ID: 1086487640

View in Genome Browser
Species Human (GRCh38)
Location 11:87325583-87325605
Sequence TTTATGTTAACTAGTCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086487639_1086487640 1 Left 1086487639 11:87325559-87325581 CCATTCTCTGCTTGCTGGTGTTA No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487632_1086487640 21 Left 1086487632 11:87325539-87325561 CCCTCTCCCTGCCACCTTGTCCA No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487636_1086487640 10 Left 1086487636 11:87325550-87325572 CCACCTTGTCCATTCTCTGCTTG No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487635_1086487640 14 Left 1086487635 11:87325546-87325568 CCTGCCACCTTGTCCATTCTCTG No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487633_1086487640 20 Left 1086487633 11:87325540-87325562 CCTCTCCCTGCCACCTTGTCCAT No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487634_1086487640 15 Left 1086487634 11:87325545-87325567 CCCTGCCACCTTGTCCATTCTCT No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data
1086487637_1086487640 7 Left 1086487637 11:87325553-87325575 CCTTGTCCATTCTCTGCTTGCTG No data
Right 1086487640 11:87325583-87325605 TTTATGTTAACTAGTCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086487640 Original CRISPR TTTATGTTAACTAGTCTCCT TGG Intergenic
No off target data available for this crispr