ID: 1086487635

View in Genome Browser
Species Human (GRCh38)
Location 11:87325546-87325568
Sequence CAGAGAATGGACAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086487635_1086487640 14 Left 1086487635 11:87325546-87325568 CCTGCCACCTTGTCCATTCTCTG No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086487635 Original CRISPR CAGAGAATGGACAAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr