ID: 1086496747

View in Genome Browser
Species Human (GRCh38)
Location 11:87411902-87411924
Sequence CCAAAAAATGTCTCCAGACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086496739_1086496747 27 Left 1086496739 11:87411852-87411874 CCTGGCCTCTACCCACTAAATTC No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496741_1086496747 22 Left 1086496741 11:87411857-87411879 CCTCTACCCACTAAATTCCGGTA No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496745_1086496747 -8 Left 1086496745 11:87411887-87411909 CCTTAGTTGAGAGAACCAAAAAA No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496744_1086496747 5 Left 1086496744 11:87411874-87411896 CCGGTAGCACTGTCCTTAGTTGA No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496742_1086496747 16 Left 1086496742 11:87411863-87411885 CCCACTAAATTCCGGTAGCACTG No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496738_1086496747 28 Left 1086496738 11:87411851-87411873 CCCTGGCCTCTACCCACTAAATT 0: 2
1: 27
2: 311
3: 924
4: 1536
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data
1086496743_1086496747 15 Left 1086496743 11:87411864-87411886 CCACTAAATTCCGGTAGCACTGT No data
Right 1086496747 11:87411902-87411924 CCAAAAAATGTCTCCAGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086496747 Original CRISPR CCAAAAAATGTCTCCAGACA AGG Intergenic
No off target data available for this crispr