ID: 1086495455

View in Genome Browser
Species Human (GRCh38)
Location 11:87400002-87400024
Sequence GGCAAACCCAATAGTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086495455_1086495459 -7 Left 1086495455 11:87400002-87400024 CCATGGCCACTATTGGGTTTGCC No data
Right 1086495459 11:87400018-87400040 GTTTGCCTCGGCCTTTGAATGGG No data
1086495455_1086495462 8 Left 1086495455 11:87400002-87400024 CCATGGCCACTATTGGGTTTGCC No data
Right 1086495462 11:87400033-87400055 TGAATGGGAACCAGAGAGAATGG No data
1086495455_1086495458 -8 Left 1086495455 11:87400002-87400024 CCATGGCCACTATTGGGTTTGCC No data
Right 1086495458 11:87400017-87400039 GGTTTGCCTCGGCCTTTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086495455 Original CRISPR GGCAAACCCAATAGTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr