ID: 1086502020

View in Genome Browser
Species Human (GRCh38)
Location 11:87463541-87463563
Sequence TGGGAAACTGAATCTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1086502012_1086502020 5 Left 1086502012 11:87463513-87463535 CCATTGTCCTTCCAGACAACTGT No data
Right 1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG No data
1086502011_1086502020 18 Left 1086502011 11:87463500-87463522 CCTCTGGTTATTTCCATTGTCCT No data
Right 1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG No data
1086502017_1086502020 -6 Left 1086502017 11:87463524-87463546 CCAGACAACTGTGGTCATGGGAA No data
Right 1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG No data
1086502014_1086502020 -2 Left 1086502014 11:87463520-87463542 CCTTCCAGACAACTGTGGTCATG No data
Right 1086502020 11:87463541-87463563 TGGGAAACTGAATCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1086502020 Original CRISPR TGGGAAACTGAATCTGGGCA TGG Intergenic
No off target data available for this crispr