357715-33357737 CAGCAGCAGCAGTAGCAGTATGG - Intergenic
1188722724 X:33543384-33543406 CAGTAGCAGTAGTTGTGGGCAGG - Intergenic
1189558047 X:42165718-42165740 CAGTGGCAGCAGCAGCACGGTGG + Intergenic
1190123000 X:47678854-47678876 TAGTAGCAGGAGTGGTGGGGTGG + Intergenic
1192737321 X:73861730-73861752 CAGTAGCAAAAGTGGCAGGGGGG + Intergenic
1193924128 X:87464561-87464583 CACCAGCAGCAGTAGTAGAAGGG - Intergenic
1193943763 X:87707751-87707773 CAGTGGCAGCATTTGTAGGTAGG + Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194353299 X:92849654-92849676 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1194366434 X:93019408-93019430 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic
1194422551 X:93695006-93695028 CAGTAGCACCAAGAGTAGTGAGG - Intronic
1195466350 X:105183339-105183361 CAGCAGCAGCAGTTGTATGCAGG + Intronic
1195541412 X:106067609-106067631 CAGTGGCAGCAGAAGTGTGGTGG + Intergenic
1197180050 X:123525133-123525155 CATTAGCAGCAGCAAGAGGGAGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198696043 X:139339396-139339418 CATTAGCTGTAGTAGTAGAGCGG + Intergenic
1199681250 X:150225960-150225982 CAGCAGCGGCAGCATTAGGGAGG + Intergenic
1200661657 Y:5966727-5966749 CAGCTGCAGAAGCAGTAGGGAGG - Intergenic
1200674661 Y:6135670-6135692 CAGTGGCAGCAGTGGAAGAGGGG - Intergenic