ID: 1086496742

View in Genome Browser
Species Human (GRCh38)
Location 11:87411863-87411885
Sequence CAGTGCTACCGGAATTTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086496742_1086496747 16 Left 1086496742 11:87411863-87411885 CCCACTAAATTCCGGTAGCACTG No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086496742 Original CRISPR CAGTGCTACCGGAATTTAGT GGG (reversed) Intergenic
No off target data available for this crispr