ID: 1086493062

View in Genome Browser
Species Human (GRCh38)
Location 11:87375221-87375243
Sequence GGACCCATGACAGCCTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086493060_1086493062 -7 Left 1086493060 11:87375205-87375227 CCAAGGTTGAGGACACGGACCCA No data
Right 1086493062 11:87375221-87375243 GGACCCATGACAGCCTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086493062 Original CRISPR GGACCCATGACAGCCTTAGG AGG Intergenic
No off target data available for this crispr